Next Article in Journal
Gram-Negative Bacterial Infections in Cardiac Implantable Electronic Devices: Insights from a Retrospective Analysis of Multidrug-Resistant and Non-Multidrug-Resistant Isolates
Previous Article in Journal
A Warming World, a Growing Threat: The Spread of Ticks and Emerging Tick-Borne Diseases
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 14
Issue 3
10.3390/pathogens14030214
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Detection of Anaplasma marginale in Amblyomma mixtum Infesting Cattle in the Major Livestock-Producing States of Mexico

by
Carolina Cárdenas-Amaya
1,
Dora Romero-Salas
1,*,
Marta Rafael
2,
Jenny J. Chaparro-Gutiérrez
3,
Sara López-Osorio
3,
Mariel Aguilar-Domínguez
1,
Miguel Á. Alonso-Díaz
4,
Adalberto Á. Pérez de León
5 and
José de la Fuente
2,6
1
Laboratorio de Parasitología, Rancho “Torreón del Molino”, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, Carretera Veracruz-Xalapa Km. 14.5, Col. Valente Díaz, Veracruz 91697, CP, Mexico
2
Grupo de Investigación en Sanidad y Biotecnología (SaBio), Instituto de Investigación en Recursos Cinegéticos (IREC), Consejo Superior de Investigaciones Científicas (CSIC), Universidad de Castilla-La Mancha (UCLM)-Junta de Comunidades de Castilla-La Mancha (JCCM), Ronda de Toledo 12, 13005 Ciudad Real, Spain
3
Grupo de Investigación Centro de Investigaciones Básicas y Aplicadas en Veterinaria (CIBAV), Facultad de Ciencias Agrarias, Universidad de Antioquia (UdeA), Carrera 75 No 65-87 Bloque 47-241, Medellín 050034, Colombia
4
Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical (CEIEGT), Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México, Km. 5.5 Carr. Fed. Martínez de la Torre-Tlapacoyan, Veracruz 93650, CP, Mexico
5
United States Department of Agriculture-Agricultural Research Service, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Avenue, Parlier, CA 93648, USA
6
Department of Veterinary Pathobiology, Center for Veterinary Health Sciences, Oklahoma State University, Stillwater, OK 74078, USA
*
Author to whom correspondence should be addressed.
Pathogens 2025, 14(3), 214; https://doi.org/10.3390/pathogens14030214
Submission received: 28 December 2024 / Revised: 14 February 2025 / Accepted: 18 February 2025 / Published: 21 February 2025
Browse Figures
Versions Notes

Abstract

:
Bovine anaplasmosis is a tick-borne disease caused by Anaplasma marginale, although mechanical transmission by biting flies also occurs. Infection with A. marginale can reach 26% mortality and morbidity is associated with reduced beef and milk production, causing economic losses for livestock producers. Between March 2022 and July 2023, 1920 ticks were collected from 52 cattle production units in major cattle-producing states in Mexico, including Chiapas, Jalisco, Michoacán, Tabasco, and Veracruz. Of all the ticks collected, 35.57% were morphologically identified as Amblyomma mixtum. Samples of A. mixtum from each state, totaling 271, were tested for A. marginale via polymerase chain reaction (PCR). A. marginale was detected molecularly in 15.3% of A. mixtum samples. A. mixtum from Chiapas had the highest prevalence of A. marginale (24.0%), followed by Tabasco and Veracruz (20.0% each), Jalisco (15.2%), and Michoacán (6.6%). Phylogenetic analysis supported the morphological identification of A. mixtum and confirmed the genetic identity of A. marginale. This research is the first report on the molecular detection of A. marginale in A. mixtum ticks in Mexico. Results suggest that this 3-host tick species might be a potential vector. A. mixtum is Mexico’s second most economically significant tick feeding on cattle after Rhipicephalus microplus. This information about A. marginale prevalence in A. mixtum expands our understanding of bovine anaplasmosis epidemiology in Mexico. Further research is needed to assess the role of A. mixtum as a vector of A. marginale.

1. Introduction

Anaplasma marginale is a tick-borne intracellular pathogen of the Anaplasmataceae family (order Rickettsiales) [1] and the causative agent of bovine anaplasmosis, which is of great economic importance for the livestock industry globally [2,3]. Bovine anaplasmosis causes severe hemolytic anemia, affecting the health and productivity of infected cattle, leading to decreased milk and meat production and, in severe cases, mortality [2,4]. Production losses, treatment costs, and associated control measures make bovine anaplasmosis one of the most economically impactful tick-borne infections globally [5,6]. In endemic areas, the economic impact is potentially severe due to the increased costs incurred during attempts to manage the disease at the herd level while losses are registered in terms of reproduction and beef production [7,8].
In addition to natural tick vectors, A. marginale can be transmitted to cattle by biting flies and iatrogenic means [1]. Bovine anaplasmosis is challenging to control due to A. marginale’s ability to establish persistent infections in its hosts, including via cattle and tick vectors, allowing continuous transmission within affected herds [9,10]. This persistence is mediated by molecular mechanisms that enable the pathogen to evade the host’s immune system, further complicating its management [11,12].
The global distribution of A. marginale includes tropical and subtropical regions in the Americas, Africa, and Asia, with multiple genotypes that vary in terms of infectivity and transmission capacity across different tick species [1,13]. The genetic diversity of A. marginale contributes to regional differences in disease severity and the success of control strategies in various geographic areas [7,14]. Bovine anaplasmosis is endemic in Mexico, where infection with A. marginale is reported in cattle and other species, like water buffalo, that may play a significant epidemiological role as reservoirs [15,16].
Rhipicephalus microplus and R. annulatus are known tick vectors of A. marginale in Mexico [16]. Anecdotal evidence suggests that the three-host tick, Amblyomma mixtum, may also serve as a vector of A. marginale in Mexico, where this tick-borne pathogen has a documented prevalence of 70% in cattle [17]. A. mixtum is regarded as the second most economically important tick affecting livestock in Mexico after R. microplus and can co-infest cattle alongside this one-host tick [18,19]. However, the role of A. mixtum in the transmission of A. marginale and its involvement in the epidemiology of bovine anaplasmosis remain to be determined.
A. mixtum is part of the A. cajennense species complex, with a wide distribution in Mexico and other Latin American countries [19,20,21]. Zoonotic pathogens including Rickettsia spp. and Ehrlichia spp. are known to be transmitted by A. mixtum [22]. Given its role as a vector of other pathogens, the ability of A. mixtum to transmit A. marginale may depend on environmental factors as well as tick population density in livestock areas [14,23].
Implementing molecular detection methods to monitor the presence of tick-borne pathogens like A. marginale in tick populations could enhance our epidemiological understanding and improve the control of bovine anaplasmosis [24]. This study aimed to detect the presence of A. marginale in A. mixtum and ascertain its prevalence in Mexico’s main livestock-producing states. The molecular detection of A. marginale in A. mixtum reported herein underscores the need to adapt suitable management plans and control measures to prevent cases of bovine anaplasmosis in areas of Mexico where A. mixtum infests cattle.

