Characterization of Fungal Pathogens Causing Blueberry Fruit Rot Disease in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling and Isolation
2.2. Morphology Characterization
2.3. DNA Extraction and PCR Amplification
2.4. Phylogenetic Analysis
2.5. Pathogenicity Assay
3. Results
3.1. Disease Symptoms and Fungal Isolation
3.2. Taxonomy
3.3. Pathogenicity Test
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Krishna, P.; Pandey, G.; Thomas, R.; Parks, S. Improving blueberry fruit nutritional quality through physiological and genetic interventions: A review of current research and future directions. Antioxidants 2023, 12, 810. [Google Scholar] [CrossRef] [PubMed]
- Kalt, W.; Cassidy, A.; Howard, L.R.; Krikorian, R.; Stull, A.J.; Tremblay, F.; Zamora-Ros, R. Recent research on the health benefits of blueberries and their anthocyanins. Adv. Nutr. 2020, 11, 224–236. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.M.; Tarafdar, A.; Chaurasia, D.; Singh, A.; Bhargava, P.C.; Yang, J.F.; Li, Z.L.; Ni, X.H.; Tian, Y.; Li, H.K.; et al. Blueberry fruit valorization and valuable constituents: A review. Int. J. Food Microbiol. 2022, 381, 109890. [Google Scholar] [CrossRef] [PubMed]
- Neugebauer, K.A.; Mattupalli, C.; Hu, M.; Oliver, J.E.; VanderWeide, J.; Lu, Y.; Sullivan, K.; Stockwell, V.O.; Oudemans, P.; Miles, T.D. Managing fruit rot diseases of Vaccinium corymbosum. Front. Plant Sci. 2024, 1, 1428769. [Google Scholar] [CrossRef]
- Rivera, S.A.; Zoffoli, J.P.; Latorre, B.A. Infection risk and critical period for the postharvest control of gray mold (Botrytis cinerea) on blueberry in Chile. Plant Dis. 2013, 97, 1069–1074. [Google Scholar] [CrossRef]
- Bell, S.R.; Hernández Montiel, L.G.; González Estrada, R.R.; Gutiérrez Martínez, P. Main diseases in postharvest blueberries, conventional and eco-friendly control methods: A review. LWT 2021, 149, 112046. [Google Scholar] [CrossRef]
- Saito, S.; Michailides, T.J.; Xiao, C.L. First report of Botrytis pseudocinerea causing gray mold on blueberry in north America. Plant Dis. 2014, 98, 1743. [Google Scholar] [CrossRef]
- Li, Q.; Hou, Z.Q.; Yu, J.P. First report of Botrytis californica causing gray mold on blueberry in China. Plant Disease 2023, 107, 3318. [Google Scholar] [CrossRef]
- Wharton, P.S.; Schilder, A.C. Novel infection strategies of Colletotrichum acutatum on ripe blueberry fruit. Plant Pathol. 2008, 57, 122–134. [Google Scholar] [CrossRef]
- Eaton, M.J.; Edwards, S.; Inocencio, H.A.; Machado, F.J.; Nuckles, E.M.; Farman, M.; Gauthier, N.A.; Vaillancourt, L.J. Diversity and cross-infection potential of Colletotrichum causing fruit rots in mixed-fruit orchards in Kentucky. Plant Dis. 2021, 105, 1115–1128. [Google Scholar] [CrossRef]
- Polashock, J.J.; Caruso, F.L.; Averill, A.L.; Schilder, A.C. Compendium of Blueberry, Cranberry, and Lingonberry Diseases and Pests, 2nd ed.; APS Press: St. Paul, MN, USA, 2017; pp. 9–134. [Google Scholar]
- Ingram, R.J.; Ludwig, H.D.; Scherm, H. Epidemiology of exobasidium leaf and fruit spot of rabbiteye blueberry: Pathogen overwintering, primary infection, and disease progression on leaves and fruit. Plant Dis. 2019, 103, 1293–1301. [Google Scholar] [CrossRef] [PubMed]
