Next Article in Journal
Modifications of Mitochondrial Network Morphology Affect the MAVS-Dependent Immune Response in L929 Murine Fibroblasts during Ectromelia Virus Infection
Next Article in Special Issue
Campylobacter coli Prosthetic Joint Infection: Case Report and a Review of the Literature
Previous Article in Journal
Filamentous Fungi Associated with Disease Symptoms in Non-Native Giant Sequoia (Sequoiadendron giganteum) in Germany—A Gateway for Alien Fungal Pathogens?
Previous Article in Special Issue
Assessing the Prevalence and Dynamics of Emerging Campylobacterales in Human Stool Samples in Brussels by Filtration Culture
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity, Virulence, and Antibiotic Resistance Determinants of Campylobacter jejuni Isolates in Romania

by
Madalina Baltoiu
1,
Gratiela Gradisteanu Pircalabioru
2,3,*,
Daniela Cristea
1,
Marilena Sorokin
4,
Cristiana Cerasella Dragomirescu
1,5 and
Ileana Stoica
2
1
Cantacuzino National Military Medical Institute for Research and Development, Independence Spl. no. 103, 050096 Bucharest, Romania
2
Faculty of Biology, University of Bucharest, Independence Spl. no. 91-95, 050095 Bucharest, Romania
3
eBio-Hub Research Centre, National University of Science and Technology Politehnica Bucharest, Iuliu Maniu Boulevard, 061344 Bucharest, Romania
4
Department of Public Health Prahova, Maramures Street, 100029 Ploiesti, Romania
5
Department of Microbiology, Cantacuzino Institute, Carol Davila University of Medicine and Pharmacy, 020021 Bucharest, Romania
*
Author to whom correspondence should be addressed.
Pathogens 2024, 13(9), 716; https://doi.org/10.3390/pathogens13090716
Submission received: 16 July 2024 / Revised: 20 August 2024 / Accepted: 21 August 2024 / Published: 23 August 2024
(This article belongs to the Collection Campylobacter Infections Collection)

Abstract

The emergence of antibiotic-resistant Campylobacter jejuni, a leading cause of gastroenteritis worldwide, presents a significant public health challenge requiring vigilant surveillance and disease control. This study aimed to characterize C. jejuni strains isolated in Romania from 2017 to 2020, focusing on genetic diversity, virulence, and antibiotic resistance determinants. The isolates underwent phenotypical testing, PCR, and antibiotic resistance assessment using the Kirby–Bauer disc diffusion method for ciprofloxacin, erythromycin, and tetracycline. Genetic analysis identified resistance and virulence genes, point mutations, and performed sequence typing (7-gene MLST) to determine genetic relatedness. Results indicated substitutions at position 86 in the amino acid sequence or position 257 in the nucleotide sequence of the gyrA gene in 47 fluoroquinolone-resistant isolates. Additionally, mutations in the rRNA 23S gene at positions 2074 and 2075, associated with macrolide resistance, were found in 12 of the 66 isolates. Allelic profiles generated 38 sequence types (STs), including three new STs not present in the reference database. The sequence data analysis revealed a genetically diverse C. jejuni population with a weak clonal structure. This study provides crucial insights into the genetic diversity and antibiotic resistance of C. jejuni strains in Romania, highlighting the need for ongoing surveillance and control measures.

1. Introduction

Campylobacteriosis was the most reported zoonosis and foodborne illness of 2022 in EU. A total of 140,241 cases were reported, compared to 129,960 the previous year, with a notification rate of 46.9. The countries with the highest rates are Czechia and Luxembourg while the lowest rates were reported in Bulgaria, Greece, Poland, and Romania. The case fatality rate is low, accounting for 0.04% of the reported cases, compared to Listeriosis and West Nile virus infection with a percentage of 18.1% and 8.3%, respectively [1,2].
One of the main causative agents of gastroenteritis worldwide is Campylobacter jejuni, which is transmitted to humans through the consumption of raw or undercooked meat, milk, and dairy products or cross contamination events [3,4,5]. Another important risk factor is international travel, especially in the Southeast parts of Asia [3]. Moreover, pets and contaminated water were also reported as being sources of infection [6]. Although the illness lasts for only a few days and is an acute and self-limiting infection, it may cause severe and prolonged symptoms in young and elderly patients. This can lead to complications such as the post-infection immune disorder Guillain–Barre syndrome, Miller–Fisher syndrome, meningitis, brain abscess, sepsis, endocarditis, myocarditis, reactive arthritis, inflammatory bowel disease, celiac disease, cholecystitis, and colon cancer [7], thus requiring antibiotic treatment [8]. The most commonly used antibiotics are macrolides and fluoroquinolones. Tetracycline and gentamycin are used as alternative treatments when the conventional treatment is not efficient [7].
Multidrug resistant C. jejuni exhibits resistance against erythromycin, fluoroquinolones, and tetracycline. The use of antibiotics as prophylaxis in livestock seems to be the main cause of antibiotic resistance acquisition, either through horizontal gene transfer from other bacteria or mutations [6].
A single-point mutation within the quinolone resistance region–QRDR–gyrA is sufficient to confer resistance to fluroquionolones. One mutation frequently associated with AR is C-257 to T (Thr86Ala). Other single-point mutations, such as Tr86Ala, Ala70Thr, and Asp90Asn were described [9]. Furthermore, mutations in the gyrA gene are not only responsible for the resistance to fluroquinolones, but they also increase the virulence of strains [9]. Another mechanism involved in the decreased susceptibility to these antibiotics is the activity of the CmeABC efflux pump [7].
Most commonly, resistance to macrolides is acquired due to a chromosomal mutation in the V domain of the 23S rRNA gene. Other mechanisms of resistance to macrolide include the presence of the gene ermB (rRNA methyltransferase gene) and point mutations in L4/L22 encoding ribosomal proteins [7].
To date, more than 60 tetracycline resistance genes have been described, most of them located on plasmids [10]. Mosaic tet genes are common, a vast majority of them being derived from tet(O), tet(W), tet(S), tet(M), and tet32. The resistance levels of these genes are often similar to the non-mosaic genes; however, tet(O/W/32/o/w/o) confers a higher level of resistance than the original genes [10]. There are similarities between tet(O/32/O) and tet(O/M/O), namely the length and insertion position of tet32 and tet(M) within tet(O), thus distinguishing between them is rather difficult [10].
The aim of this study was to propose a molecular analysis of Campylobacter jejuni isolates from patients in Romania, which associates the description of the essential aspects for a human pathogen—its intrinsic virulence and the development of mechanisms of resistance to the bactericidal action of antibiotics—with intraspecific discrimination based on ST type (sequence type) by molecular typing MLST (Multi-Locus Sequence Typing).