2. Materials and Methods

2.1. Study Area

A descriptive study was conducted, using a convenience sampling method, in order to collect ticks from cattle belonging to 52 cattle production units (CPUs) located in the primary Mexican states with the largest cattle inventories, including Chiapas, Jalisco, Michoacán, Tabasco, and Veracruz [25] (Table 1). Tick sampling took place from March 2022 to July 2023. The location of sampling sites within each state was determined based on published data describing the potential distribution of A. mixtum in these regions [21] (Figure 1). Most CPUs comprised other animals, including horses, dogs, laying hens, and pigs.

2.2. Collection and Taxonomic Identification of Specimens

Each bovine was inspected from head to tail and against the hair grain to locate ticks, as described [19]. Ticks were removed using entomological forceps by applying gentle vertical traction [26]. Each specimen was individually stored in vials containing 70% ethanol (v/v) for preservation. Tick identification was performed using a MOTIC® (Microscope World, Carlsbad, CA, USA) stereoscopic microscope and dichotomous taxonomic keys. Different taxonomic keys were used to distinguish A. cajennense [27], A. mixtum [20], and R. microplus [28].

2.3. DNA Extraction

Specimens identified as A. mixtum were individually processed using the TRI reagent (Sigma-Aldrich, St. Louis, MO, USA), a mixture of guanidinium thiocyanate and phenol, following the manufacturer’s protocol. DNA concentration and purity were assessed using a Nanodrop ONE® spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) via the quantification of nucleic acids at an optical density of 260 nm, with the ratio of absorbance set at 260/280 nm.

2.4. Polymerase Chain Reaction (PCR) Test

The quality of the DNA extraction protocol and tick species confirmation were appraised through the conventional polymerase chain reaction (PCR) of the 16S ribosomal DNA (16S rDNA) [29] gene and the cytochrome oxidase subunit I (COI) gene of 26 individual ticks [30] (Table 2). For pathogen detection, specific oligonucleotides and conditions were used to amplify a fragment of the 16S rDNA gene for Anaplasma spp. Subsequently, a second PCR procedure was performed to amplify the msp5 region corresponding to A. marginale using the conditions and oligos described previously [31] (Table 2).
PCR amplifications were performed in a total reaction volume of 25 µL, containing 12.5 µL of 2× PCR Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 2 µL of DNA template (~50 ng), and nuclease-free water, to complete the final volume. The PCR cycling conditions were as follows. We used 16S rDNA for tick molecular identification: we performed initial denaturation at 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 48 °C for 30 s, and 72 °C for 45 s, with a final extension at 72 °C for 5 min. We used COI for tick molecular identification: we performed initial denaturation at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. We used 16S rDNA for Anaplasma spp. molecular detection: we performed initial denaturation at 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 42 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 10 min. We used msp5 for A. marginale molecular identification: we performed initial denaturation at 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 54 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 10 min. Positive and negative controls were included in all PCR reactions to ensure the accuracy and reliability of the results. The positive control consisted of DNA from a confirmed Anaplasma marginale sample obtained from a bovine blood sample (for Anaplasma spp. molecular detection we used 16S DNA corresponding to A. ovis). The negative control consisted of nuclease-free water in order to confirm the absence of contamination. PCRs were conducted using a C1000 touch PCR thermal cycler (Bio-Rad, Hercules, CA, USA), with PCR fragments visualized in 1.5% agarose gel stained with GelRed (Biotium, Fremont, CA, USA) under UV transillumination conditions. Presumed positive samples were purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) and sent to Secugen in Madrid, Spain, for sequencing.

2.5. Phylogenetic Reconstruction

Chromas software v.2.6.6 was used to edit the sequences obtained. Homology analysis was performed using the National Center for Biotechnology Information (NCBI) database with the Basic Local Alignment Search Tool (BLAST 2.16.0). The sequences for Anaplasma marginale was deposited in the GenBank database (accession numbers P PV052636.1, PV052637.1 and PV052638.1). Phylogenetic reconstruction was performed using the Maximum Likelihood method. We selected the best nucleotide substitution model in the MEGA v.11 software [32] and applied the ClustalW algorithm for multiple sequence alignment [33]. We performed 1000 bootstrap replicates to assess the robustness of the phylogenetic groupings.

2.6. Statistical Analysis

The similarity of tick/pathogen/state variables was analyzed by applying a χ2 test and descriptive statistical analysis was performed using STATA software, version 14.0 [34]. Maps were created using QGIS (Geographic Information System) (3.38.2 version) [35].