- Alvarez Osorio, A.K.; Miles, L.A.; Miles, T.D. Mummy berry of blueberry caused by Monilinia vaccinii-corymbosi: A diagnostic guide. Plant Health Prog. 2022, 23, 362–368. [Google Scholar] [CrossRef]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; Volume 38, pp. 315–322. [Google Scholar]
- Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [PubMed]
- Staats, M.; van Baarlen, P.; van Kan, J.A.L. Molecular phylogeny of the plant pathogenic genus Botrytis and the evolution of host specificity. Mol. Biol. Evol. 2004, 22, 333–346. [Google Scholar] [CrossRef] [PubMed]
- Guerber, J.C.; Liu, B.; Correll, J.C.; Johnston, P.R. Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia 2003, 95, 872–895. [Google Scholar] [CrossRef]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
- Reeb, V.; Lutzoni, F.; Roux, C. Contribution of RPB2 to multilocus phylogenetic studies of the Euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming acarosporaceae and evolution of polyspory. Mol. Phylogenet. Evol. 2004, 32, 1036–1060. [Google Scholar] [CrossRef]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
- Alves, A.; Crous, P.W.; Correia, A.; Phillips, A.J.L. Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae. Fungal Divers. 2008, 28, 1–13. [Google Scholar]
- O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
- Zhang, W.; Groenewald, J.Z.; Lombard, L.; Schumacher, R.K.; Phillips, A.J.L.; Crous, P.W. Evaluating species in Botryosphaeriales. Persoonia 2021, 46, 63–115. [Google Scholar] [CrossRef]
- Garfinkel, A.R. The history of Botrytis taxonomy, the rise of phylogenetics, and implications for species recognition. Phytopathology 2021, 111, 437–454. [Google Scholar] [CrossRef]
- Bensch, K.; Groenewald, J.Z.; Meijer, M.; Dijksterhuis, J.; Jurjević, Ž.; Andersen, B.; Houbraken, J.; Crous, P.W.; Samson, R.A. Cladosporium species in indoor environments. Stud. Mycol. 2018, 89, 177–301. [Google Scholar] [CrossRef]
- Liu, F.; Ma, Z.Y.; Hou, L.W.; Diao, Y.Z.; Wu, W.P.; Damm, U.; Song, S.; Cai, L. Updating species diversity of Colletotrichum, with a phylogenomic overview. Stud. Mycol. 2022, 101, 1–56. [Google Scholar] [CrossRef]
- Norphanphoun, C.; Gentekaki, E.; Hongsanan, S.; Jayawardena, R.; Senanayake, I.; Manawasinghe, I.; Abeywickrama, P.; Bhunjun, C.; Hyde, K. Diaporthe: Formalizing the species-group concept. Mycosphere 2022, 13, 752–819. [Google Scholar] [CrossRef]
- Yilmaz, N.; Sandoval-Denis, M.; Lombard, L.; Visagie, C.M.; Wingfield, B.D.; Crous, P.W. Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 2021, 46, 129–162. [Google Scholar] [CrossRef]
- Peng, C.; Crous, P.W.; Jiang, N.; Fan, X.L.; Liang, Y.M.; Tian, C.M. Diversity of Sporocadaceae (Pestalotioid fungi) from Rosa in China. Persoonia 2022, 49, 201–260. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
- Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. trimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef] [PubMed]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar]
- Stamatakis, A.; Hoover, P.; Rougemont, J. A rapid bootstrap algorithm for the RAxML web servers. Syst. Biol. 2008, 57, 758–771. [Google Scholar] [CrossRef] [PubMed]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Rambaut, A. FigTree Version 1.4. 2012. Available online: http://tree.bio.ed.ac.uk/software/Figtree/ (accessed on 1 January 2023).
- Hyde, K.D.; Noorabadi, M.T.; Thiyagaraja, V.; He, M.Q.; Johnston, P.R.; Wijesinghe, S.N.; Armand, A.; Biketova, A.Y.; Chethana, K.W.T.; Erdoğdu, M.; et al. The 2024 outline of fungi and fungus-like taxa. Mycosphere 2024, 15, 5146–6239. [Google Scholar] [CrossRef]
- Marsberg, A.; Kemler, M.; Jami, F.; Nagel, J.H.; Postma-Smidt, A.; Naidoo, S.; Wingfield, M.J.; Crous, P.W.; Spatafora, J.W.; Hesse, C.N.; et al. Botryosphaeria dothidea: A latent pathogen of global importance to woody plant health. Mol. Plant Pathol. 2017, 18, 477–488. [Google Scholar] [CrossRef]
- Slippers, B.; Crous, P.W.; Denman, S.; Coutinho, T.A.; Wingfield, B.D.; Wingfield, M.J. Combined multiple gene genealogies and phenotypic characters differentiate several species previously identified as Botryosphaeria dothidea. Mycologia 2004, 96, 83–101. [Google Scholar] [CrossRef]
- Phillips, A.J.L.; Alves, A.; Abdollahzadeh, J.; Slippers, B.; Wingfield, M.J.; Groenewald, J.Z.; Crous, P.W. The Botryosphaeriaceae: Genera and species known from culture. Stud. Mycol. 2013, 76, 51–167. [Google Scholar] [CrossRef]
- Zhang, G.H.; Yang, Q.; Li, X.Y.; Song, S.Y.; Ren, Y.Q.; Huang, S.H. Pathogens identification of twig blight and fruit rot disease and investigation on insect pests against Vaccnium uliginosum in Majiang County. China Plant Protect. 2016, 5, 12–15. [Google Scholar]
- Gu, C.Y.; Yang, X.; Al-Attala, M.N.; Abid, M.; May Phyo, S.S.; Zang, H.Y.; Pan, R.; Chen, Y. First report of pomegranate fruit rot caused by Botryosphaeria dothidea in Anhui province of China. Plant Dis. 2020, 104, 2736. [Google Scholar] [CrossRef]
- Wang, L.; Hou, H.; Zhou, Z.Q.; Tu, H.T.; Yuan, H.B. Identification and detection of Botryosphaeria dothidea from kiwifruit (Actinidia chinensis) in China. Plants 2021, 10, 401. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.L.; Qi, Y.T.; Wu, Z.; Yang, C.X.; Cui, C.Y. First report of Botryosphaeria dothidea causing postharvest fruit rot of plum in China. Plant Dis. 2024, 108, 1111. [Google Scholar] [CrossRef] [PubMed]
- Fillinger, S.; Elad, Y. (Eds.) Botrytis—The Fungus, the Pathogen and Its Management in Agricultural Systems; Springer: Cham, Switzerland, 2016. [Google Scholar]
- Dean, R.; Van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- Wang, S.Y.; Wang, Y.; Li, Y. Cladosporium spp. (Cladosporiaceae) isolated from Eucommia ulmoides in China. MycoKeys 2022, 91, 151–168. [Google Scholar] [CrossRef]
- Yang, Y.; Luo, W.; Zhang, W.; Mridha, M.A.U.; Wijesinghe, S.N.; McKenzie, E.H.C.; Wang, Y. Cladosporium species associated with fruit trees in Guizhou Province, China. J. Fungi 2023, 9, 250. [Google Scholar] [CrossRef]
- Da Silva, N.M.P.; Guterres, D.C.; Borges, L.S.; Barreto, R.W.; Furtado, G.Q. Surveying potentially antagonistic fungi to myrtle rust (Austropuccinia psidii) in Brazil: Fungicolous Cladosporium Spp. Braz. J. Microbiol. 2023, 54, 1899–1914. [Google Scholar] [CrossRef]
- Pereira, C.M.; Sarmiento, S.S.; Colmán, A.A.; Belachew-Bekele, K.; Evans, H.C.; Barreto, R.W. Mycodiversity in a Micro-Habitat: Twelve Cladosporium species, including four new taxa, isolated from uredinia of coffee leaf rust, Hemileia vastatrix. Fungal Syst. Evol. 2024, 14, 9–33. [Google Scholar] [CrossRef]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Crous, P.W. The Colletotrichum acutatum species complex. Stud. Mycol. 2012, 73, 37–113. [Google Scholar] [CrossRef]
- Talhinhas, P.; Baroncelli, R. Colletotrichum species and complexes: Geographic distribution, host range and conservation status. Fungal Divers. 2021, 110, 109–198. [Google Scholar] [CrossRef]
- Fu, M.; Crous, P.W.; Bai, Q.; Zhang, P.F.; Xiang, J.; Guo, Y.S.; Zhao, F.F.; Yang, M.M.; Hong, N.; Xu, W.X.; et al. Colletotrichum species associated with anthracnose of Pyrus spp. in China. Persoonia 2019, 42, 1–35. [Google Scholar] [CrossRef] [PubMed]
- Ling, J.F.; Peng, A.T.; Jiang, Z.D.; Xi, P.G.; Song, X.B.; Cheng, B.P.; Cui, Y.P.; Chen, X. First report of anthracnose fruit rot caused by Colletotrichum fioriniae on litchi in China. Plant Dis. 2021, 105, 1225. [Google Scholar] [CrossRef] [PubMed]
- Tan, Q.; Schnabel, G.; Chaisiri, C.; Yin, L.F.; Yin, W.X.; Luo, C.X. Colletotrichum species associated with peaches in China. J. Fungi 2022, 8, 313. [Google Scholar] [CrossRef] [PubMed]
- Dissanayake, A.J.; Zhu, J.T.; Chen, Y.Y.; Maharachchikumbura, S.S.N.; Hyde, K.D.; Liu, J.K. A re-evaluation of Diaporthe: Refining the boundaries of species and species complexes. Fungal Divers. 2024, 126, 1–125. [Google Scholar] [CrossRef]
- Gao, Y.; Liu, F.; Duan, W.; Crous, P.W.; Cai, L. Diaporthe is paraphyletic. IMA Fungus 2017, 8, 153–187. [Google Scholar] [CrossRef]
- Early, M.P.; Punithalingam, E. Phomopsis anacardii sp. nov. on Anacardium occidentale. Trans. Br. Mycol. Soc. 1972, 59, 345–347. [Google Scholar] [CrossRef]
- Gomes, R.R.; Glienke, C.; Videira, S.I.R.; Lombard, L.; Groenewald, J.Z.; Crous, P.W. Diaporthe: A genus of endophytic, saprobic and plant pathogenic fungi. Persoonia 2013, 31, 1–41. [Google Scholar] [CrossRef]
- Hilário, S.; Lopes, A.; Santos, L.; Alves, A. Botryosphaeriaceae species associated with blueberry stem blight and dieback in the centre region of Portugal. Eur. J. Plant Pathol. 2020, 156, 31–44. [Google Scholar] [CrossRef]
- Bugnicourt, F. Une Espèce Fusarienne Nouvelle, Parasite Du Riz. Rev. Générale Bot. 1952, 59, 13–18. [Google Scholar]
- Seifert, K.A.; Aoki, T.; Baayen, R.P.; Brayford, D.; Burgess, L.W.; Chulze, S.; Gams, W.; Geiser, D.; de Gruyter, J.; Leslie, J.F.; et al. The name Fusarium moniliforme should no longer be used. Mycol. Res. 2003, 107, 643–644. [Google Scholar] [CrossRef]
- Nelson, P.; Toussoun, T.; Marasas, W.F.O. Fusarium species: An Illustrated Manual for Identification; Pennsylvania State University Press: Pennsylvania, PA, USA, 1983. [Google Scholar]
- Zhang, H.; Sha, H.D.; Chen, W.L.; Mao, B.Z. First report of Fusarium annulatum causing blight on Bletilla striata (Baiji) in China. Plant Dis. 2024, 108, 800. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Zhang, L.; Yang, X.L.; Shen, G.J.; Wang, S.; Teng, H.L.; Yang, C.B.; Liu, X.Y.; Wang, X.J.; Zhao, J.W.; et al. Fusarium species associated with maize leaf blight in Heilongjiang Province, China. J. Fungi 2022, 8, 1170. [Google Scholar] [CrossRef]
- Zhang, H.; Zeng, Y.; Wei, T.P.; Jiang, Y.L.; Zeng, X.Y. Endophytic Fusarium and allied fungi from Rosa roxburghii in China. Mycosphere 2023, 14, 2092–2207. [Google Scholar] [CrossRef]
- Maharachchikumbura, S.S.N.; Hyde, K.D.; Groenewald, J.Z.; Xu, J.; Crous, P.W. Pestalotiopsis revisited. Stud. Mycol. 2014, 79, 121–186. [Google Scholar] [CrossRef]
- Solarte, F.; Muñoz, C.G.; Maharachchikumbura, S.S.N.; Álvarez, E. Diversity of Neopestalotiopsis and Pestalotiopsis spp., causal agents of guava scab in Colombia. Plant Dis. 2018, 102, 49–59. [Google Scholar] [CrossRef]
- Zhai, H.; Li, Y.; Wu, N.G.; Yao, M.; Liu, H.; Cui, D.D. Occurrence and control of grey mould of blueberry. Deciduous Fruits 2024, 56, 85–86. [Google Scholar]
- Dai, Q.D.; Li, G.X. Identification and biological characteristics of grey mould of blueberry. China Fruits 2011, 3, 46–48. [Google Scholar]
- MacKenzie, S.J.; Peres, N.A.; Barquero, M.P.; Arauz, L.F.; Timmer, L.W. Host range and genetic relatedness of Colletotrichum acutatum isolates from fruit crops and leatherleaf fern in Florida. Phytopathology 2009, 99, 620–631. [Google Scholar] [CrossRef]
- Pszczółkowska, A.; Okorski, A.; Paukszto, Ł.; Jastrzębski, J. First report of anthracnose disease caused by Colletotrichum fioriniae on blueberry in western Poland. Plant Dis. 2016, 100, 2167. [Google Scholar] [CrossRef]
- Castro, J.F.; Millas, P.; Cisterna-Oyarce, V.; Carrasco-Fernández, J.; Santelices, C.; Muñoz, V.; Guerra, M.; Barra-Bucarei, L.; France, A. First report of Colletotrichum fioriniae causing anthracnose fruit rot on Vaccinium corymbosum in Chile. Plant Dis. 2023, 107, 959. [Google Scholar] [CrossRef]
- Covarrubias-Rivera, L.; Ragazzo-Sánchez, J.A.; González-Gutiérrez, K.N.; Narváez-Zapata, J.A.; Calderón-Santoyo, M. Isolation and identification of phytopathogenic fungi from blueberry (Vaccinium corymbosum) and their biocontrol by Meyerozyma guilliermondii LMA-Cp01. J. Plant Pathol. 2024. [Google Scholar] [CrossRef]
- Xu, C.N.; Zhang, H.J.; Zhou, Z.S.; Hu, T.L.; Wang, S.T.; Wang, Y.N.; Cao, K.Q. Identification and distribution of Botryosphaeriaceae species associated with blueberry stem blight in China. Eur. J. Plant Pathol. 2015, 143, 737–752. [Google Scholar] [CrossRef]
- Hongsanan, S.; Norphanphoun, C.; Senanayake, I.C.; Jayawardena, R.S.; Manawasinghe, I.S.; Abeywickrama, P.D.; Khuna, S.; Suwannarach, N.; Senwanna, C.; Monkai, J.; et al. Annotated notes on Diaporthe species. Mycosphere 2023, 14, 918–1189. [Google Scholar] [CrossRef]
- Milholland, R.D. Blueberry fruit rot caused by Phomopsis vaccinii. Plant Dis. 1983, 67, 325. [Google Scholar] [CrossRef]
- Hilário, S.; Gonçalves, M.F.M.; Alves, A. Using genealogical concordance and coalescent-based species delimitation to assess species boundaries in the Diaporthe eres complex. J. Fungi 2021, 7, 507. [Google Scholar] [CrossRef]
- Santos, J.; Hilário, S.; Pinto, G.; Alves, A. Diversity and pathogenicity of Pestalotioid fungi associated with blueberry plants in Portugal, with description of three novel species of Neopestalotiopsis. Eur. J. Plant Pathol. 2022, 162, 539–555. [Google Scholar] [CrossRef]
- Darapanit, A.; Boonyuen, N.; Leesutthiphonchai, W.; Nuankaew, S.; Piasai, O. Identification, pathogenicity and effects of plant extracts on Neopestalotiopsis and Pseudopestalotiopsis causing fruit diseases. Sci. Rep. 2021, 11, 22606. [Google Scholar] [CrossRef]
- Liu, Y.H.; Lin, T.; Ye, C.S.; Zhang, C.Q. First report of Fusarium wilt in blueberry (Vaccinium corymbosum) caused by Fusarium oxysporum in China. Plant Dis. 2014, 98, 1158. [Google Scholar] [CrossRef]
- Li, S.; Hou, R.; Zhang, F.M.; Shang, X.J. First report of Fusarium commune causing root rot of blueberry plants in Guizhou Province, China. Plant Dis. 2023, 107, 1227. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, C.W.; Gao, J.; Yang, L.N. First report of Fusarium acuminatum causing postharvest fruit rot on stored Vaccinium corymbosum in China. Plant Dis. 2016, 100, 2527. [Google Scholar] [CrossRef]
- Bensch, K.; Braun, U.; Groenewald, J.Z.; Crous, P. The genus Cladosporium. Stud. Mycol. 2012, 72, 1–401. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Hu, S.; de Hoog, S.; Liu, X.; Meng, X.; Xue, R.; van Diepeningen, A.D.; Like, F.; Li, R.Y.; Gao, S. Medical Fusarium: Novel species or uncertain identifications? Mycosphere 2023, 14, 2263–2283. [Google Scholar] [CrossRef]
- Briceño, E.X.; Latorre, B.A. Characterization of Cladosporium rot in grapevines, a problem of growing importance in Chile. Plant Dis. 2008, 92, 1635–1642. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.S.; Xie, Y.Y.; Su, Q.N.; Huo, G.H.; Cui, C.Y. First report of brown spot of dekopon fruit caused by Cladosporium tenuissimum in China. Plant Dis. 2022, 107, 559. [Google Scholar] [CrossRef]
- Delisle-Houde, M.; Dionne, A.; Demers, F.; Tweddell, R.J. Cladosporium fruit rot of raspberry caused by Cladosporium pseudocladosporioides in the Québec Province. Plant Dis. 2024, 108, 526. [Google Scholar] [CrossRef]
- Saito, S.; Michailides, T.J.; Xiao, C.L. Fungicide resistance profiling in Botrytis cinerea populations from blueberry in California and Washington and their impact on control of gray mold. Plant Dis. 2016, 100, 2087–2093. [Google Scholar] [CrossRef]
Locus | Primer | Sequence of Primer (5′–3′) | Annealing Temperature (°C) | Reference |
---|---|---|---|---|
act | ACT-512F | ATGTGCAAGGCCGGTTTCGC | 59 | [14] |
ACT-783R | TACGAGTCCTTCTGGCCCAT | |||
ITS | ITS5 | GGAAGTAAAAGTCGTAACAAGG | 58 | [15] |
ITS4 | TCCTCCGCTTATTGATATGC | |||
cal | CL1C | GAATTCAAGGAGGCCTTCTC | 59 | [16] |
CL2C | CTTCTGCATCATGAGCTGGAC | |||
CAL-228F | GAGTTCAAGGAGGCCTTCTCCC | 54 | [14] | |
CAL-737R | CATCTTTCTGGCCATCATGG | |||
chs | CHS-79F | TGGGGCAAGGATGCTTGGAAGAAG | 58 | [14] |
CHS-345R | TGGAAGAACCATCTGTGAGAGTTG | |||
gapdh | G3PDHfor | ATTGACATCGTCGCTGTCAACGA | 64 | [17] |
G3PDHrev | ACCCCACTCGTTGTCGTACCA | |||
GDF | GCCGTCAACGACCCCTTCATTGA | 59 | [18] | |
GDR | GGGTGGAGTCGTACTTGAGCATGT | |||
his | CYLH3F | AGGTCCACTGGTGGCAAG | 58 | [19] |
H3-1b | GCGGGCGAGCTGGATGTCCTT | |||
hsp60 | HSP60for | CAACAATTGAGATTTGCCCACAAG | 55 | [17] |
HSP60rev | GATGGATCCAGTGGTACCGAGCAT | |||
rpb2 | rpb2-5f2 | GGGGWGAYCAGAAGAAGGC | 56 | [20] |
rpb2-7cR | CCCATRGCTTGYTTRCCCAT | [21] | ||
RPB2Ffor | GATGATCGTGATCATTTCGG | 55 | [17] | |
RB2rev | CCCATAGCTTGCTTACCCAT | |||
tef 1-α | EF1-728F | CATCGAGAAGTTCGAGAAGG | 54 | [14] |
EF1-986R | TACTTGAAGGAACCCTTACC | |||
EF1-688F | CGGTCACTTGATCTACAAGTGC | 54 | [22] | |
EF1-1251R | CCTCGAACTCACCAGTACCG | |||
EF1 | ATGGGTAAGGARGACAAGAC | 55 | [23] | |
EF2 | GGARGTACCAGTSATCATG | |||
β-tub | T1 | AACATGCGTGAGATTGTAAGT | 58 | [24] |
Bt2a | GGTAACCAAATCGGTGCTGCTTTC | 58 | [19] | |
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC |
Genus | Loci Used for Amplification | Reference | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
ITS | β-tub | tef 1-α | gapdh | cal | act | chs | rpb2 | his | hsp60 | ||
Botryosphaeria | ITS5/ ITS4 | Bt2a/ Bt2b | EF1-728F/ EF1-986R | [25] | |||||||
Botrytis | G3PDHfor/ G3PDHrev | RPB2for/RPB2rev | HSP60for/HSP60rev | [26] | |||||||
Cladosporium | ITS5/ ITS4 | EF1-728F/ EF1-986R | ACT-512F/ ACT-783R | [27] | |||||||
Colletotrichum | ITS5/ ITS4 | T1/Bt2b | GDF/ GDR | ACT-512F/ ACT-783R | CHS-79F/ CHS-345R | [28] | |||||
Diaporthe | ITS5/ ITS4 | Bt2a/ Bt2b | EF1-688F/ EF1-1251R | CAL-228F/ CAL-737R | CYLH3F/ H31b | [29] | |||||
Fusarium | EF1/EF2 | RPB2-5f2/ 7cR | [30] | ||||||||
Pestalotiopsis | ITS5/ ITS4 | T1/Bt2b | EF1-688F/ EF1-1251R | [31] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Zhang, W.; Wu, L.; Chen, P.; Li, X.; Wen, G.; Tangtrakulwanich, K.; Chethana, K.W.T.; Al-Otibi, F.; Hyde, K.D.; et al. Characterization of Fungal Pathogens Causing Blueberry Fruit Rot Disease in China. Pathogens 2025, 14, 201. https://doi.org/10.3390/pathogens14020201
Zhou Y, Zhang W, Wu L, Chen P, Li X, Wen G, Tangtrakulwanich K, Chethana KWT, Al-Otibi F, Hyde KD, et al. Characterization of Fungal Pathogens Causing Blueberry Fruit Rot Disease in China. Pathogens. 2025; 14(2):201. https://doi.org/10.3390/pathogens14020201
Chicago/Turabian StyleZhou, Yueyan, Wei Zhang, Linna Wu, Pengzhao Chen, Xinghong Li, Guangqin Wen, Khanobporn Tangtrakulwanich, Kandawatte Wedaralalage Thilini Chethana, Fatimah Al-Otibi, Kevin D. Hyde, and et al. 2025. "Characterization of Fungal Pathogens Causing Blueberry Fruit Rot Disease in China" Pathogens 14, no. 2: 201. https://doi.org/10.3390/pathogens14020201
APA StyleZhou, Y., Zhang, W., Wu, L., Chen, P., Li, X., Wen, G., Tangtrakulwanich, K., Chethana, K. W. T., Al-Otibi, F., Hyde, K. D., & Yan, J. (2025). Characterization of Fungal Pathogens Causing Blueberry Fruit Rot Disease in China. Pathogens, 14(2), 201. https://doi.org/10.3390/pathogens14020201