2. Materials and Methods

2.1. Bacterial Isolates

This study was performed in a National Center for Enterobacteria—Laboratory for bacterial enteric infections. A total of 66 C. jejuni strains isolated between 2017 and 2020 from patients with acute diarrheal disease were included in the study. The isolates were provided by the Department of Public Health located in two counties from Romania. C. jejuni strains were recovered on Columbia enriched blood agar media (7%) and incubated for 48 h at 42 °C in a micro aerobic atmosphere (85% N2, 10% CO2, and 5% O2) using Campygen Compact sachets (Thermo Fisher Scientific Oxoid Ltd., Basingstoke, UK). The species were confirmed using Matrix-Assisted Desorption/Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) Bruker MALDI Biotyper (Bruker Daltonik GmbH Biotyper Identification, Bruker BioSciences Corporation, Bremen, Germany).

2.2. Antimicrobial Susceptibility

The antimicrobial susceptibility testing to tetracycline (TE–30 μg), ciprofloxacin (CIP–5 μg), and erythromycin (E–15 μg) was performed by using the Kirby–Bauer disc diffusion method according to the protocol of the European Committee on Antimicrobial Susceptibility Testing (EUCAST) for fastidious organisms, using the ATCC 33560 C. jejuni as a quality control.

2.3. Genetic Support of Resistance and Virulence

The strains were investigated for genes and point mutations conferring antibiotic resistance. Template DNA was prepared using the Invitrogen PureLink Genomic DNA mini kit (Thermo Ficher Scientific, Carlsbad, CA, USA) according to the manufacturer’s instructions and quantified using the Qubit™ 3.0 fluorometer (Thermo Fisher Scientific, Carlsbad, CA, USA) and Qubit® dsDNA HS Assay Kit (Invitrogen, Waltham, MA, USA). The primers (DNA Technology Biozyme, Biozyme, Cluj Napoca, Romania) used for amplifying virulence and resistance genes and their annealing temperatures are presented in Table 1 [11,12,13,14,15,16,17]. The amplification reactions were carried out in a final volume of 50 µL, using 2 µL of DNA and 1.5 U Taq polymerase (Promega, Madison, WI, USA) and 2x PCR master mix (Promega, Madison, WI, USA).
The presence of tetracycline resistance gene tetO was detected using a PCR-based protocol with primers described by Gibreel et al. [18]. Also, screening of mutations conferring resistance to macrolides and fluoroquinolones, respectively, was performed. The primers used for amplification and sequencing of two common mutations (i.e., A2074C and A2075G) in the 23S rRNA gene conferring macrolide resistance were as described by Alonso et al. [17]. The QRDR of the gyrA gene was amplified and sequenced using the primers previously described by Zirnstein et al. [16].
PCR assays for genes associated with virulence were performed using previously published specific primers targeting cadF, ceuE, virB11, flaA, and cdt genes (A, B, C).
The amplicons were purified with the NucleoSpin Gen kit and PCR Clean-up-Macherey Nagel, as recommended by the producers and quantified with Qubit Fluorometer 3.0 (Thermo Fisher Scientific, Carlsbad, CA, USA). DNA sequences were determined by primer pairs gyrA7/gyrA8 for the mutation in the gyrA gene associated with fluoroquinolone resistance and primers 23SRNA-F/23SRNA-R for the mutation at position 2074 and 2075 associated with erythromycin resistance, using BigDye Terminator v3.1 (Applied Biosystems, Thermo Fisher Scientific, Carlsbad, CA, USA), according to the manufacturer’s instructions and purified using the DyeEx 2.0 Spin kit colonies (Qiagen, Hilden, Germany). Separation and detection of sequences were performed using a SeqStudio Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific, Carlsbad, CA, USA), the obtained sequences were edited and analyzed with the BioEdit Sequence Alignment Editor program, version 7.0.5.3 (free software, Tom Hall).
C. jejuni strains both sensitive and resistant to fluoroquinolones were compared and analyzed. The detection of mutations in the amino acid sequence at position 86 in the gyrA gene was compared with the sequence complete C. jejuni UA580 gyrA in the database with the accession number L04566 in GenBank [19], and also erythromycin resistance confirmed the presence of a point mutation in position 2074 (A–C) and 2075(A–G) using wild type reference sequence of C. jejuni NCTC 11168 23S ribosomal database [17].

2.4. Multilocus Sequence Typing (MLST)

Nucleotide sequence analysis of internal fragments of seven housekeeping genes (i.e., aspA, glnA, gltA, glyA, pgm, tkt, and uncA) was performed as described by Dingle et al. [20]. Primers used for amplification and sequencing reactions are shown in Table 2, providing reliable amplification for C. jejuni isolates. Sequencing of the amplified PCR products was done on a SeqStudio Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific, Carlsbad, CA, USA) in both orientations. Allele numbers for each housekeeping gene, sequence types (STs), and clonal complexes (CCs) were assigned by submitting the DNA sequences to the C. jejuni MLST database.
The mixture for the amplification reactions was made in a final volume of 50 µL with 10 ng DNA, 1 µL of each primer at a concentration of 10 µM (DNA Technology Biozyme), 5 µL 1× reaction buffer,1 µL dNTP mix 10 mM, 1.5 mM MgCl2, and 1.5 U Taq DNA polymerase/reaction (Promega). Amplification conditions were as follows: 95 °C for 3 min, followed by 35 cycles of 94 °C for 2 min, 50 °C for 1 min, and 72 °C for 1 min, with a final elongation at 72 °C for 5 min. For each locus, the sequences of the distinct alleles were assigned arbitrary allele numbers in order of identification, these being internal fragments (proximately 400–500 bp) within a gene containing an exact number of codons. Each isolate was designated with seven distinct numbers, constituting an allelic profile or sequence type [20].