3. Results

A total of 1920 adult ticks were collected from infested cattle. Of all the ticks collected, 64.4% were morphologically identified as R. microplus and 35.6% were morphologically identified as A. mixtum (Figure 2, Table 3). BLAST analysis of the sequences obtained for the 26 ticks tested revealed 98.9–100% identity with A. mixtum [GenBank accession numbers for 16S rDNA PV034243, PV034244 and PV034245, and for COX1 PV033859, PV033860 and PV033861 (Figure 3)].
PCR results revealed that all samples positive for the A. marginale 16S gene were also positive for the msp5 gene. Similarly, the samples were positive for both genes in their entirety; this was the case for species confirmation (Table 3).
A total of 271 A. mixtum ticks were processed for the molecular detection of A. marginale. For the first time, our study was able to detect the presence of A. marginale in A. mixtum (n = 47) in Mexico. The result represents an overall frequency of 17.3% (Table 3). PCR results revealed that all samples positive for the A. marginale 16S gene were also positive for the msp5 gene. The highest prevalence of A. marginale was observed in Chiapas (24.0%), followed by Tabasco and Veracruz (both at 20.0%), while Jalisco showed a prevalence of 15.2%, and Michoacán had the lowest prevalence (6.6%). Although lacking statistical significance (χ2 = 5.26, d.f. = 4, P = 0.262), these results suggest a heterogeneous geographic distribution of A. marginale infection in A. mixtum infesting cattle in the major livestock-producing states of Mexico (Table 3, Figure 1).
These results demonstrate the heterogeneous geographic distribution of A. marginale infection in A. mixtum; however, they are without representative statistical difference (χ2 = 5.26, d.f. = 4, P = 0.262) (Table 3, Figure 1).
With respect to pathogen molecular analysis, sequences of A. marginale msp5 obtained in this study showed high genetic identity with sequences previously reported in GenBank (Figure 4). The phylogenetic tree shows the evolutionary position of an isolate of A. marginale obtained from the tick A. mixtum (labeled as Anaplasma marginale isolate Amblyomma mixtum, with accession numbers PV052636.1, PV052637.1 and PV052638.1). These isolates fall within the main A. marginale clade, being grouped with other A. marginale isolates from Cervus elephanus (LC126872.1), as well as with other ectoparasite species such as Hyalomma schulzei (MN453603.1) and Haematopinus tubercuatus (MK310487.1).

4. Discussion

Our results detected, for the first time, the presence of A. marginale in A. mixtum ticks in Mexico. A. mixtum exposure to A. marginale might have occurred through co-feeding with infected R. microplus or by feeding on a bacteremic bovine. In this case, A. mixtum could be a mechanical vector, as has been shown for some biting flies where exposure to A. marginale results in a non-productive infection [16]. However, the vector competence of A. mixtum for Rickettsia spp. and Ehrlichia spp. suggests that this 3-host tick could be infected with A. marginale under certain conditions [22,36]. This possibility highlights the necessity for research to ascertain if A. mixtum can be involved in the transmission of A. marginale to bovine hosts.
Results from this study underscore the potential of A. mixtum as a vector of A. marginale. These findings are epidemiologically relevant for bovine anaplasmosis given the documented coexistence of A. mixtum and R. microplus, which is the principal vector of A. marginale in Mexico, on infested cattle. The frequency of A. marginale detected in A. mixtum showed statistically insignificant but biologically notable geographic variation among the Mexican states sampled. These differences may be influenced by environmental factors such as the specific climatic conditions of each region. For example, Chiapas and Tabasco, with tropical environments characterized by high temperatures and relative humidities [37,38], provide suitable habitats for the proliferation of A. mixtum, which can result in enhanced A. marginale transmission [14,39]. By contrast, conditions in Michoacán with relatively cooler conditions and apparently stricter livestock management practices [40,41] may be less conducive to finding cattle infested with the neotropical A. mixtum that are infected with A. marginale.
The overall detection rate obtained in this study, standing at 15.3%, agrees with previous molecular studies conducted in Latin America, where detection rates for A. marginale in A. mixtum ranged from 12% to 40% [8,24]. Factors influencing the molecular detection of A. marginale in A. mixtum included environmental conditions, vector density, and livestock management practices. Similarly, temperature, humidity, and cattle density influence the epidemiology of tick-borne diseases affecting cattle in tropical regions of South America [14,24]. However, this contrasts with the findings of [17], where A. marginale was not detected in A. mixtum. Several factors could account for these differences. First, regional variations in tick and host populations might influence the prevalence of A. marginale, as environmental and ecological factors can affect both the distribution of the vector and the pathogen [19]. Second, differences in sampling strategies, including the number and type of hosts from which ticks are collected, can impact detection rates. Third, methodological discrepancies, such as variations in DNA extraction protocols, target genes, or PCR sensitivity, can lead to divergent results. Lastly, temporal differences in studies may reflect changes in the epidemiology of A. marginale due to shifts in livestock management practices, vector control measures, or pathogen evolution over time. These factors highlight the importance of considering regional and methodological contexts when comparing findings across studies. Cattle management practices that influence the dynamics of A. marginale transmission include acaricide use and other tick-borne disease control measures [7]. The higher frequencies observed in tropical states like Chiapas and Tabasco also suggest that environmental conditions, combined with less stringent livestock management practices, may contribute to the high density of infected A. mixtum [14]. Conversely, states such as Michoacán and Jalisco, with lower prevalences, may benefit from more effective livestock management strategies or reduced contact between cattle and A. mixtum. Additionally, factors such as vegetation, water access, and cattle movement could also influence the geographic variation observed [42].
In Mexico, detecting and confirming the presence of A. marginale through molecular analysis emphasizes the need to manage populations of A. mixtum infesting cattle because of their potential in the epidemiology of bovine anaplasmosis [13]. The diversity of hosts A. mixtum parasitizes to complete its 3-host life cycle raises the specter of co-infection with pathogens that may include A. marginale. This multi-host life cycle complicates efforts to control vector-borne cattle diseases in areas of Mexico where A. mixtum and R. microplus coexist [23,43]. This situation reinforces the importance of an integrated approach to managing tick-borne diseases [44].
Integrated bovine anaplasmosis management would not only include interventions to control tick vectors but also measures to prevent infection and cure subclinical and clinical infections in affected bovines, taking into consideration aspects of the One Health concept [45,46,47]. Future research should evaluate the vectorial capacity of A. mixtum and its interaction with R. microplus and explore the impacts of coinfections on A. marginale transmission dynamics. This knowledge will allow informed decision-making to improve the prevention and management of bovine anaplasmosis in parts of the world like Mexico, where multiple tick vector species contribute to the intensity of endemic disease pressure on cattle herds [48].

5. Conclusions

The findings of this study support the hypothesis that A. mixtum is a potential vector of A. marginale. Molecular detection rates for A. marginale in A. mixtum collected from cattle in the main livestock-producing states of Mexico showed a heterogeneous geographic distribution. However, these differences were not statistically significant, indicating that additional factors may influence distribution and that larger studies are required to confirm this apparent trend. The highest detection rates were observed in the states of Chiapas and Tabasco, which are located in tropical areas.
A holistic approach through integrated bovine anaplasmosis management would address regional differences in tick vector ecology and disease epidemiology. Research is needed to determine if A. mixtum is a competent vector of A. marginale, its interaction with other vectors including R. microplus, and its impact on the risk of A. marginale transmission among cattle herds.

Author Contributions

Conceptualization, C.C.-A., D.R.-S., A.Á.P.d.L., M.A.-D. and M.Á.A.-D.; methodology, J.d.l.F. and M.R.; software, C.C.-A., M.R. and S.L.-O.; validation, A.Á.P.d.L. and J.d.l.F., D.R.-S. and J.J.C.-G.; formal analysis, C.C.-A., M.R. and S.L.-O.; investigation, C.C.-A., M.R. and D.R.-S.; resources, C.C.-A., D.R.-S. and J.d.l.F.; data curation, C.C.-A., M.R. and S.L.-O.; writing—original draft preparation, C.C.-A., D.R.-S. and A.Á.P.d.L.; writing—review and editing, C.C.-A., J.J.C.-G., S.L.-O., M.R. and A.Á.P.d.L. All authors have read and agreed to the published version of the manuscript.

Funding

Carolina Cárdenas Amaya is the recipient of a doctoral scholarship awarded by the Consejo Nacional de Humanidades, Ciencia y Tecnología (CONAHCYT), under grant number 999006, and is currently a student in the Doctoral Program in Agricultural Sciences at Universidad Veracruzana, Veracruz. The support provided by the Consortium of Mexican Universities (CUMex) in association with Ibero-American University Association for Postgraduate Studies (AUIP) through a mobility scholarship, which made this collaboration possible, is also acknowledged.

Institutional Review Board Statement

This project was approved on 12 April 2023, by the Bioethics and Animal Welfare Commission of the Faculty of Veterinary Medicine and Zootechnics, Universidad Veracruzana, ensuring compliance with the required ethical standards.

Informed Consent Statement

Not applicable.

Data Availability Statement

All sequences obtained were deposited in the GenBank database, whose accession numbers were mentioned above, in the following link the accession number is placed and complementary information is provided: https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome (accessed on 27 December 2024).

Acknowledgments

We are grateful to the producers who provided access to their cattle and the veterinarians who facilitated tick collections. Thanks to the staff of the Parasitology Laboratory at the Faculty of Veterinary Medicine and Zootechnics, Universidad Veracruzana for their invaluable technical support, as well as the Grupo de Investigación en Sanidad y Biotecnología (SaBio) at the Instituto de Investigación en Recursos Cinegéticos (IREC)–CSIC, UCLM, JCCM, who collaborated in the execution of this study. It should be noted that all the individuals included in this study gave their consent to the study. We also acknowledge the veterinarians who contributed logistical support in the different states to sample ticks.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kocan, K.M.; De la Fuente, J.; Blouin, E.F.; Coetzee, J.F.; Ewing, S. The natural history of Anaplasma marginale. Vet. Parasitol. 2010, 167, 95–107. [Google Scholar] [CrossRef] [PubMed]
  2. Aubry, P.; Geale, D.W. A Review of Bovine Anaplasmosis. Transbound. Emerg. Dis. 2010, 58, 1–30. [Google Scholar] [CrossRef] [PubMed]
  3. Atif, F.A. Anaplasma marginale and Anaplasma phagocytophilum: Rickettsiales pathogens of veterinary and public health significance. Parasitol. Res. 2015, 114, 3941–3957. [Google Scholar] [CrossRef]
  4. Ristic, M. Infectious Blood Diseases of Man and Animals, Volume 2: Anaplasmosis; Academic Press: New York, NY, USA, 1968; pp. 473–542. [Google Scholar]
  5. Dumler, J.S.; Barbet, A.F.; Bekker, C.P.; Dasch, G.A.; Palmer, G.H.; Ray, S.C.; Rikihisa, Y.; Rurangirwa, F.R. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: Unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ’HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 2001, 51, 2145–2165. [Google Scholar] [CrossRef]
  6. Rodríguez, S.D.; Ortiz, M.Á.G.; Ocampo, R.J.; Murguía, C.A.V.Y. Molecular epidemiology of bovine anaplasmosis with a particular focus in Mexico. Infect. Genet. Evol. 2009, 9, 1092–1101. [Google Scholar] [CrossRef]
  7. Almazan, C.; Tipacamu, G.A.; Rodriguez, S.; Mosqueda, J.; Pérez de León, A.Á. Immunological control of ticks and tick-borne diseases that impact cattle health and production. Front. Biosci. 2018, 23, 1535–1551. [Google Scholar] [CrossRef]
  8. Frabetti, A.F.; Katiki, L.M.; Caetano, L.; Sarti, M.B.; Falasca, T.M.; Polli, H.; Verissimo, C.J.; Vercesi Filho, A.E.; de Oliveira, H.N.; de Sena Oliveira, M.C.; et al. Natural levels of Rhipicephalus microplus infestation and Anaplasma marginale infection in Angus and Ultrablack calves. Exp. Appl. Acarol. 2023, 89, 131–140. [Google Scholar] [CrossRef]
  9. Quiroz-Castañeda, R.E.; Amaro-Estrada, I.; Rodríguez-Camarillo, S.D. Anaplasma marginale: Diversity, virulence, and vaccine landscape through a genomics approach. BioMed Res. Int. 2016, 9032085. [Google Scholar] [CrossRef]
  10. Parodi, P.; Armúa-Fernández, M.T.; Schanzembach, M.; Mir, D.; Benítez-Galeano, M.J.; Rodríguez-Osorio, N.; Rivero, R.; Venzal, J.M. Characterization of strains of Anaplasma marginale from clinical cases in bovine using major surface protein 1a in Uruguay. Front. Vet. Sci. 2022, 9, 990228. [Google Scholar] [CrossRef]
  11. Palmer, G.H.; Bankhead, T.; Seifert, H.S. Antigenic Variation in Bacterial Pathogens. Microbiol. Spectr. 2016, 4, 28. [Google Scholar] [CrossRef]
  12. de La Fuente, J.; Garcia-Garcia, J.C.; Blouin, E.F.; Rodríguez, S.D.; García, M.A.; Kocan, K.M. Evolution and function of tandem repeats in the major surface protein 1a of the ehrlichial pathogen Anaplasma marginale. Anim. Health Res. Rev. 2001, 2, 163–173. [Google Scholar] [CrossRef]
  13. de la Fuente, J.; Blouin, E.F.; Manzano-Roman, R.; Naranjo, V.; Almazán, C.; Pérez de la Lastra, J.M.; Zivkovic, Z.; Jongejan, F.; Kocan, K.M. Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale. Genomics 2007, 90, 712–722. [Google Scholar] [CrossRef] [PubMed]
  14. Estrada-Peña, A.; Corson, M.; Venzal, J.M.; Mangold, A.J.; Guglielmone, A. Changes in climate and habitat suitability for the cattle tick Boophilus microplus in its southern Neotropical distribution range. J. Vector Ecol. 2007, 31, 158–167. [Google Scholar] [CrossRef]
  15. Hernández-Velasco, A.; Sánchez-Montes, S.; Romero-Salas, D.; Cruz-Romero, A.; Jiménez-Hernández, J.A.; Becker, I.; Aguilar-Domínguez, M. First record of natural infection with Anaplasma marginale in sucking lice infesting the water buffalo (Bubalus bubalis) in Mexico. Parasitol. Res. 2020, 119, 11. [Google Scholar] [CrossRef] [PubMed]
  16. Lira-Amaya, J.J.; Santamaria-Espinosa, R.M.; Castañeda-Arriola, R.O.; Martínez-García, G.; Polanco-Martínez, D.J.; Rojas-Martínez, C.; Alvarez-Martínez, J.Á.; Figueroa-Millán, J.V. Molecular Identification of Babesia spp. and Anaplasma marginale in Water Buffaloes in Veracruz and Tabasco, Mexico: A Retrospective Study. Microorganisms 2022, 10, 1702. [Google Scholar] [CrossRef]
  17. Ortiz-Ramírez, J.Á.; Rodríguez-Rojas, J.J.; Hernández-Escareño, J.J.; Galan-Huerta, K.A.; Rebollar-Téllez, E.A.; Moreno-Degollado, G.; Medina-De la Garza, C.E.; Sánchez-Casas, R.M.; Fernández-Salas, I. Molecular and Serological Identification of Anaplasma marginale and Borrelia burgdorferi in Cattle and Ticks from Nuevo Leon, Northern Mexico. Pathogens 2023, 12, 784. [Google Scholar] [CrossRef]
  18. Higa, L.O.S.; Barradas Piña, F.T.; Rodrigues, V.D.S.; Garcia, M.V.; Salas, D.R.; Miller, R.J.; Pérez de León, A.Á.; Barros, J.C.; Andreotti, R. Evidence of acaricide resistance in different life stages of Amblyomma mixtum and Rhipicephalus microplus (Acari: Ixodidae) collected from the same farm in the state of Veracruz, Mexico. Prev. Vet. Med. 2020, 174, 104837. [Google Scholar] [CrossRef]
  19. Cárdenas-Amaya, C.; Romero-Salas, D.; Aguilar-Domínguez, M.; Cruz-Romero, A.; Alonso-Díaz, M.A.; Sánchez-Montes, S.; González-Hernández, M.; Rosas-Saito, G.; Pérez de León, A.Á. Infestation of Cattle with the Tick Amblyomma mixtum in the States with the Highest Cattle Inventory in Mexico. Agro Prod. 2024, 17, 47–57. [Google Scholar] [CrossRef]
  20. Nava, S.; Beati, L.; Labruna, M.B.; Cáceres, A.G.; Mangold, A.J.; Guglielmone, A.A. Reassessment of the taxonomic status of Amblyomma cajennense (Fabricius, 1787) with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and Amblyomma patinoi n. sp., and reinstatement of Amblyomma mixtum Koch, 1844, and Amblyomma sculptum Berlese, 1888 (Ixodida: Ixodidae). Ticks Tick Borne Dis. 2014, 5, 252–276. [Google Scholar] [CrossRef]
  21. Aguilar-Domínguez, M.; Moo-Llanes, D.A.; Sánchez-Montes, S.; Becker, I.; Feria-Arroyo, T.P.; de León, A.P.; Romero-Salas, D. Potential distribution of Amblyomma mixtum (Koch, 1844) in climate change scenarios in the Americas. Ticks Tick Borne Dis. 2021, 12, 101812. [Google Scholar] [CrossRef]
  22. Castillo-Martínez, A.; Cueto-Medina, S.M.; Hernández-Rodríguez, S.; Salinas-Ramírez, N.; Romero-Santos, R.D.; Martínez-Patricio, G.; García-López, E. Amblyomma mixtum Koch (Acari: Ixodidae) en ambientes peridomésticos de la Región Otomí-Tepehua, Hidalgo, México. Rev. Chil. Entomol. 2020, 46, 661–669. [Google Scholar] [CrossRef]
  23. Cabezas-Cruz, A.; Vayssier-Taussat, M.; Greub, G. Tick-borne pathogen detection: What’s new? Microbes Infect. 2018, 20, 441–444. [Google Scholar] [CrossRef] [PubMed]
  24. Cotes-Perdomo, A.P.; Oviedo, A.; Castro, L.R. Molecular detection of pathogens in ticks associated with domestic animals from the Colombian Caribbean region. Exp. Appl. Acarol. 2020, 82, 13. [Google Scholar] [CrossRef] [PubMed]
  25. Servicio de Información Agroalimentaria y Pesquera (SIAP). Consulta de Inventario de Cabezas de Ganado en Pie. 2023. Available online: https://www.gob.mx/siap (accessed on 6 February 2023).
  26. Gammons, M.; Salam, G. Tick removal. Am. Fam. Physician 2002, 66, 643–645. [Google Scholar] [PubMed]
  27. Guzmán-Cornejo, C.; Robbins, R.G.; Guglielmone, A.A.; Montiel-Parra, G.; Pérez, T.M. The Amblyomma (Acari: Ixodida: Ixodidae) of Mexico: Identification Keys, Distribution and Hosts CARMEN GUZMÁN-CORNEJO (Mexico), RICHARD G. ROBBINS (USA), ALBERTO A. GUGLIELMONE (Argentina), GRISELDA MONTIEL-PARRA (Mexico) and TILA MARÍA PÉREZ (Mexico). Zootaxa 2011, 2998, 22. [Google Scholar] [CrossRef]
  28. Nava, S.; Venzal, J.M.; Acuña, D.G.; Martins, T.F.; Guglielmone, A.A. Ticks of the Southern Cone of America: Diagnosis, Distribution, and Hosts with Taxonomy, Ecology and Sanitary Importance; Academic Press: Newton, MA, USA, 2017; p. 348. [Google Scholar]
  29. Rodríguez, O.; De la Fuente, G.; De Mera, I.G.F.; Vaz-Rodrigues, R.; Gortázar, C.; De la Fuente, J. The Saharan antelope addax (Addax nasomaculatus) as a host for Hyalomma marginatum, tick vector of Crimean-Congo hemorrhagic fever virus. Ticks Tick Borne Dis. 2022, 13, 102034. [Google Scholar] [CrossRef]
  30. Coimbra-Dores, M.J.; Maia-Silva, M.; Marques, W.; Oliveira, A.C.; Rosa, F.; Dias, D. Phylogenetic insights on Mediterranean and Afrotropical Rhipicephalus species (Acari: Ixodida) based on mitochondrial DNA. Exp. Appl. Acarol. 2018, 75, 107–128. [Google Scholar] [CrossRef]
  31. Fernández, A.M.; Ortiz, J.A.; Jabbar, A.; Ghafar, A.; Cabezas-Cruz, A.; De la Fuente, G.; De la Fuente, J.; De Mera, I.G.F. Fatal cases of bovine anaplasmosis in a herd infected with different Anaplasma marginale genotypes in southern Spain. Ticks Tick Borne Dis. 2021, 13, 101864. [Google Scholar] [CrossRef]
  32. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 70 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  33. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
  34. Thrusfield, M. Veterinary Epidemiology, 3rd ed.; Blackwell Publishing Company: Oxford, UK, 2005; p. 626. [Google Scholar]
  35. QGIS Development Team. QGIS Geographic Information System. Open Source Geospatial Foundation Project. 2023. Available online: https://qgis.org (accessed on 7 August 2023).
  36. Mota, T.F.; Fukutani, E.R.; Martins, K.A.; Salgado, V.R.; Andrade, B.B.; Fraga, D.B.M.; Queiroz, A.T.L. Another tick bites the dust: Exploring the association of microbial composition with a broad transmission competence of tick vector species. Microbiol. Spectr. 2023, 11, 15. [Google Scholar] [CrossRef]
  37. de la Mora-Orozco, C.; Ruíz-Corral, J.A.; Flores-López, H.E.; Zarazúa-Villaseñor, P.; Ramírez-Ojeda, G.; Medina-García, G.; Rodríguez-Moreno, V.M.; Chávez-Durán, Á.A. Índices de cambio climático en el estado de Chiapas, México, en el periodo 1960–2009. Rev. Mex. Cienc. Agríc. 2016, 7, 13. Available online: http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S2007-09342016000902523&lng=es&nrm=iso (accessed on 20 October 2024).
  38. Instituto Nacional de Estadística y Geografía (INEGI). Conociendo Tabasco, 6th ed.; INEGI: Aguascalientes, México, 2016; Available online: http://www.inegi.org.mx (accessed on 13 November 2024).
  39. Oliveira, J.; Montoya, J.; Romero, J.; Urbina, A.; Soto-Barrientos, N.; Melo, E.; Ramos, C.; Araújo, F.R. Epidemiology of bovine anaplasmosis in dairy herds from Costa Rica. Vet. Parasitol. 2011, 177, 359–365. [Google Scholar] [CrossRef]
  40. Montiel-González, C.; Gallegos, Á.; Gómez, A.M.O.; Bautista, F.; Gopar-Merino, F.; Velázquez, A. Análisis climático para la agricultura de temporal en Michoacán, México. Ecosist. Recur. Agropec. 2019, 6, 307–316. [Google Scholar] [CrossRef]
  41. Valencia, J.B.; Hernández, M.Á.B.; Mejía, C.M.M. Diagnóstico del sector ganadero bovinos productores de carne de la Región V Tepalcatepec, Michoacán. South Fla. J. Dev. 2023, 4, 3345–3358. [Google Scholar] [CrossRef]
  42. Bermúdez, C.S.E.; Félix, M.L.; Domínguez, A.L.; Araúz, D.; Venzal, J.M. Molecular screening of tick-borne microorganisms in ticks from rural areas of Panama, with the first record of Ehrlichia minasensis in Rhipicephalus microplus from Central America. Vet. Res. Commun. 2024, 48, 1301–1308. [Google Scholar] [CrossRef]
  43. Rodríguez-Vivas, R.; Apanaskevich, D.; Ojeda-Chi, M.; Trinidad-Martínez, I.; Reyes-Novelo, E.; Esteve-Gassent, M.; De León, A.P. Ticks collected from humans, domestic animals, and wildlife in Yucatan, Mexico. Vet. Parasitol. 2016, 215, 106–113. [Google Scholar] [CrossRef]
  44. Urcuqui-Bustamante, A.M.; Leahy, J.E.; Sponarski, C.; Gardner, A.M. Collaborative Modeling of the Tick-Borne Disease Social-Ecological System: A Conceptual Framework. EcoHealth 2023, 20, 453–467. [Google Scholar] [CrossRef]
  45. Pérez de León, A.A.; Strickman, D.A.; Knowles, D.P.; Fish, D.; Thacker, E.; De la Fuente, J.; Krause, P.J.; Wikel, S.K.; Miller, R.S.; Wagner, G.G.; et al. One Health approach to identify research needs in bovine and human babesiosis: Workshop report. Parasites Vectors 2010, 3, 12. [Google Scholar] [CrossRef]
  46. Zortman, I.; De Garine-Wichatitsky, M.; Arsevska, E.; Dub, T.; Van Bortel, W.; Lefrançois, E.; Vial, L.; Pollet, T.; Binot, A.A. Social-ecological systems approach to tick bite and tick-borne disease risk management: Exploring collective action in the Occitanie region in southern France. One Health 2023, 17, 100630. [Google Scholar] [CrossRef]
  47. Lagunes-Quintanilla, R.; Gómez-Romero, N.; Mendoza-Martínez, N.; Castro-Saines, E.; Galván-Arellano, D.; Basurto-Alcantara, F.J. Perspectives on using integrated tick management to control Rhipicephalus microplus in a tropical region of Mexico. Front. Vet. Sci. 2024, 11, 1497840. [Google Scholar] [CrossRef] [PubMed]
  48. Nur-Amalina, N.; Nur-Sabrina, A.M.; Muhamad-Ali, H.A.M.; Basripuzi, N.H. Bovine anaplasmosis: A systematic review with meta-analysis on the global prevalence. Trop. Biomed. 2023, 40, 375–382. [Google Scholar] [CrossRef]
Pathogens 14 00214 g001
Figure 1. A geographical representation of CPUs sampled by state in Mexico, including CPUs reporting the presence of Amblyomma mixtum and the molecular detection of Anaplasma marginale in this tick. The map was created using QGIS (Geographic Information System).
Figure 1. A geographical representation of CPUs sampled by state in Mexico, including CPUs reporting the presence of Amblyomma mixtum and the molecular detection of Anaplasma marginale in this tick. The map was created using QGIS (Geographic Information System).
Pathogens 14 00214 g001
Pathogens 14 00214 g002
Figure 2. The taxonomic identity of adult ticks collected from cattle in cattle production units across the states sampled in Mexico: (A) Amblyomma mixtum (female); (B) Amblyomma mixtum (male); (C) Rhipicephalus microplus (female, engorged); (D) Rhipicephalus microplus (male).
Figure 2. The taxonomic identity of adult ticks collected from cattle in cattle production units across the states sampled in Mexico: (A) Amblyomma mixtum (female); (B) Amblyomma mixtum (male); (C) Rhipicephalus microplus (female, engorged); (D) Rhipicephalus microplus (male).
Pathogens 14 00214 g002
Pathogens 14 00214 g003
Figure 3. A phylogenetic tree of the partial COX1 sequence of Amblyomma mixtum, as inferred using the Maximum Likelihood method. Sequences from the samples in this study are marked with a black dot. GenBank accession numbers for the partial COX1 sequences are followed by the corresponding species name and the host from which they were obtained.
Figure 3. A phylogenetic tree of the partial COX1 sequence of Amblyomma mixtum, as inferred using the Maximum Likelihood method. Sequences from the samples in this study are marked with a black dot. GenBank accession numbers for the partial COX1 sequences are followed by the corresponding species name and the host from which they were obtained.
Pathogens 14 00214 g003
Pathogens 14 00214 g004
Figure 4. A phylogenetic tree of msp5 sequences of Anaplasma marginale isolated from Amblyomma mixtum ticks collected from Mexico. The sequences obtained in this study are marked with a tick symbol. The analysis was performed based on Maximum Likelihood Analysis with a Tamura-3-parameter model. The reliability of internal branches was assessed using the bootstrapping method with 1000 replicates.
Figure 4. A phylogenetic tree of msp5 sequences of Anaplasma marginale isolated from Amblyomma mixtum ticks collected from Mexico. The sequences obtained in this study are marked with a tick symbol. The analysis was performed based on Maximum Likelihood Analysis with a Tamura-3-parameter model. The reliability of internal branches was assessed using the bootstrapping method with 1000 replicates.
Pathogens 14 00214 g004
Table 1. The geographical description of the cattle production units, which were sampled according to the corresponding locality, municipality, and state in Mexico.
Table 1. The geographical description of the cattle production units, which were sampled according to the corresponding locality, municipality, and state in Mexico.
StateMunicipalityLocalityGeolocationElevation (m.a.s.l.)
LatitudeLongitude
ChiapasTapachulaOro Verde14.84200−92.3495310
Corlai14.87378−92.3628915
Tapachula14.90611−92.2950320
MapastepecAdolfo López Mateos15.44686−92.99903500
Dos Pasajes15.48253−93.06236520
La Trinidad15.54211−92.99906530
PijijiapanPuente Margaritas15.59361−93.04472540
La Herradura15.59669−93.07642550
Gabriel Toledo15.58256−93.17053560
Las Carmelitas15.60114−93.17806570
Caña Brava15.64281−93.17767580
Pijijiapan15.70444−93.22747600
TonaláAgua Prieta16.01653−93.62961700
PalenquePalenque17.53831−91.97250100
JaliscoCihuatlánEmiliano Zapata19.29353−104.714001500
La HuertaEl Progreso19.32539−104.819941520
Concepción de Buenos AiresConcepción de Buenos Aires19.99872−103.263971530
Encarnación de DíazConcepción de Buenos Aires20.01097−103.255031540
La Cuadra21.52769−102.191531550
MichoacánLázaro CárdenasLázaro Cárdenas17.98364−102.2397850
Buenos Aires18.03692−102.2795055
Playa Azul17.98908−102.3824460
El Habillal18.02278−102.3612865
El Habillal17.99297−102.3815870
ArteagaArteaga18.34197−102.2909475
Arteaga18.35228−102.2877580
AquilaEl Aguacate18.49844−103.2967285
TuxpanEl Malacate19.54581−100.477891600
MoreliaCañada de Buena Vista19.55433−101.253331610
Santiago Undameo19.59053−101.257781620
Santiago Undameo19.59289−101.258501630
ZamoraRomeo de Guzmán20.04158−102.248721640
Cuto de la EsperanzaCuto de la Esperanza19.72861−101.342171650
TabascoBalancánEl Tornillo17.84378−91.51683200
TacotalpaPuente de Piedra17.59256−92.61969210
HuimanguilloOcuapan17.83039−93.50228220
VeracruzCosoleacaqueCalzadas18.13028−94.52667230
San Juan EvangelistaRancho Azteca17.65839−94.96669240
Juan Rodríguez ClaraPerseveranza17.93864−95.19114250
CoatzacoalcosMatilla de Conejo18.06981−95.25825260
IslaMatilla de Conejo18.06369−95.27286270
Túxpam de Rodríguez CanoMatilla de Conejo18.17344−94.26556280
Manlio Fabio AltamiranoEl Tigre17.93589−95.36167290
TlapacoyanGuillermo Prieto18.17344−94.26556280
San Isidro18.08114−95.53406300
Lindavista20.81628−97.23894310
Mata Loma19.13728−96.30019320
San Francisco20.03556−97.10631330
Table 2. Oligonucleotides and references for the amplified genes.
Table 2. Oligonucleotides and references for the amplified genes.
GeneSequence 5′-3′ (F: Forward/R: Reverse)Fragment (bp)Annealing (°C)Reference
16Sr DNAF: CCGGTCTGAACTCAGATCAAGT
R:CTGCTCAATGATTTTTTAAATTGCTGTGG		46048[29]
COIF: GGTCAACAAATCATAAAGATATTGG
R: TAAACTTCAGGGTGACCAAAAATCA		65050[30]
16S rDNA (Anaplasma spp.)F: CAGAGTTTGATCCTGGCTCAGAACG
R: GAGTTTGCCGGGACTTCTTCTGTA		42142[31]
MSP5F:GCATAGCCTCCGCGTCTTTC
R: TCCTCGCCTTGGCCCTCAGA		45654[31]
Table 3. Tick distribution and prevalence of Anaplasma marginale in adult Amblyomma mixtum ticks collected from cattle in cattle production units across major livestock-producing states in Mexico.
Table 3. Tick distribution and prevalence of Anaplasma marginale in adult Amblyomma mixtum ticks collected from cattle in cattle production units across major livestock-producing states in Mexico.
Tick Taxonomic IdentificationA. marginale in A. mixtum
StateCPUs SampledTotal EctoparasitesR. microplus(%)A. mixtum(%)A. mixtum ProcessedPositive for A. marginale(%)IC 95%
Chiapas1419616182.23517.82562411.5–43.4
Jalisco826021482.34617.746715.27.5–28.2
Michoacán1436431987.64512.44536.622.9–17.8
Tabasco41446645.87854.275152012.5–30.4
Veracruz1295647749.947950.180162012.7–30.0
Total521920123764.468335.62714717.313.3–22.3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cárdenas-Amaya, C.; Romero-Salas, D.; Rafael, M.; Chaparro-Gutiérrez, J.J.; López-Osorio, S.; Aguilar-Domínguez, M.; Alonso-Díaz, M.Á.; Pérez de León, A.Á.; de la Fuente, J. Molecular Detection of Anaplasma marginale in Amblyomma mixtum Infesting Cattle in the Major Livestock-Producing States of Mexico. Pathogens 2025, 14, 214. https://doi.org/10.3390/pathogens14030214

AMA Style

Cárdenas-Amaya C, Romero-Salas D, Rafael M, Chaparro-Gutiérrez JJ, López-Osorio S, Aguilar-Domínguez M, Alonso-Díaz MÁ, Pérez de León AÁ, de la Fuente J. Molecular Detection of Anaplasma marginale in Amblyomma mixtum Infesting Cattle in the Major Livestock-Producing States of Mexico. Pathogens. 2025; 14(3):214. https://doi.org/10.3390/pathogens14030214

Chicago/Turabian Style

Cárdenas-Amaya, Carolina, Dora Romero-Salas, Marta Rafael, Jenny J. Chaparro-Gutiérrez, Sara López-Osorio, Mariel Aguilar-Domínguez, Miguel Á. Alonso-Díaz, Adalberto Á. Pérez de León, and José de la Fuente. 2025. "Molecular Detection of Anaplasma marginale in Amblyomma mixtum Infesting Cattle in the Major Livestock-Producing States of Mexico" Pathogens 14, no. 3: 214. https://doi.org/10.3390/pathogens14030214

APA Style

Cárdenas-Amaya, C., Romero-Salas, D., Rafael, M., Chaparro-Gutiérrez, J. J., López-Osorio, S., Aguilar-Domínguez, M., Alonso-Díaz, M. Á., Pérez de León, A. Á., & de la Fuente, J. (2025). Molecular Detection of Anaplasma marginale in Amblyomma mixtum Infesting Cattle in the Major Livestock-Producing States of Mexico. Pathogens, 14(3), 214. https://doi.org/10.3390/pathogens14030214

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop