The Prevalence of Enteric Viruses in Bivalve Molluscs in a Farming Area in Liguria, Northwest Italy
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Sample Preparation and Nucleic Acid Extraction
2.3. Real-Time RT-(q)PCR
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fong, T.-T.; Lipp, E.K. Enteric Viruses of Humans and Animals in Aquatic Environments: Health Risks, Detection, and Potential Water Quality Assessment Tools. Microbiol. Mol. Biol. Rev. 2005, 69, 357–371. [Google Scholar] [CrossRef]
- Sánchez, G.; Bosch, A. Survival of Enteric Viruses in the Environment and Food. In Viruses in Foods; Goyal, S.M., Cannon, J.L., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 367–392. ISBN 978-3-319-30721-3. [Google Scholar]
- Bellou, M.; Kokkinos, P.; Vantarakis, A. Shellfish-Borne Viral Outbreaks: A Systematic Review. Food Environ. Virol. 2013, 5, 13–23. [Google Scholar] [CrossRef]
- European Food Safety Authority. European Centre for Disease Prevention and Control The European Union One Health 2021 Zoonoses Report. EFS2 2022, 20, e07666. [Google Scholar] [CrossRef]
- Epidemiology—SEIEVA Data 2022. Available online: https://www.epicentro.iss.it/en/hepatitis/data-seieva (accessed on 1 October 2024).
- Treagus, S.; Wright, C.; Baker-Austin, C.; Longdon, B.; Lowther, J. The Foodborne Transmission of Hepatitis E Virus to Humans. Food Environ. Virol. 2021, 13, 127–145. [Google Scholar] [CrossRef] [PubMed]
- Le Guyader, F.S.; Le Saux, J.-C.; Ambert-Balay, K.; Krol, J.; Serais, O.; Parnaudeau, S.; Giraudon, H.; Delmas, G.; Pommepuy, M.; Pothier, P.; et al. Aichi Virus, Norovirus, Astrovirus, Enterovirus, and Rotavirus Involved in Clinical Cases from a French Oyster-Related Gastroenteritis Outbreak. J. Clin. Microbiol. 2008, 46, 4011–4017. [Google Scholar] [CrossRef] [PubMed]
- Rivadulla, E.; Romalde, J.L. A Comprehensive Review on Human Aichi Virus. Virol. Sin. 2020, 35, 501–516. [Google Scholar] [CrossRef] [PubMed]
- Fiorito, F.; Amoroso, M.G.; Lambiase, S.; Serpe, F.P.; Bruno, T.; Scaramuzzo, A.; Maglio, P.; Fusco, G.; Esposito, M. A Relationship between Environmental Pollutants and Enteric Viruses in Mussels(Mytilus Galloprovincialis). Environ. Res. 2019, 169, 156–162. [Google Scholar] [CrossRef] [PubMed]
- Aspinall, E.J.; Couturier, E.; Faber, M.; Said, B.; Ijaz, S.; Tavoschi, L.; Takkinen, J.; Adlhoch, C.; on behalf of the country experts. Hepatitis E Virus Infection in Europe: Surveillance and Descriptive Epidemiology of Confirmed Cases, 2005 to 2015. Eurosurveillance 2017, 22, 30561. [Google Scholar] [CrossRef] [PubMed]
- La Rosa, G.; Proroga, Y.T.R.; De Medici, D.; Capuano, F.; Iaconelli, M.; Della Libera, S.; Suffredini, E. First Detection of Hepatitis E Virus in Shellfish and in Seawater from Production Areas in Southern Italy. Food Environ. Virol. 2018, 10, 127–131. [Google Scholar] [CrossRef]
- Di Cola, G.; Fantilli, A.C.; Pisano, M.B.; Ré, V.E. Foodborne Transmission of Hepatitis A and Hepatitis E Viruses: A Literature Review. Int. J. Food Microbiol. 2021, 338, 108986. [Google Scholar] [CrossRef]
- Koizumi, Y.; Isoda, N.; Sato, Y.; Iwaki, T.; Ono, K.; Ido, K.; Sugano, K.; Takahashi, M.; Nishizawa, T.; Okamoto, H. Infection of a Japanese Patient by Genotype 4 Hepatitis E Virus While Traveling in Vietnam. J. Clin. Microbiol. 2004, 42, 3883–3885. [Google Scholar] [CrossRef]
- Said, B.; Ijaz, S.; Kafatos, G.; Booth, L.; Thomas, H.L.; Walsh, A.; Ramsay, M.; Morgan, D.; on behalf of the Hepatitis E Incident Investigation Team. Hepatitis E Outbreak on Cruise Ship. Emerg. Infect. Dis. 2009, 15, 1738–1744. [Google Scholar] [CrossRef]
- Kitajima, M.; Gerba, C. Aichi Virus 1: Environmental Occurrence and Behavior. Pathogens 2015, 4, 256–268. [Google Scholar] [CrossRef] [PubMed]
- Vu, D.-L.; Bosch, A.; Pintó, R.; Guix, S. Epidemiology of Classic and Novel Human Astrovirus: Gastroenteritis and Beyond. Viruses 2017, 9, 33. [Google Scholar] [CrossRef]
- Wohlgemuth, N.; Honce, R.; Schultz-Cherry, S. Astrovirus Evolution and Emergence. Infect. Genet. Evol. 2019, 69, 30–37. [Google Scholar] [CrossRef]
- Fusco, G.; Di Bartolo, I.; Cioffi, B.; Ianiro, G.; Palermo, P.; Monini, M.; Amoroso, M.G. Prevalence of Foodborne Viruses in Mussels in Southern Italy. Food Environ. Virol. 2017, 9, 187–194. [Google Scholar] [CrossRef] [PubMed]
- Le Guyader, F.; Haugarreau, L.; Miossec, L.; Dubois, E.; Pommepuy, M. Three-Year Study To Assess Human Enteric Viruses in Shellfish. Appl. Environ. Microbiol. 2000, 66, 3241–3248. [Google Scholar] [CrossRef]
- Fusco, G.; Anastasio, A.; Kingsley, D.H.; Amoroso, M.G.; Pepe, T.; Fratamico, P.M.; Cioffi, B.; Rossi, R.; La Rosa, G.; Boccia, F. Detection of Hepatitis A Virus and Other Enteric Viruses in Shellfish Collected in the Gulf of Naples, Italy. IJERPH 2019, 16, 2588. [Google Scholar] [CrossRef]
- Vasquez-García, A.; Mejia-Ballesteros, J.E.; De Godoy, S.H.S.; Barbieri, E.; De Sousa, R.L.M.; Fernandes, A.M. Norovirus GII and Astrovirus in Shellfish from a Mangrove Region in Cananéia, Brazil: Molecular Detection and Characterization. Braz. J. Microbiol. 2022, 53, 317–326. [Google Scholar] [CrossRef]
- Vilariño, M.L.; Le Guyader, F.S.; Polo, D.; Schaeffer, J.; Kröl, J.; Romalde, J.L. Assessment of Human Enteric Viruses in Cultured and Wild Bivalve Molluscs. Int. Microbiol. 2009, 12, 145–151. [Google Scholar]
- Duchenne-Moutien, R.A.; Neetoo, H. Climate Change and Emerging Food Safety Issues: A Review. J. Food Prot. 2021, 84, 1884–1897. [Google Scholar] [CrossRef]
- ISO 15216-1:2017; Microbiology of the Food Chain—Horizontal Method for Determination of Hepatitis a Virus and Norovirus Using Real-Time Rt-Pcr. Part 1: Method for Quantification. ISO: Geneva, Switzerland, 2017.
- Pintó, R.M.; Costafreda, M.I.; Bosch, A. Risk Assessment in Shellfish-Borne Outbreaks of Hepatitis A. Appl. Environ. Microbiol. 2009, 75, 7350–7355. [Google Scholar] [CrossRef]
- Costafreda, M.I.; Bosch, A.; Pintó, R.M. Development, Evaluation, and Standardization of a Real-Time TaqMan Reverse Transcription-PCR Assay for Quantification of Hepatitis A Virus in Clinical and Shellfish Samples. Appl. Environ. Microbiol. 2006, 72, 3846–3855. [Google Scholar] [CrossRef]
- Da Silva, A.K.; Le Saux, J.-C.; Parnaudeau, S.; Pommepuy, M.; Elimelech, M.; Le Guyader, F.S. Evaluation of Removal of Noroviruses during Wastewater Treatment, Using Real-Time Reverse Transcription-PCR: Different Behaviors of Genogroups I and II. Appl. Environ. Microbiol. 2007, 73, 7891–7897. [Google Scholar] [CrossRef]
- Svraka, S.; Duizer, E.; Vennema, H.; De Bruin, E.; Van Der Veer, B.; Dorresteijn, B.; Koopmans, M. Etiological Role of Viruses in Outbreaks of Acute Gastroenteritis in The Netherlands from 1994 through 2005. J. Clin. Microbiol. 2007, 45, 1389–1394. [Google Scholar] [CrossRef] [PubMed]
- Loisy, F.; Atmar, R.L.; Guillon, P.; Le Cann, P.; Pommepuy, M.; Le Guyader, F.S. Real-Time RT-PCR for Norovirus Screening in Shellfish. J. Virol. Methods 2005, 123, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Kageyama, T.; Kojima, S.; Shinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F.B.; Takeda, N.; Katayama, K. Broadly Reactive and Highly Sensitive Assay for Norwalk-Like Viruses Based on Real-Time Quantitative Reverse Transcription-PCR. J. Clin. Microbiol. 2003, 41, 1548–1557. [Google Scholar] [CrossRef] [PubMed]
- Jothikumar, N.; Cromeans, T.L.; Robertson, B.H.; Meng, X.J.; Hill, V.R. A Broadly Reactive One-Step Real-Time RT-PCR Assay for Rapid and Sensitive Detection of Hepatitis E Virus. J. Virol. Methods 2006, 131, 65–71. [Google Scholar] [CrossRef]
- Garson, J.A.; Ferns, R.B.; Grant, P.R.; Ijaz, S.; Nastouli, E.; Szypulska, R.; Tedder, R.S. Minor Groove Binder Modification of Widely Used TaqMan Probe for Hepatitis E Virus Reduces Risk of False Negative Real-Time PCR Results. J. Virol. Methods 2012, 186, 157–160. [Google Scholar] [CrossRef]
- Le Cann, P.; Ranarijaona, S.; Monpoeho, S.; Le Guyader, F.; Ferré, V. Quantification of Human Astroviruses in Sewage Using Real-Time RT-PCR. Res. Microbiol. 2004, 155, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Kitajima, M.; Hata, A.; Yamashita, T.; Haramoto, E.; Minagawa, H.; Katayama, H. Development of a Reverse Transcription-Quantitative PCR System for Detection and Genotyping of Aichi Viruses in Clinical and Environmental Samples. Appl. Environ. Microbiol. 2013, 79, 3952–3958. [Google Scholar] [CrossRef]
- StataCorp. Stata Statistical Software: Release 17; StataCorp LLC: College Station, TX, USA, 2021. [Google Scholar]
- Razafimahefa, R.M.; Ludwig-Begall, L.F.; Thiry, E. Cockles and Mussels, Alive, Alive, Oh —The Role of Bivalve Molluscs as Transmission Vehicles for Human Norovirus Infections. Transbound. Emerg. Dis. 2020, 67, 9–25. [Google Scholar] [CrossRef]
- Ludwig-Begall, L.F.; Mauroy, A.; Thiry, E. Noroviruses—The State of the Art, Nearly Fifty Years after Their Initial Discovery. Viruses 2021, 13, 1541. [Google Scholar] [CrossRef]
- Ilic, N.; Velebit, B.; Teodorovic, V.; Djordjevic, V.; Karabasil, N.; Vasilev, D.; Djuric, S.; Adzic, B.; Dimitrijevic, M. Influence of Environmental Conditions on Norovirus Presence in Mussels Harvested in Montenegro. Food Environ. Virol. 2017, 9, 406–414. [Google Scholar] [CrossRef]
- Romalde, J.L.; Rivadulla, E.; Varela, M.F.; Barja, J.L. An Overview of 20 Years of Studies on the Prevalence of Human Enteric Viruses in Shellfish from Galicia, Spain. J. Appl. Microbiol. 2018, 124, 943–957. [Google Scholar] [CrossRef]
- Battistini, R.; Listorti, V.; Squadrone, S.; Pederiva, S.; Abete, M.C.; Mua, R.; Ciccotelli, V.; Suffredini, E.; Maurella, C.; Baioni, E.; et al. Occurrence and Persistence of Enteric Viruses, Arsenic and Biotoxins in Pacific Oysters Farmed in an Italian Production Site. Mar. Pollut. Bull. 2021, 162, 111843. [Google Scholar] [CrossRef]
- Lowther, J.A.; Gustar, N.E.; Powell, A.L.; O’Brien, S.; Lees, D.N. A One-Year Survey of Norovirus in UK Oysters Collected at the Point of Sale. Food Environ. Virol. 2018, 10, 278–287. [Google Scholar] [CrossRef]
- Messens, W.; Fernandez-Escamez, P.S.; Lees, D.; Lindqvist, R.; O’Mahony, M.; Suffredini, E.; Cortiñas Abrahantes, J.; Chantzis, E.; Koutsoumanis, K. Thermal Processing of Live Bivalve Molluscs for Controlling Viruses: On the Need for a Risk-Based Design. Crit. Rev. Food Sci. Nutr. 2018, 58, 2854–2865. [Google Scholar] [CrossRef] [PubMed]
- Suffredini, E.; Lanni, L.; Arcangeli, G.; Pepe, T.; Mazzette, R.; Ciccaglioni, G.; Croci, L. Qualitative and Quantitative Assessment of Viral Contamination in Bivalve Molluscs Harvested in Italy. Int. J. Food Microbiol. 2014, 184, 21–26. [Google Scholar] [CrossRef]
- Van Beek, J.; De Graaf, M.; Al-Hello, H.; Allen, D.J.; Ambert-Balay, K.; Botteldoorn, N.; Brytting, M.; Buesa, J.; Cabrerizo, M.; Chan, M.; et al. Molecular Surveillance of Norovirus, 2005–2016: An Epidemiological Analysis of Data Collected from the NoroNet Network. Lancet Infect. Dis. 2018, 18, 545–553. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority (EFSA). Analysis of the European Baseline Survey of Norovirus in Oysters. EFS2 2019, 17, e05762. [Google Scholar] [CrossRef]
- EFSA Panel on Biological Hazards (BIOHAZ). Scientific Opinion on Norovirus (NoV) in Oysters: Methods, Limits and Control Options. EFSA J. 2012, 10, 2500. [Google Scholar] [CrossRef]
- Winder, N.; Gohar, S.; Muthana, M. Norovirus: An Overview of Virology and Preventative Measures. Viruses 2022, 14, 2811. [Google Scholar] [CrossRef]
- Lowther, J.A.; Gustar, N.E.; Hartnell, R.E.; Lees, D.N. Comparison of Norovirus RNA Levels in Outbreak-Related Oysters with Background Environmental Levels. J. Food Prot. 2012, 75, 389–393. [Google Scholar] [CrossRef]
- European Food Safety Authority (EFSA). Technical Specifications for a European Baseline Survey of Norovirus in Oysters. EFS2 2016, 14, 4414. [Google Scholar] [CrossRef]
- Ming, H.X.; Fan, J.F.; Wu, L.J.; Liang, Y.B. Prevalence of Human Enteric Viruses and a Potential Indicator of Contamination in Shellfish in C Hina. J. Food Saf. 2013, 33, 209–214. [Google Scholar] [CrossRef]
- Elamri, D.E.; Aouni, M.; Parnaudeau, S.; Le Guyader, F.S. Detection of Human Enteric Viruses in Shellfish Collected in Tunisia. Lett. Appl. Microbiol. 2006, 43, 399–404. [Google Scholar] [CrossRef]
- Terio, V.; Bottaro, M.; Di Pinto, A.; Fusco, G.; Barresi, T.; Tantillo, G.; Martella, V. Occurrence of Aichi Virus in Retail Shellfish in Italy. Food Microbiol. 2018, 74, 120–124. [Google Scholar] [CrossRef] [PubMed]
- Rivadulla, E.; Varela, M.F.; Romalde, J.L. Low Prevalence of Aichi Virus in Molluscan Shellfish Samples from Galicia (NW Spain). J. Appl. Microbiol. 2017, 122, 516–521. [Google Scholar] [CrossRef] [PubMed]
- Sdiri-Loulizi, K.; Hassine, M.; Aouni, Z.; Gharbi-Khelifi, H.; Sakly, N.; Chouchane, S.; Guédiche, M.N.; Pothier, P.; Aouni, M.; Ambert-Balay, K. First Molecular Detection of Aichi Virus in Sewage and Shellfish Samples in the Monastir Region of Tunisia. Arch. Virol. 2010, 155, 1509–1513. [Google Scholar] [CrossRef]
- Suffredini, E.; Le, Q.H.; Di Pasquale, S.; Pham, T.D.; Vicenza, T.; Losardo, M.; To, K.A.; De Medici, D. Occurrence and Molecular Characterization of Enteric Viruses in Bivalve Shellfish Marketed in Vietnam. Food Control 2020, 108, 106828. [Google Scholar] [CrossRef]
- Ferri, G.; Olivieri, V.; Vergara, A. Human Enteric Viruses’ Detection in Mussels (Mytilus galloprovincialis) Farmed in the Central Adriatic Sea. Ital. J. Food Safety 2024, 13, 12349. [Google Scholar] [CrossRef] [PubMed]
- Bozkurt, H.; Phan-Thien, K.-Y.; Van Ogtrop, F.; Bell, T.; McConchie, R. Outbreaks, Occurrence, and Control of Norovirus and Hepatitis a Virus Contamination in Berries: A Review. Crit. Rev. Food Sci. Nutr. 2021, 61, 116–138. [Google Scholar] [CrossRef] [PubMed]




| Virus | Primers, Probes | SEQUENCE (5′–3′) | Ref. |
|---|---|---|---|
| MV | MENGO 110 | GCGGGTCCTGCCGAAAGT | [25] |
| MENGO 209 | GAAGTAACATATAGACAGACGCACAC | ||
| MENGO 147 | FAM-ATCACATTACTGGCCGAAGC–MGB | ||
| HAV | HAV68 | TCACCGCCGTTTGCCTAG | [26] |
| HAV240 | GGAGAGCCCTGGAAGAAAG | ||
| HAV150 | FAM-CCTGAACCTGCAGGAATTAA–MGBNFQ | ||
| NoV GI | QNIF4 | CGCTGGATGCGNTTCCAT | [27,28] |
| NV1LCR | CCTTAGACGCCATCATCATTTAC | ||
| NVGG1p | FAM-TGGACAGGAGAYCGCRATCT-TAMRA | ||
| NoV GII | QNIF2 | ATGTTCAGRTGGATGAGRTTCTCWGA | [29,30] |
| COG2R | TCGACGCCATCTTCATTCACA | ||
| QNIFS | FAM-AGCACGTGGGAGGGCGATCG-TAMRA | ||
| HEV | JVHEV-F | GGTGGTTTCTGGGGTGAC | [31,32] |
| JVHEV-R | AGGGGTTGGTTGGATGAA | ||
| JVHEV- Pmod | FAM-TGATTCTCAGCCCTTCGC–MGB | ||
| AsV | AV1 | CCGAGTAGGATCGAGGGT | [33] |
| AV2 | GCTTCTGATTAAATCAATTTTAA | ||
| AVs | FAM-CTTTTCTGTCTCTGTTTAGATTATTTTAATCACC-TAMRA | ||
| AiV | AiV-AB-F | GTCTCCACHGACACYAAYTGGAC | [34] |
| AiV-AB-R | GTTGTAACATRGCAGCCCAGG | ||
| AiV-AB-TP | FAM-TTYTCCTTYGTGCGTGC-MGBNFQ |
| Month | Number of Positive Samples/Number of Samples Analysed (%) | |||||
|---|---|---|---|---|---|---|
| HAV | NoV GI | NoVGII | HEV | AsV | AiV | |
| Apr. | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 7/14 (50.0) | 2/14 (14.3) |
| May | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 2/14 (14.3) |
| Jun. | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 1/14 (7.1) | 0/14 (0.0) |
| Jul. | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) |
| Aug. | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) |
| Sept. | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) |
| Oct. | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) |
| Nov. | 0/14 (0.0) | 1/14 (7.1) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) | 0/14 (0.0) |
| Dec. | 0/14 (0.0) | 12/14 (85.7) | 10/14 (71.4) | 0/14 (0.0) | 8/14 (57.1) | 3/14 (21.4) |
| Jan. | 0/14 (0.0) | 14/14 (100.0) | 14/14 (100.0) | 0/14 (0.0) | 11/14 (78.6) | 12/14 (85.7) |
| Feb. | 0/14 (0.0) | 13/14 (92.9) | 14/14 (100.0) | 0/14 (0.0) | 0/14 (0.0) | 11/14 (78.6) |
| Mar. | 0/14 (0.0) | 12/14 (85.7) | 14/14 (100.0) | 0/14 (0.0) | 4/14 (28.6) | 3/14 (21.4) |
| Total | 0/168 (0.0) | 52/168 (31.0) | 52/168 (31.0) | 0/168 (0.0) | 31/168 (18.4) | 33/168 (19.6) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Masotti, C.; Serracca, L.; Costa, E.; Betti, B.; Garcia-Vozmediano, A.; Suffredini, E.; Battistini, R. The Prevalence of Enteric Viruses in Bivalve Molluscs in a Farming Area in Liguria, Northwest Italy. Pathogens 2025, 14, 21. https://doi.org/10.3390/pathogens14010021
Masotti C, Serracca L, Costa E, Betti B, Garcia-Vozmediano A, Suffredini E, Battistini R. The Prevalence of Enteric Viruses in Bivalve Molluscs in a Farming Area in Liguria, Northwest Italy. Pathogens. 2025; 14(1):21. https://doi.org/10.3390/pathogens14010021
Chicago/Turabian StyleMasotti, Chiara, Laura Serracca, Erica Costa, Barbara Betti, Aitor Garcia-Vozmediano, Elisabetta Suffredini, and Roberta Battistini. 2025. "The Prevalence of Enteric Viruses in Bivalve Molluscs in a Farming Area in Liguria, Northwest Italy" Pathogens 14, no. 1: 21. https://doi.org/10.3390/pathogens14010021
APA StyleMasotti, C., Serracca, L., Costa, E., Betti, B., Garcia-Vozmediano, A., Suffredini, E., & Battistini, R. (2025). The Prevalence of Enteric Viruses in Bivalve Molluscs in a Farming Area in Liguria, Northwest Italy. Pathogens, 14(1), 21. https://doi.org/10.3390/pathogens14010021