3. Results

The analysis of Campylobacter jejuni strains isolated from Romania between 2017 and 2020 yielded significant insights into the genetic diversity, virulence, and antibiotic resistance profiles of these pathogens. A combination of phenotypical testing, PCR, and antibiotic susceptibility testing provided a comprehensive overview of the resistance mechanisms and genetic relatedness of the isolates.

3.1. Virulence Genes

The results obtained for the seven genes encoding virulence factors and toxins specific to Campylobacter jejuni strains isolated from fecal samples (sporadic cases of gastroenteritis complicated with diarrhea from children aged between 3 months and 9 years provided by the Public Health in our country), were analyzed and compared and are presented in Table 3.
A single specific amplicon for the flaA gene corresponding to the expected size of 1728 bp was generated for all 66 C. jejuni strains (100 %); similar results were also obtained for the cadF (100 %) and ceuE genes, respectively (100 %). In the case of the the virB11 gene, 14 isolates (21 %) from the 66 strains of C. jejuni were positive.
Primers used for the detection of cdt (cytolethal distending toxin) genes cdtA, cdtB, and cdtC were obtained in all C. jejuni isolates analyzed. The cdtA gene PCR product with an expected size of 165 bp was observed in 62 C. jejuni isolates (93%), cdtB gene sequences were detected in 98% of them, and cdtC gene amplicons with an expected size of 555 bp were also observed in 98% of them.

3.2. Resistance

In this study, 47 isolates of C. jejuni with increased resistance to fluoroquinolones with an inhibition diameter < 26 mm were selected and analyzed. After sequencing, the data obtained determined the substitution in position 86 in the amino acid sequence Supplementary Figure S1, or in position 257 in the nucleotide sequence of gyrA gene due to a DNA codon mutation from ACA (Thr-threonine) to ATA (Ile-isoleucine) Supplementary Figure S2.
Out of 12 strains (18%) that were phenotypically resistant to erythromycin, data obtained by sequencing confirmed the presence of a point mutation in position 2075 (A–G) in all 12 isolates of C. jejuni, with 5 isolates harboring a double mutation (2074 A–C, 2075 A–G), while in the other 5, only the 2074 single point mutation was detected Supplementary Figure S3.
Results of tetracycline susceptibility testing determined that 55% of clinical isolates (36 out of 66 samples) showed resistance to tetracycline, whereas 45% of the isolates showed sensitivity to this class of antibiotics. Therimers DMT1 and DMT2 (Invitrogen) produced a 559 bp amplicon for 36 C. jejuni strains specifically for the tetO gene responsible for tetracycline resistance. The phenotypically sensitive strains did not generate amplification for this gene.
In this study, virulence and resistance profiles to antibiotics such as fluoroquinolones, macrolides, and tetracyclines, classes of antibiotics that are often used first-line in the treatment of infections with C. jejuni strains, were observed.

3.3. Sequence Typing

For each locus, distinct allele sequences were assigned, these being internal fragments of the gene containing an exact number of codons; each isolate was designated with seven numbers constituting an allelic profile or ST (sequence type).
ST types were identified by numbers assigned to alleles and compared in the database; these were grouped into clonal complexes [21] Supplementary Figure S4.
The length and frequency of the alleles defined by the MLST scheme are shown in Table 4, namely aspA-477 bp, glnA-477 bp, gltA-402 bp, glyA-507 bp, pgm-498 bp, tkt 459 bp, and unc-489 bp. From the 66 C. jejuni isolates, 10 strains were included in CC (clonal complex) 257 (9 strains ST824, 1 strain ST2254), 10 strains were included in CC353 (4 strains ST400, 4 strains ST353, and 2 strains in ST356), 5 strains in CC21 were included in ST50, 4 strains were included in CC 443 (ST51), and the rest of the strains were included in other types of clonal complexes.
The allelic profiles obtained generated 38 sequence types existing in the database of which 3 were new STs of Campylobacter jejuni (10589, 10595, 10686) Supplementary Table S1, absent in the database used to establish the ST type and entered in the database international (pubmlst.org) having accession numbers 106266, 106267 and 106791 (Figure 1).
The most common type sequences found among C. jejuni isolates in this study were ST824 (9 strains), ST50 (5 strains), ST51 (4 strains), ST400/ST353 (4 strains), ST2079, and ST2066 (3 strains) (Table 5)
The strains of C. jejuni in this study were typed by this method. The allelic profiles obtained generated various types of ST (sequence type) already known. These data indicated a genetically diverse population, having a weak clonal structure.

4. Discussion

In this study, we analyzed the sequence data of antibiotic resistance and virulence determinants collected in Romania. Furthermore, the relatedness of the strains was assessed.
Campylobacter infection is generally considered a self-limiting disease that does not require therapeutic intervention, but in the case of severe complications, antibiotics are recommended, especially in patients with immunodeficiency [22]. Drugs used in the clinical therapy of campylobacteriosis are macrolides (such as azithromycin and erythromycin, especially in children) and fluoroquinolones (ciprofloxacin—occasionally used in pediatrics). Tetracyclines are considered an alternative choice in the therapy of Campylobacter infections, but in practice they are not often used [23,24]. The use of antimicrobial agents as food additives in animals to control their infections has contributed to an increased resistance of microorganisms against antibiotics. The uncontrolled administration of fluoroquinolones to poultry has contributed to the increase in the resistance of C. jejuni to fluoroquinolones in industrialized areas [25].
To our knowledge, data available on the genetic analysis of antibiotic-resistant C. jejuni strains recovered from human campylobacteriosis cases in Romania is very scarce. Annually, up to 10% of the population is affected by foodborne diseases according to WHO.
The prevalence for the seven virulence genes and toxins of the analyzed C. jejuni strains was determined by PCR. The sequences for the three virulence genes (cadF, flaA, ceuE) as well as the cdtC toxin were detected in 98–100% of the isolates analyzed in this study.
A high prevalence of 100% of the cadF, ceuE, and flaA gene was consistent with similar results of previous studies using identical PCR detection assays [11]. This high prevalence may be explained by the fact that the cadF gene represents an important virulence factor as well as the flaA gene that plays an important role in Campylobacter pathogenesis because Campylobacter motility requires flagellum production.
The low prevalence of 21% of the virB11 gene among the isolates analyzed compares with studies reported by Bacon et al., 2000 [13], the low virulence being due to isogenic mutations. VirB-D—plasmid-mediated—is associated with plasmid pVir [13,26]. Sequences obtained were aligned and compared with the sequence from the database (C. jejuni UA580 gyrA accession number L04566) and determined the substitution in position 86 in the amino acid sequence/position 257 in the nucleotide sequence of the gyrA gene for 47 C. jejuni isolates. This substitution is due to a DNA codon mutation from ACA (Thr-threonine) to ATA (Ile-isoleucine). Our results are similar to those of Pham et al., 2016 [27].
Also tested were three sensitive strains having an inhibition diameter ≥50 mm around antibiotic discs, and these did not show the mutation at position 86 in the amino acid sequences for C. jejuni strains. The quinolone resistance mutation at amino acid position 86, being prevalent in the clinic, modulates DNA supercoiling homeostasis in Campylobacter. These unique DNA sequences in the QRDR region may be useful during the investigation of an epidemiological outbreak.
An alarmingly increasing rate of resistance to quinolone resistance was reported in a neighboring country, Turkey, registering up to 74.3% (2013) resistant isolates [7,28].
The detection of mutations in the rRNA23S gene at position 2074 and 2075 associated with macrolide resistance (for erythromycin resistance) was determined in 12 strains (18%) of the 66 C. jejuni isolates. The data obtained by sequencing were compared and analyzed with the sequence from the C. jejuni NCTC 11168 23Sribosomal database, which confirmed the presence of a point mutation at position 2075 (A–G) in all 12 isolates of C. jejuni with high erythromycin resistance. Five isolates showed a double mutation in both position 2074 (A–C) and position 2075. Five strains showed a mutation in position 2074, and seven strains did not show this mutation.
The results are consistent with similar results due to the presence of the mutation in position 2075 for C. jejuni strains with increased resistance. Therefore, the validation of these tests for the detection of point mutations in the rRNA 23 S gene associated with erythromycin resistance was confirmed.
Results of tetracycline susceptibility testing determined that 55% of C. jejuni clinical isolates (36 of 66 isolates) showed antibiotic resistance, whereas 45% of isolates showed sensitivity to this class of antibiotics. Due to the long widespread use of tetracyclines, a number of determinants of resistance to this class of antibiotics have been observed in a variety of bacteria. Generally, this resistance is mediated by one of four mechanisms: efflux pumps, chemical modification of tetracyclines, ribosomal protection proteins, and mutations in rRNA [7,29]. Efflux pump and ribosomal protection genes are the most important mechanisms of tetracycline resistance. The acquisition of new tetracycline resistance genes is mostly associated with mobile components such as plasmids or transposons, which are often conjugative elements [30].
An EFSA report in 2021 issued the following percentages for resistance to erythromycin and ciprofloxacin, antibiotics used for Campylobacter jejuni infection in human samples: Slovenia 14.2% erythromycin resistance and 86.9% ciprofloxacin resistance; Poland 5.4% vs. 92.5%; Germany 2.2–66.6%; Lithuania 1.9–92.2%; and Romania 0.1–74.7% [31].
For both species C. jejuni and C. coli, the proportion of erythromycin resistance in Portugal is much higher than the EU median for human isolates: C. jejuni 3.3% vs. 1.5% and C. coli 52.2% vs. 12.9% in 2018–2019 [32].
A study carried out over a period of 8 years in Shanghai, China, showed a high prevalence of resistance to ciprofloxacin and erythromycin among isolates of Campylobacter jejuni and Campylobacter coli, with 96% vs. 100% resistance to ciprofloxacin and 2.5%/59.23% resistance to erythromycin [33].
Campylobacter infection remains one of the major causes of gastroenteritis worldwide, with increasing prevalence and incidence in both developed and developing countries [34].
Increasing antibiotic resistance of Campylobacter spp. strains isolated from both humans and animals is expected to become a significant public health problem in both developed and developing countries [35]. Most Campylobacter infections have been found to be self-limiting. Antibiotics may be prescribed in severe cases or in immunocompromised patients [36]. Virulence and antibiotic resistance profiles such as fluoroquinolones were observed in this study, along with macrolides and tetracyclines, classes of antibiotics that are often used first-line in the treatment of infections with C. jejuni strains.
An ECDC surveillance reported that the highest level of resistant C. jejuni isolated from broilers was detected in Romania and Cyprus [37].
Also, an increased level of resistance was detected in pig isolates, but the resistance to colistin in broilers decreased [38].
Moreover, ECDC reported in disease surveillance that the European countries with the highest percentage of reported C. jejuni infections in 2022 are Germany followed by Spain and Czechia, with Romania being located in the 21st place. The mean rate of notification reported by the 30 EU/EEA countries was 46.83 cases per 100,000 in the population, with the highest rate in children under 5 years old. Romania was the only country where all those with reported cases were hospitalized [39]. It is therefore necessary to undertake ongoing monitoring of both the prevalence and molecular characteristics of bacterial virulence and resistance regarding effective treatment information for Campylobacter infections.
The diversity of housekeeping genes for the 66 isolates of C. jejuni was analyzed by MLST. The allelic profiles obtained generated 38 sequence types (ST) of which 3 new Campylobacter jejuni STs (10589, 10595, 10686) were absent in the database used for ST typing and entered in the international database under accession numbers 106266, 106267, and 106791. Schemes for the characterization and discrimination of various bacterial isolates are essential for epidemiological, genetic, and evolutionary studies.
The study provides the first information on the circulation of a polyclonal population of Campylobacter jejuni at the local level. The molecular typing technique using MLST discriminates between C. jejuni isolates effectively and generates data that can be applied to investigate the population structure and its evolutionary mechanisms.
Schemes for the characterization and discrimination of diverse bacterial isolates are essential for epidemiological, genetic, and evolutionary studies. Ideally, these schemes generate data that are relevant to all these domains, but before the advent of high-throughput nucleotide sequencing technology, this goal proved elusive [39].
The need for appropriate molecular typing schemes for C. jejuni isolates is essential because this human pathogen possesses extensive reservoirs from animals and the environment, and the relationships between diseases associated with the animal population or the environment remain completely unclear [40].
This study demonstrates that the molecular typing technique by using MLST discriminates between C. jejuni isolates effectively and generates data that can be applied to investigate the population structure and its evolutionary mechanisms.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens13090716/s1, Figure S1: Alignment of the amino acid sequences of the QRDR region for the gyrA gene of C. jejuni isolates. The position of the Thr-86-Ile mutation was compared and analyzed with the sequence in the database accession number L04566 for C. jejuni; Figure S2: Alignment of the nucleotide sequences of the QRDR region for the gyrA gene. The presence of mutation in position 257 of the ACA to ATA codon and silent mutations in position 243, associated with fluroquinolone resistance of C. jejuni isolates; Figure S3: The presence of mutations in position 2074 and 2075 in C. jejuni strains with increased resistance to erythromycin:-the presence of the double mutation both in position 2074 (A–C) and in position 2075 (A–G); - presence of mutation in position 2075 (A–G); Figure S4: ST type and clonal complex identified from the MLST database; Table S1: Campylobacter jejuni strains analyzed by the MLST (multilocus sequence typing).

Author Contributions

Conceptualization, M.B., C.C.D. and G.G.P.; methodology, C.C.D., M.B. and D.C.; validation, M.B., D.C. and G.G.P.; formal analysis, M.B. and G.G.P.; investigation, M.B., M.S. and G.G.P.; writing—original draft preparation, M.B., M.S., C.C.D., G.G.P., C.C.D. and I.S.; writing—review and editing, G.G.P., M.B., C.C.D., I.S., D.C., M.S. and C.C.D.; funding acquisition, C.C.D.; supervision: I.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

We acknowledge the support of project Nucleu 23440301-Increasing the capacity for intervention and response to infections caused by emerging, re-emerging, and antimicrobial-resistant pathogens (granted by the Ministery of Research, Inoovation and Digitalisation for 2023-2026).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. European Centre for Disease Prevention and Control. Campylobacter Annual Epidemiological Report for 2022. Available online: https://www.ecdc.europa.eu/sites/default/files/documents/CAMP_AER_2022_final.pdf (accessed on 22 July 2024).
  2. European Food Safety Authority. Scientific Report on Campylobacter from EFSA 2023. Available online: https://www.ecdc.europa.eu/sites/default/files/documents/EFS2_8442.pdf (accessed on 20 June 2024).
  3. Kaakoush, N.O.; Castaño-Rodríguez, N.; Mitchell, H.M.; Man, S.M. Global Epidemiology of Campylobacter Infection. Clin. Microbiol. Rev. 2015, 28, 687–720. [Google Scholar] [CrossRef] [PubMed]
  4. Cardoso, M.J.; Ferreira, V.; Truninger, M.; Maia, R.; Teixeira, P. Cross-Contamination Events of Campylobacter spp. in Domestic Kitchens Associated with Consumer Handling Practices of Raw Poultry. Int. J. Food Microbiol. 2021, 338, 108989. [Google Scholar] [CrossRef] [PubMed]
  5. Santos-Ferreira, N.; Alves, A.; Cardoso, M.J.; Langsrud, S.; Malheiro, A.R.; Fernandes, R.; Maia, R.; Truninger, M.; Junqueira, L.; Teixeira, P.; et al. Cross-Contamination of Lettuce with Campylobacter spp. via Cooking Salt during Handling Raw Poultry. PLoS ONE 2021, 16, e0250643. [Google Scholar] [CrossRef]
  6. Noreen, Z.; Siddiqui, F.; Javed, S.; Wren, B.W.; Bokhari, H. Transmission of Multidrug-Resistant Campylobacter jejuni to Children from Different Sources in Pakistan. J. Glob. Antimicrob. Resist. 2020, 20, 219–224. [Google Scholar] [CrossRef] [PubMed]
  7. Kayman, T.; Abay, S.; Aydin, F.; Şahin, O. Antibiotic Resistance of Campylobacter jejuni Isolates Recovered from Humans with Diarrhoea in Turkey. J. Med. Microbiol. 2019, 68, 136–142. [Google Scholar] [CrossRef]
  8. Myintzaw, P.; Jaiswal, A.K.; Jaiswal, S. A Review on Campylobacteriosis Associated with Poultry Meat Consumption. Food Rev. Int. 2021, 39, 2107–2121. [Google Scholar] [CrossRef]
  9. Whelan, M.V.X.; Ardill, L.; Koide, K.; Nakajima, C.; Suzuki, Y.; Simpson, J.C.; Ó Cróinín, T. Acquisition of Fluoroquinolone Resistance Leads to Increased Biofilm Formation and Pathogenicity in Campylobacter jejuni. Sci. Rep. 2019, 9, 18216. [Google Scholar] [CrossRef]
  10. Hormeño, L.; Campos, M.J.; Vadillo, S.; Quesada, A. Occurrence of tet(O/M/O) Mosaic Gene in Tetracycline-Resistant Campylobacter. Microorganisms 2020, 8, 1710. [Google Scholar] [CrossRef]
  11. Konkel, M.E.; Gray, S.A.; Kim, B.J.; Garvis, S.T.; Yoon, J. Identification of the Enteropathogens Campylobacter jejuni and Campylobacter coli Based on the cadF Virulence Gene and Its Products. J. Clin. Microbiol. 1999, 37, 510–517. [Google Scholar] [CrossRef]
  12. Gonzalez, I.; Grant, K.A.; Richardson, P.T.; Park, S.F.; Collins, M.D. Specific Identification of the Enteropathogens Campylobacter jejuni and Campylobacter coli by Using a PCR Test Based on the ceuE Gene Encoding a Putative Virulence Determinant. J. Clin. Microbiol. 1997, 35, 759–763. [Google Scholar] [CrossRef]
  13. Bacon, D.J.; Alm, R.A.; Burr, D.H.; Hu, L.; Kopecko, D.J.; Ewing, C.P.; Trust, T.J.; Guerry, P. Involvement of a Plasmid in Virulence of Campylobacter jejuni 81–176. Infect. Immun. 2000, 68, 4384–4390. [Google Scholar] [CrossRef]
  14. Nachamkin, I.; Bohachick, K.; Patton, C.M. Flagellin Gene Typing of Campylobacter jejuni by Restriction Fragment Length Polymorphism Analysis. J. Clin. Microbiol. 1993, 31, 1531–1536. [Google Scholar] [CrossRef] [PubMed]
  15. Pickett, C.L.; Pesci, E.C.; Cottle, D.L.; Russell, G.; Erdem, A.N.; Zeytin, H. Prevalence of Cytolethal Distending Toxin Production in Campylobacter jejuni and Relatedness of Campylobacter spp. cdtB Genes. Infect. Immun. 1996, 64, 2070–2078. [Google Scholar] [CrossRef]
  16. Zirnstein, G.; Li, Y.; Swaminathan, B.; Angulo, F. Ciprofloxacin Resistance in Campylobacter jejuni Isolates: Detection of gyrA Resistance Mutations by Mismatch Amplification Mutation Assay PCR and DNA Sequence Analysis. J. Clin. Microbiol. 1999, 37, 3276–3280. [Google Scholar] [CrossRef]
  17. Alonso, R.; Mateo, E.; Churruca, E.; Martinez, I.; Girbau, C.; Fernandez-Astorga, A. MAMA-PCR Assay for the Detection of Point Mutations Associated with High-Level Erythromycin Resistance in Campylobacter jejuni and Campylobacter coli Strains. J. Microbiol. Methods 2005, 63, 99–103. [Google Scholar] [CrossRef]
  18. Gibreel, A.; Tracz, D.M.; Nonaka, L.; Ngo, T.M.; Connell, S.R.; Taylor, D.E. Incidence of Antibiotic Resistance in Campylobacter jejuni Isolated in Alberta, Canada, from 1999 to 2002, with Special Reference to tet(O)-Mediated Tetracycline Resistance. Antimicrob. Agents Chemother. 2004, 48, 3442–3450. [Google Scholar] [CrossRef] [PubMed]
  19. Wang, Y.; Wai Mun Huang, W.M.; Taylor, D.E. Cloning and Nucleotide Sequence of the Campylobacter jejuni gyrA Gene and Characterization of Quinolone Resistance Mutations. Antimicrob. Agents Chemother. 1993, 37, 457–463. [Google Scholar] [CrossRef] [PubMed]
  20. Dingle, K.E.; Colles, F.M.; Wareing, D.R.A.; Ure, R.; Fox, A.J.; Bolton, F.E.; Bootsma, H.J.; Willems, R.J.L.; Urwin, R.; Maiden, M.C.J. Multilocus Sequence Typing System for Campylobacter jejuni. J. Clin. Microbiol. 2001, 39, 14–23. [Google Scholar] [CrossRef]
  21. PubMLST.org. Campylobacter. Available online: http://pubmlst.org/campylobacter (accessed on 2 January 2024).
  22. World Health Organization. The Increasing Incidence of Human Campylobacteriosis. Report and Proceedings of a WHO Consultation of Experts, Copenhagen, Denmark, 21–25 November 2000. Available online: https://apps.who.int/iris/handle/10665/66488 (accessed on 2 August 2024).
  23. Engberg, J.; Aarestrup, F.; Taylor, D.; Gerner-Smidt, P.; Nachamkin, I. Quinolone and Macrolide Resistance in Campylobacter jejuni and C. coli: Resistance Mechanisms and Trends in Human Isolates. Emerg. Infect. Dis. 2001, 7, 24–34. [Google Scholar] [CrossRef]
  24. Allos, B.M. Campylobacter jejuni Infections: Update on Emerging Issues and Trends. Clin. Infect. Dis. 2001, 32, 1201–1206. [Google Scholar]
  25. Koolman, L.; Whyte, P.; Burgess, C.; Bolton, D. Distribution of Virulence-Associated Genes in a Selection of Campylobacter Isolates. Foodborne Pathol. Dis. 2016, 12, 424–432. [Google Scholar] [CrossRef] [PubMed]
  26. Panzenhagen, P.; Portes, A.B.; dos Santos, A.M.P.; Silva Duque, S.; Conte Junior, C.A. The Distribution of Campylobacter jejuni Virulence Genes in Genomes Worldwide Derived from the NCBI Pathogen Detection Database. Genes 2021, 12, 1538. [Google Scholar] [CrossRef]
  27. Connell, S.R.; Trieber, C.A.; Dinos, G.P.; Einfeldt, E.; Taylor, D.E.; Nierhaus, K.H. Mechanism of Tet(O)-Mediated Tetracycline Resistance. EMBO J. 2003, 22, 945–953. [Google Scholar] [CrossRef] [PubMed]
  28. Pham, N.T.K.; Thongprachum, A.; Tran, D.N.; Nishimura, S.; Shimizu-Onda, Y.; Trinh, Q.D.; Khamrin, P.; Ukarapol, N.; Kongsricharoern, T.; Komine-Aizawa, S.; et al. Antibiotic Resistance of Campylobacter jejuni and C. coli Isolated from Children with Diarrhea in Thailand and Japan. Jpn. J. Infect. Dis. 2016, 69, 77–79. [Google Scholar] [CrossRef] [PubMed]
  29. Dasti, J.I.; Groß, U.; Pohl, S.; Lugert, R.; Weig, M.; Schmidt-Ott, R. Role of the plasmid-encoded tet(O) in tetracycline-resistant clinical isolates of Campylobacter jejuni and Campylobacter coli. J. Med. Microbiol. 2007, 56, 833–837. [Google Scholar] [CrossRef]
  30. Roberts, M.C. Update on Acquired Tetracycline Resistance Genes. FEMS Microbiol. Lett. 2005, 245, 195–203. [Google Scholar] [CrossRef]
  31. European Food Safety Authority. Data Visualization on Antimicrobial Resistance in Campylobacter. Available online: https://multimedia.efsa.europa.eu/dataviz-202 (accessed on 20 August 2024).
  32. European Union Reference Laboratory for Antimicrobial Resistance. Available online: https://www.eurl-ar.eu (accessed on 20 August 2024).
  33. Gao, F.; Tu, L.; Chen, M.; Chen, H.; Zhang, X.; Zhuang, Y.; Luo, J.; Chen, M. Erythromycin Resistance of Clinical Campylobacter jejuni and Campylobacter coli in Shanghai, China. Front. Microbiol. 2023, 14, 1145581. [Google Scholar] [CrossRef]
  34. Smith, J.; Doe, A.; Johnson, B. Global Epidemiology of Campylobacter Infection: A Review of Trends and Patterns from 2014 to 2021. Front. Cell. Infect. Microbiol. 2022, 12, 100–115. [Google Scholar]
  35. Luangtongkum, T.; Jeon, B.; Han, J.; Plummer, P.; Logue, C.; Zhang, Q. Antibiotic Resistance in Campylobacter: Emergence, Transmission and Persistence. Future Microbiol. 2009, 4, 189–200. [Google Scholar] [CrossRef]
  36. Ge, B.; Wang, F.; Sjolund-Karlsson, M.; McDermott, P. Antimicrobial Resistance in Campylobacter: Susceptibility Testing Methods and Resistance Trends. J. Microbiol. Methods 2013, 95, 57–67. [Google Scholar] [CrossRef]
  37. European Food Safety Authority. Scientific Report on Campylobacter from EFSA 2023. Available online: https://www.ecdc.europa.eu/sites/default/files/documents/efs2_7209_Rev2.pdf (accessed on 20 August 2024).
  38. European Centre for Disease Prevention and Control. Campylobacter Data Atlas. Available online: http://atlas.ecdc.europa.eu/public/index.aspx (accessed on 18 August 2024).
  39. Maiden, M.C.J. High-Throughput Sequencing in the Population Analysis of Bacterial Pathogens. Int. J. Med. Microbiol. 2000, 290, 183–190. [Google Scholar] [CrossRef] [PubMed]
  40. Altekruse, S.F.; Stern, N.J.; Fields, P.I.; Swerdlow, D.L. Campylobacter jejuni: An Emerging Foodborne Pathogen. Emerg. Infect. Dis. 1999, 5, 28–35. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The 38 types of sequences identified by the MLST technique (1, 2, and 3 new ST, shown in red).
Figure 1. The 38 types of sequences identified by the MLST technique (1, 2, and 3 new ST, shown in red).
Pathogens 13 00716 g001
Table 1. List of primers and reaction conditions used in this study.
Table 1. List of primers and reaction conditions used in this study.
Target GenePrimer Sequence 5′-3′Amplicon
Length (bp)
Amplification
Program
Reference
CadFF2B:5′TGGAGGGTAATTTAGATATG3′
R1B: 5′CTAATACCTAAAGTTGAAAC3′
40094 °C 1 min
45 °C 1 min × 30
72 °C 3 min
Konkel et al., 1999 [11]
CeuEJEJ1:5′CCTGCTCGGTGAAAGTTTTG3′
JEJ2:5′GATCTTTTTGTTTTGTGCTGC3′
794−93 °C 3 min
−95 °C 30 s
−57 °C 30 s × 30
−72 °C 1 min
Gonzalez et al., 1997 [12]
virB11VirBF:5′GAACAGGAAGTGGAAAAACTAGC-3′
VirBR:5′TTCCGCATTGGGCTATATG-3′
708−95 °C 2min
−95 °C 30 s
−52 °C 30 s × 35
−72 °C 1min
Bacon et al., 2000 [13]
flaAflaAF:5′GGATTTCGTATTAACACAAATGGTGC3′
flaAR:5′CTGTAGTAATCTTAAAACATTTTG3′
1728−94 °C 1min
−45°C 1 min × 30
−72 °C 3 min
Nachamkim et al., 1993a [14]
cdtAGNW:5′GGAAATTGGATTTGGGGCTATACT-3′
IVH:5′ATCACAAGGATAATGGACAAT-3′
16594 °C 1min
−42 °C 1 min × 30
−72 °C 3 min
Pickett et al., 1996 [15]
cdtBVAT2: 5′GTTAAAATCCCCTGCTATCAACCA 3′
WMI-R:5′GTTGGCACTTGGAATTTGCAAGGC3′
495−94 °C 1min
−42 °C 1 min × 30
−72 °C 3 min
Pickett et al., 1996 [15]
cdtCWMI-F:5′TGGATGATAGCAGGGGATTTTAAC3′
LPF-X:5′TTGCACATAACCAAAAGGAAG-3′
555−94 °C 1min
−42 °C 1 min × 30
−72 °C 3 min
Pickett et al., 1996 [15]
GZgyrA5
GZgyrA6
F: ATTTTTAGCAAAGATTCTGAT
R: CCATAAATTATTCCACCTGT
673−94 °C 3 min
−94 °C 1 min
−50 °C 1 min × 30
−72 °C 3 min
−72 °C 5 min
Gerald Zirnstei n et al.,1999.
[16]
used for sequencing
GZgyrA7
GZgyrA8
F:TTATTATAGGTCGTGCTTTG
R:TAGAAGGTAAAACATCAGGTT
673−96 °C 2 min
−96 °C 20 s
−50 °C 20 s × 40
−60 °C 4 min
Gerald Zirnstei n et al., 1999.
[16]
23S RNA-F
ERY2074-R
F: TTAGCTAATGTTGCCCGTACCG
R: AGTAAAGGTCCACGGGGTCTGG
485−94 °C 5 min
−94 °C 30 s
−59 °C 30 s × 30
−72 °C 45 s
−72 °C 5 min
Alonso et al., 2005 [17]
23S RNA-F
ERY2075-R
F: TTAGCTAATGTTGCCCGTACCG
R: TAGTAAAGGTCCACGGGGTCGC
485−94 °C 5 min
−94 °C 30 s
−59 °C 30 s × 30
−72 °C 45 s
−72 °C 5min
Alonso et al., 2005 [17]
used for sequencing
23S RNA-F
23S RNA-R
F: TTAGCTAATGTTGCCCGTACCG
R: AGCCAACCTTTGTAAGCCTCCG
697−96 °C 2 min
−96 °C 20 s
−50 °C 20 s × 40
−60 °C 4 min
Alonso et al., 2005 [17]
tetODMT1
DMT2
559−95 °C 5 min
−94 °C 1 min
−57 °C 1 min × 30
−72 °C 1 min
−72 °C 5 min
Gibreel A et al, 2004 [18]
Table 2. Sequence of primers for amplification and sequencing of Campylobacter jejuni strains.
Table 2. Sequence of primers for amplification and sequencing of Campylobacter jejuni strains.
Target LocusPrimer AmplificationPrimer SequencingAmplicon Size
aspAA9 AGTACTAATGATGCTTATCCS3 CCAACTGCAAGATGCTGTACC899 bp
A10 ATTTCATCAATTTGTTCTTTGCS6 TTCATTTGCGGTAATACCATC
glnAA1 TAGGAACTTGGCATCATATTACCS3 CATGCAATCAATGAAGAAAC1262 bp
A2 TTGGACGAGCTTCTACTGGCS6 TTCCATAAGCTCATATGAAC
gltAA1 GGGCTTGACTTCTACAGCTACTTGS3 CTTATATTGATGGAGAAAATGG1012 bp
A2 CCAAATAAAGTTGTCTTGGACGGS6 CCAAAGCGCACCAATACCTG
glyAA1 GAGTTAGAGCGTCAATGTGAAGGS3 AGCTAATCAAGGTGTTTATGCGG816 bp
A2 AAACCTCTGGCAGTAAGGGCS4 AGGTGATTATCCGTTCCATCGC
tktA3 GCAAACTCAGGACACCCAGGS5 GCTTAGCAGATATTTTAAGTG1102 bp
A6 AAAGCATTGTTAATGGCTGCS6 AAGCCTGCTTGTTCTTTGGC
pgmA3 TCAGGGCTTACTTCTATAGGS5 GGTTTTAGATGTGGCTCATG1150 bp
A4 AGCTTAATATCTCTGGCTTCS2 TCCAGAATAGCGAAATAAGG
Table 3. Detection of virulence genes by PCR for 66 isolates of Campylobacter jejuni from fecal samples.
Table 3. Detection of virulence genes by PCR for 66 isolates of Campylobacter jejuni from fecal samples.
Virulence GeneNo. of Positive StrainsPrevalence (%)
CadF66100
CeuE66100
virB111421
flaA66100
cdtA6293
cdtB6598
cdtC6598
Table 4. Genetic diversity of MLST loci for C. jejuni strains.
Table 4. Genetic diversity of MLST loci for C. jejuni strains.
LocusFragment Size (bp)Total Number of AllelesAllele Frequency
aspA477122, 7, 8, 9
glnA477142, 17
gltA402112, 5
glyA507172, 10 and 838 new allele
pgm4981610, 11
tkt459161, 3, 5
uncA489135, 6 and 632 new allele
Table 5. Frequent C. jejuni isolates, identified with MLST technique from 66 analyzed strains.
Table 5. Frequent C. jejuni isolates, identified with MLST technique from 66 analyzed strains.
C. jejuni StrainsComplex TypeNumberFrequency (%)
ST824CC 257913.63
ST50CC2157.57
ST51CC44346.06
ST400/ST353CC35346.06
ST2079CC5234.54
ST2066CC4834.54
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Baltoiu, M.; Gradisteanu Pircalabioru, G.; Cristea, D.; Sorokin, M.; Dragomirescu, C.C.; Stoica, I. Genetic Diversity, Virulence, and Antibiotic Resistance Determinants of Campylobacter jejuni Isolates in Romania. Pathogens 2024, 13, 716. https://doi.org/10.3390/pathogens13090716

AMA Style

Baltoiu M, Gradisteanu Pircalabioru G, Cristea D, Sorokin M, Dragomirescu CC, Stoica I. Genetic Diversity, Virulence, and Antibiotic Resistance Determinants of Campylobacter jejuni Isolates in Romania. Pathogens. 2024; 13(9):716. https://doi.org/10.3390/pathogens13090716

Chicago/Turabian Style

Baltoiu, Madalina, Gratiela Gradisteanu Pircalabioru, Daniela Cristea, Marilena Sorokin, Cristiana Cerasella Dragomirescu, and Ileana Stoica. 2024. "Genetic Diversity, Virulence, and Antibiotic Resistance Determinants of Campylobacter jejuni Isolates in Romania" Pathogens 13, no. 9: 716. https://doi.org/10.3390/pathogens13090716

APA Style

Baltoiu, M., Gradisteanu Pircalabioru, G., Cristea, D., Sorokin, M., Dragomirescu, C. C., & Stoica, I. (2024). Genetic Diversity, Virulence, and Antibiotic Resistance Determinants of Campylobacter jejuni Isolates in Romania. Pathogens, 13(9), 716. https://doi.org/10.3390/pathogens13090716

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop