Next Article in Journal
The Application of Rat Models in Staphylococcus aureus Infections
Previous Article in Journal
Use of Matrix-Assisted and Laser Desorption/Ionization Time-of-Flight Technology in the Identification of Aeromonas Strains Isolated from Retail Sushi and Sashimi
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 13
Issue 6
10.3390/pathogens13060433
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

The Effect of Caco-2 Cells on Sporulation and Enterotoxin Expression by Foodborne Clostridium perfringens

by
Chao Wang
1,
Tom Defoirdt
2 and
Andreja Rajkovic
1,*
1
Laboratory of Food Microbiology and Food Preservation, Department of Food Technology, Safety and Health, Faculty of Bioscience Engineering, Ghent University, 9000 Ghent, Belgium
2
Center for Microbial Ecology and Technology, Department of Biotechnology, Faculty of Bioscience Engineering, Ghent University, 9000 Ghent, Belgium
*
Author to whom correspondence should be addressed.
Pathogens 2024, 13(6), 433; https://doi.org/10.3390/pathogens13060433
Submission received: 24 April 2024 / Revised: 13 May 2024 / Accepted: 19 May 2024 / Published: 21 May 2024
(This article belongs to the Section Bacterial Pathogens)
Browse Figures
Versions Notes

Abstract

:
Clostridium perfringens enterotoxin (Cpe)-producing strains cause gastrointestinal infections in humans and account for the second-largest number of all foodborne outbreaks caused by bacterial toxins. The Cpe toxin is only produced during sporulation; this process might be affected when C. perfringens comes into contact with host cells. The current study determined how the cpe expression levels and spore formation changed over time during co-culture with Caco-2 cells (as a model of intestinal epithelial cells). In co-culture with Caco-2 cells, total C. perfringens cell counts first decreased and then remained more or less stable, whereas spore counts were stable over the whole incubation period. The cpe mRNA level in the co-culture with Caco-2 cells increased more rapidly than in the absence of Caco-2 cells (3.9-fold higher levels in coculture than in the absence of Caco-2 cells after 8 h of incubation). Finally, we found that cpe expression is inhibited by a cue released by Caco-2 cells (8.3-fold lower levels in the presence of supernatants of Caco-2 cells than in the absence of the supernatants after 10 h of incubation); as a consequence, the increased expression in co-culture with Caco-2 cells must be caused by a factor associated with the Caco-2 cells.

1. Introduction

Clostridium perfringens is a common pathogen causing histotoxic and intestinal infections in humans and animals [1,2]. Secreted toxins of C. perfringens play a vital role in host infection. The bacterium can produce 23 different toxins and many extracellular hydrolytic enzymes [3,4,5,6]. Strains belonging to this species are divided into seven types (from type A to G) based on the presence or absence of the main toxins [5,7]. C. perfringens enterotoxin (Cpe) is a toxin that causes food poisoning, and strains producing this toxin belong to C. perfringens type F.
Humans and animals are usually infected after coming into contact with foodborne C. perfringens, and the production of Cpe depends on sporulation [8]. The bacterial cells start an asymmetrical division to initiate the sporulation process and form a forespore and a mother cell. Forespores are released and mother cells lyse during the sporulation process, thereby releasing the toxin. After this, the toxin can exert its activity in the host intestine [9,10]. Thus far, research studies have primarily focused on sporulation media, growth characteristics, and the production of Cpe protein, but the cpe expression kinetics during sporulation have not been studied.
The human epithelial cell line Caco-2 is widely used as a model for investigating the interaction between a toxin and the human host. Previous studies focused on the role of Cpe in activating the cell death pathway in the host or on investigating morphological effects of host exposure to Cpe [11,12,13,14,15]. Yasugi and coworkers found that type F C. perfringens strains only showed severe cytotoxicity during Cpe production and sporulation in co-culture with Caco-2 cells [16]. Also, they determined Cpe production in the presence of Caco-2 cells after 12 h by Western blot and reversed passive latex agglutination. However, cpe expression kinetics have not been reported during co-culture with host cells. Meanwhile, understanding cpe expression is vital to control C. perfringens enterotoxin production. Therefore, the aim of this study was to determine the impact of interaction with host cells on cpe expression and sporulation of C. perfringens, using Caco-2 cells as a model.

2. Materials and Methods

2.1. Bacterial Strain and Growth Conditions

The strain LMG 453, a C. perfringens type F food poisoning isolate [5,17], was obtained from the BCCM/LMG culture collection, stored at −75 °C on glass beads, and revived in 9 mL brain heart infusion broth (BHI, CM1135, Oxoid, Hampshire, UK) overnight at 37 °C in an anaerobic jar (HP0011A, Oxoid, Hampshire, UK) with an anaerobic indicator (BR0055, Oxoid, Hampshire, UK) and an anaerobic sachet (AN0035, Oxoid, Hampshire, UK). Overnight cultures were transferred into cold storage tubes (375418PK, Nunc, Thermo Scientific, Waltham, MA, USA) with 20% sterilized glycerol (CL00.0706, Chem-Lab, Zedelgem, Belgium) and stored at −75 °C until further use. To confirm the purity of C. perfringens, loops of the stock cultures were streaked on Tryptic Soy Agar (CM0131, Oxoid) plates and anaerobically incubated for 24 h at 37 °C, then stored at 4 °C as work stocks for up to 3 weeks. Trypticase peptone glucose yeast extract broth (50 g/L pancreatic digest of casein, 211921, BD; 5 g/L peptone, LP0034, Oxoid, Hampshire, UK; 20 g/L yeast extract, LP0021, Oxoid, Hampshire, UK; 4 g/L glucose, CL00.0710, Chem-Lab, Zedelgem, Belgium; 1 g/L sodium thioglycolate, STBJ0402, Sigma-Aldrich, St. Louis, MO, USA), and brain heart infusion agar (15 g/L agar LP0011, Oxoid, Hampshire, UK and 37 g/L BHI, CM1135, Oxoid, Hampshire, UK) were used to grow and count C. perfringens, respectively [18].

2.2. Sporulation of C. perfringens

A single colony of a stock culture was transferred to 10 mL of trypticase peptone glucose yeast extract broth, anaerobically incubated at 37 °C for 19 to 20 h, after which, 200 µL of the grown culture was transferred into a tube containing fresh trypticase peptone glucose yeast extract broth for the second overnight growth. The modified Duncan Strong medium (15 g/L proteose peptone, LP0085, Oxoid, Hampshire, UK; 4 g/L yeast extract, LP0021, Oxoid, Hampshire, UK; 1 g/L sodium thioglycolate, STBJ0402, Sigma-Aldrich, St. Louis, MO, USA; 10 g/L sodium phosphate dibasic, BCBV5946, Sigma-Aldrich; 4 g/L raffinose, BCCC1674, Sigma-Aldrich) was used for C. perfringens sporulation. The pH was adjusted to 7.8 ± 0.1 at room temperature before use, and the medium was prepared within three days before use [18,19]. Ten per cent by volume of a grown C. perfringens culture was transferred into a sterilized modified Duncan Strong medium and anaerobically incubated at 37 °C to initiate sporulation [19]. All samples were heated to 70.5 °C in a water bath (GD 120, Grant Instruments Ltd., Cambridge, UK) for 20 min to inactivate vegetative C. perfringens cells and then promptly cooled on ice water for at least 3 min. Then, samples were serially diluted in peptone physiological solution (1 g/L peptone; 8.5 g/L NaCl, S9888, Sigma-Aldrich) and spread-plated on brain heart infusion agar in duplicate, after which the plates were anaerobically incubated for 24 h at 37 °C. The experiment was repeated three times.

2.3. Caco-2 Cell Culture

Caco-2 cells (ATCC HTB37) were obtained from the American Type Culture Collection. The cells were cultivated in Dulbecco’s Modified Eagle Medium supplemented with GlutaMAX (10569010, Life Technologies Limited, Renfrew, UK), 10% fetal bovine serum (F7524, Sigma-Aldrich), 1% non-essential amino acids (11140035, Life Technologies Limited, Renfrew, UK), and 1% penicillin/streptomycin (15140122, Life Technologies Limited, Renfrew, UK). Caco-2 cells were grown aerobically at 37 °C in a humidified environment containing 10% CO2 and subcultured by trypsinization at 80% confluency. The medium was changed every two or three days, and the cells were passaged less than 50 times.

2.4. Collection of Caco-2 Cell Supernatants

Caco-2 cells were grown in Dulbecco’s Modified Eagle Medium until they reached 80% confluency. Then, the cells were washed once with phosphate-buffered saline (PBS) and then incubated in PBS without Ca2+, Mg2+ (14190144, Gibco, Life Technologies Europe B.V., Bleiswijk, The Netherlands) for 24 h aerobically at 37 °C in a humidified environment containing 10% CO2. The cell suspension was collected into a 50 mL falcon tube (02-527-3001, nerbe plus, Winsen (Luhe), Germany) and centrifuged at 1000× g for 3 min at room temperature. Then, the supernatants were filtered through a 0.22 µM filter (A35150, Novolab NV, Geraardsbergen, Belgium), and 10 mL aliquots were stored at −20 °C until further use.

2.5. Interaction between C. perfringens and Caco-2 Cells or Caco-2 Cell Supernatants

Caco-2 cells were seeded at a density of 2 × 105 cells/well in PBS in 6-well plates (657160, Greiner Bio-One, Vilvoorde, Belgium) and incubated aerobically for 24 h at 37 °C in a humidified environment containing 10% CO2 to allow the cells to adhere. C. perfringens cells were rinsed twice with PBS before further use. Subsequently, 2 mL volumes of C. perfringens in phosphate-buffered saline were added per well, with a Caco-2 cell-to-bacterium ratio of 1:100. As controls, C. perfringens cells in PBS or Caco-2 cell supernatants were added to empty wells. The suspensions were incubated for 6-12 h at 37 °C in a humidified environment containing 10% CO2. After incubation, C. perfringens were collected and separated into two groups using cell scrapers (541070, Greiner Bio-One, Vilvoorde, Belgium). One group was heated to inactivate vegetative C. perfringens cells, while the other was kept at room temperature as a control. C. perfringens cell densities were determined by spread-plating on brain heart infusion agar and anaerobic incubation for 24 h at 37 °C. Experiments were done with three biological repeats.

2.6. Determination of C. perfringens Enterotoxin (cpe) mRNA Levels

cpe mRNA levels were determined as described recently [20]. Briefly, total RNA was extracted from C. perfringens with/without Caco-2 cells using the RNeasy Protect Bacteria Mini Kit (74524, Qiagen, Hilden, Germany). Genomic DNA was removed from total RNA using the RapidOut DNA Removal Kit (K2981, Thermo Scientific, Dreieich, Germany). The concentration of extracted total RNA was measured using a Quantus™ Fluorometer (E6150, Promega, Madison, WI, USA). Following that, 1 µg of total RNA was utilized to synthesize cDNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (K1632, Thermo Scientific, Dreieich, Germany). All processes were carried out according to the manufacturer’s instructions.
The mRNA levels of cpe were quantified by reverse transcription quantitative PCR (RT-qPCR). Glyceraldehyde 3-phosphate dehydrogenase (gapdh) was used as the reference gene. The RT-qPCR mixture contained 12.5 μL PowerUp™ SYBR™ Green Master Mix (A25742, Applied Biosystems, Waltham, MA, USA), 2 μL cDNA, 500 nM forward and reverse primers (Table 1), and nuclease-free water (129115, Qiagen, Hilden, Germany) to a total volume of 25 μL.
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerSequence (5′-3′)Amplicon Size (bp)Reference
cpe FGGAGATGGTTGGATATTAGG233[21]
cpe RGGACCAGCAGTTGTAGATA  
GAPDH FAACAAGAGAACCTTTAGGGG123[20]
GAPDH RGTAGCAGGTTTAAGCACAAC  
The RT-qPCR was completed with an Applied Biosystems 7300 real-time PCR system (Applied Biosystem, Waltham, MA, USA). The conditions of RT-qPCR were as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s, 55 °C for 60 s, 72 °C for 60 s, and 1 cycle of 95 °C for 15 s, 60 °C for 60 s, 95 °C for 15 s and 60 °C for 15 s as a final extension. All experiments included at least two biological replicates for RNA extraction and three technical replicates for RT-qPCR for each sample. The relative cpe expression level was calculated using the comparative threshold cycle technique (2−ΔΔCt) [22,23].

2.7. Statistical Analyses

Data analysis was performed and generated using SPSS Statistics 26.0 software (IBM SPSS Statistics, NY, USA) and graphs were constructed using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA). All data were expressed as mean ± standard deviations. The lognormality of all enumeration and RT-qPCR data were checked by the Anderson–Darling test, D’Agostino–Pearson omnibus test, Shapiro–Wilk test, and QQ plot. Differences in cpe mRNA levels over time in the modified Duncan Strong medium were assessed using one-way ANOVA, followed by Dunnett’s post hoc test. Two-way ANOVA, followed by Tukey’s post hoc test, was used to analyze the differences between the cpe expression of C. perfringens incubated in the presence of Caco-2 cells or Caco-2 cell supernatants. Differences were considered significant if the p value was less than 0.05.

3. Results

3.1. Growth, Sporulation, and cpe Expression of C. perfringens in Modified Duncan Strong Medium

C. perfringens cell counts in modified Duncan Strong medium were determined both before and after heat treatment in order to distinguish between total cell counts and spore counts, respectively. Total cell counts increased with one log unit in the first three hours, then remained constant for 6 h, and then decreased again with one log unit (Figure 1A). OD600 measurements reflected this trend, with a maximum obtained after 9 h incubation and a gradual decrease thereafter. Spore counts, on the other hand, increased with more than 2 log units between 6 and 12 h of incubation, after which the level remained constant. From 12 h onwards, virtually all C. perfringens were spores.
The relative cpe mRNA level of C. perfringens peaked after 12 h of incubation (3.4 times higher than the level at 9 h), after which, it gradually decreased again (Figure 1B). These results demonstrate that our methodology enables us to determine sporulation and cpe expression in C. perfringens.

3.2. Survival, Sporulation, and cpe Expression of the C. perfringens Enterotoxin (cpe) Gene during Contact with Caco-2 Cells

In this experiment, we aimed to investigate the impact of exposure of C. perfringens to Caco-2 cells on sporulation and cpe mRNA levels. The total cell counts of C. perfringens and the OD600 values gradually decreased over time, with a reduction of over 2 log units in total C. perfringens cell counts during the first 8 h and a decrease of more than 0.4 OD600 units during the first 6 h (Figure 2A). The C. perfringens total cell counts decreased a bit more rapidly in co-culture than in the PBS control but reached the same level after 8 h. Spore counts, on the other hand, remained more or less stable over the incubation and did not differ between co-culture and PBS control.
We further determined the impact of co-culture with Caco-2 cells on cpe mRNA levels. In the PBS control treatment, the cpe mRNA level increased over time and was significantly different from the level at the 6 h time point after 10 h of incubation (6-fold higher than the level at the 6 h time point; Figure 2B). The cpe mRNA level in the coculture increased more rapidly and reached its maximum after 8 h already (9.8-fold higher than in the PBS control after 6 h), and at that time point, the cpe mRNA level in the coculture was significantly different from that in the PBS control (3.9-fold higher levels).

3.3. Survival, Sporulation and cpe Expression of C. perfringens in Caco-2 Cell Supernatants

In the last experiment, we aimed to determine whether the difference in cpe expression observed in co-culture with Caco-2 cells was mediated by a cue released by the Caco-2 cells. To this end, we determined the survival, sporulation, and cpe expression of C. perfringens in the presence of Caco-2 cell supernatants. Similar to what we observed in the previous experiment, the total C. perfringens cell counts and OD600 decreased at the beginning of the experiment and remained constant thereafter (Figure 3A). Also similar to the previous experiment, there was no clear trend in spore counts.
Similar to the previous experiment, the relative cpe mRNA levels increased over time in the PBS control treatment (Figure 3B). However, the cpe mRNA levels of C. perfringens incubated in Caco-2 cell supernatants were significantly lower than those in the PBS control at all sampling points, with a maximal difference at the 10 h sampling point (8.3-fold difference).
We finally compared the cpe mRNA level in PBS, in co-culture with Caco-2 cells, and in the presence of supernatants of Caco-2 cells to that in modified Duncan Strong medium and found that it was still about 25-fold lower in co-culture with Caco-2 cells than in modified Duncan Strong medium (Figure 4).

4. Discussion

In this study, we aimed to determine the impact of interaction with host cells on sporulation and cpe expression in C. perfringens. We first validated our methodology using a modified Duncan Strong medium. The modified Duncan Strong medium is the most common medium for the cultivation and induction of sporulation of C. perfringens. Although the sporulation ability and cpe expression of C. perfringens may vary from strain to strain, the strain used in this study (LMG 453) was sporulating well in this medium (Figure 1A). The spore formation did not change within the first 6 h of incubation, after which it increased dramatically (more than 100-fold difference). Similarly, De Jong and coworkers reported a significant increase in the number of spores of C. perfringens after 5 h in a modified Duncan Strong medium [19]. Sporulation is a sign for C. perfringens to produce the enterotoxin, and cpe mRNA was indeed the highest at the moment when most C. perfringens cells had sporulated (3.4-fold increase), and they decreased again thereafter. Similarly, Melville and coworkers found that the cpe mRNA of strain NCTC 10240 reached the highest level after 10 h of incubation in Duncan Strong medium, and at the same time point, the enterotoxin protein concentration also achieved the maximal level [24]. Our results indicated that the methodology we used enabled us to detect sporulation and cpe expression in the C. perfringens strain we used and, thus, could be used in further experiments.
We subsequently aimed to investigate the impact of coming into contact with human cells on sporulation and cpe expression. We used Caco-2 cells as a model as this cell line has been widely used as a model of intestinal epithelial cells [25]. We found that contact with Caco-2 cells did not induce sporulation in our strain. Rather, spore counts remained stable during incubation in the presence of Caco-2 cells (Figure 2A), whereas total C. perfringens cell counts sharply decreased (more than 100-fold) during the first hours of incubation, and this was also observed in the control, in which C. perfringens was incubated in PBS under the same conditions (aerobic incubation at 37 °C in a humidified environment containing 10% CO2). This finding reflects those of Paredes-Sabja and Sarker, who found that the total cell number of C. perfringens strain F4969 decreased during aerobic incubation in the presence of 5% CO2 in cell growth medium [26]. They also showed that the number of heat-resistant spores remained constant from 0.5 h to 24 h for three strains cocultured with Raw 264.7 cells under the same conditions. As C. perfringens is an anaerobic bacterium, the presence of oxygen was likely responsible for the decrease in total cell counts. Indeed, previous studies have demonstrated that although oxygen itself does not cause C. perfringens death immediately, it results in the formation of hydroxyl radicals, hydrogen peroxide, or superoxide radicals, which are toxic to vegetative cells of C. perfringens [27,28]. This can explain why the total number of C. perfringens cells decreased during the first hours of exposure to Caco-2 cell growth conditions.
We also measured the cpe mRNA levels during incubation under Caco-2 cell culture conditions and found that they increased over time. Remarkably, the cpe mRNA levels increased faster when cocultured with Caco-2 cells than in the PBS control (5-fold difference in cpe mRNA levels after 8 h of incubation—Figure 2B). This result is in agreement with the findings of Vidal and coworkers, who showed that ß toxin and perfringolysin O production were upregulated in type C C. perfringens when the bacterium was incubated in the presence of Caco-2 cells [29]. Interestingly, Yasugi and coworkers demonstrated the presence of Cpe in the supernatants of cocultures of type A C. perfringens and Caco-2 cells at 24 h by Western blot [16]. Although this result indicated that Cpe was produced at 24 h, the kinetics of Cpe production were not studied; therefore, our study fills this knowledge gap by showing that cpe expression is induced relatively early (i.e., within 8 h) during contact with Caco-2 cells.
It has been shown before that mammalian cells can release cues, such as hormones, which can affect toxin production in bacterial pathogens [30,31]. As Caco-2 cells are also able to produce hormones [32], we hypothesized that the increased expression of cpe might be caused by such a cue released by the Caco-2 cells. In order to investigate this possibility, cell-free supernatants of Caco-2 cells were collected and C. perfringens was subsequently exposed to it. In contrast to our expectations, cpe expression was inhibited rather than induced in these supernatants (Figure 3B). This indicates that the cpe expression in co-culture with Caco-2 cells was inhibited rather than induced by cues released from Caco-2 cells, and therefore, the induction of cpe expression in co-culture was caused by a factor that is associated with the Caco-2 cells rather than a secreted cue. We very recently reported that mucins strongly increase the expression of cpe in C. perfringens [20]. Caco-2 cells also produce mucins [33] and consequently, we hypothesize that mucins secreted by and attached to the Caco-2 cells might have been responsible for the increased expression of cpe during coculture of C. perfringens with Caco-2 cells.
Together, our results indicate that cpe expression is inhibited by a cue released by Caco-2 cells and induced by a factor associated with the cells, and in co-culture with Caco-2 cells, the inhibition is overruled by induction. This suggests that cpe expression is activated in the gut when C. perfringens is close to the epithelium, whereas it is inhibited when the bacterium is located farther away from the epithelium. The cell-associated factor inducing cpe expression might be mucin, whereas the identification of the released cue that inhibits cpe expression needs further research.

Author Contributions

Conceptualization, C.W., T.D. and A.R.; methodology, C.W., T.D. and A.R.; investigation, C.W.; validation, C.W.; formal analysis, C.W.; visualization, C.W.; writing—original draft, C.W. and T.D.; writing—review and editing, T.D. and A.R.; funding acquisition, C.W. and A.R. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the China Scholarship Council (CSC, file n° 201808630020), the Special Research Fund of Ghent University (BOF-UGent, BOF20/BAS/120), and the Research Foundation Flanders (no. 1506419N).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data associated with this article will be shared upon reasonable request to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Collie, R.E.; Kokai-Kun, J.F.; McClane, B.A. Phenotypic characterization of enterotoxigenic Clostridium perfringens isolates from non-foodborne human gastrointestinal diseases. Anaerobe 1998, 4, 69–79. [Google Scholar] [CrossRef] [PubMed]
  2. McClane, B.A.; Chakrabarti, G. New insights into the cytotoxic mechanisms of Clostridium perfringens enterotoxin. Anaerobe 2004, 10, 107–114. [Google Scholar] [CrossRef] [PubMed]
  3. Chen, J.M.; McClane, B.A.; Chen, J.M.; McClane, B.A. Characterization of Clostridium perfringens TpeL toxin gene carriage, production, cytotoxic contributions, and trypsin sensitivity. Infect. Immun. 2015, 83, 2369–2381. [Google Scholar] [CrossRef] [PubMed]
  4. Dabrowski, S.; Staat, C.; Zwanziger, D.; Sauer, R.-S.S.; Bellmann, C.; Gunther, R.; Krause, E.; Haseloff, R.F.; Rittner, H.; Blasig, I.E. Redox-sensitive structure and function of the first extracellular loop of the cell-cell contact protein claudin-1: Lessons from molecular structure to animals. Antioxid. Redox Signal. 2015, 22, 1–14. [Google Scholar] [CrossRef] [PubMed]
  5. Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microb. Infect. 2018, 7, 141. [Google Scholar] [CrossRef] [PubMed]
  6. Shrestha, A.; Uzal, F.A.; McClane, B.A. Enterotoxic Clostridia: Clostridium perfringens enteric diseases. Microbiol. Spectr. 2018, 6, GPP3-0003-2017. [Google Scholar] [CrossRef] [PubMed]
  7. Rajkovic, A.; Jovanovic, J.; Monteiro, S.; Decleer, M.; Andjelkovic, M.; Foubert, A.; Beloglazova, N.; Tsilla, V.; Sas, B.; Madder, A. Detection of toxins involved in foodborne diseases caused by Gram-positive bacteria. Compr. Rev. Food Sci. Food Saf. 2020, 19, 1605–1657. [Google Scholar] [CrossRef] [PubMed]
  8. Paredes-Sabja, D.; Sarker, M.R. Host serum factor triggers germination of Clostridium perfringens spores lacking the cortex hydrolysis machinery. J. Med. Microbiol. 2011, 60, 1734–1741. [Google Scholar] [CrossRef] [PubMed]
  9. Harry, K.H.; Zhou, R.; Kroos, L.; Melville, S.B. Sporulation and enterotoxin (CPE) synthesis are controlled by the sporulation-specific sigma factors SigE and SigK in Clostridium perfringens. J. Bacteriol. 2009, 191, 2728–2742. [Google Scholar] [CrossRef] [PubMed]
  10. Zhao, Y.L.; Melville, S.B. Identification and characterization of sporulation-dependent promoters upstream of the enterotoxin gene (cpe) of Clostridium perfringens. J. Bacteriol. 1998, 180, 136–142. [Google Scholar] [CrossRef]
  11. Chakrabarti, G.; Zhou, X.; McClane, B.A. Death pathways activated in CaCo-2 cells by Clostridium perfringens enterotoxin. Infect. Immun. 2003, 71, 4260–4270. [Google Scholar] [CrossRef] [PubMed]
  12. Garcia, J.P.; Li, J.; Shrestha, A.; Freedman, J.C.; Beingesser, J.; McClane, B.A.; Uzal, F.A. Clostridium perfringens type A enterotoxin damages the rabbit colon. Infect. Immun. 2014, 82, 2211–2218. [Google Scholar] [CrossRef] [PubMed]
  13. Low, L.-Y.; Harrison, P.F.; Gould, J.; Powell, D.R.; Choo, J.M.; Forster, S.C.; Chapman, R.; Gearing, L.J.; Cheung, J.K.; Hertzog, P.; et al. Concurrent host-pathogen transcriptional responses in a Clostridium perfringens murine myonecrosis infection. mBio 2018, 9, e00473-18. [Google Scholar] [CrossRef] [PubMed]
  14. Miyakawa, M.E.F.; Creydt, V.P.; Uzal, F.A.; McClane, B.A.; Ibarra, C. Clostridium perfringens enterotoxin damages the human intestine in vitro. Infect. Immun. 2005, 73, 8407–8410. [Google Scholar] [CrossRef]
  15. Singh, U.; Van Itallie, C.M.; Mitic, L.L.; Anderson, J.M.; McClane, B.A. CaCo-2 cells treated with Clostridium perfringens enterotoxin form multiple large complex species, one of which contains the tight junction protein occludin. J. Biol. Chem. 2000, 275, 18407–18417. [Google Scholar] [CrossRef]
  16. Yasugi, M.; Sugahara, Y.; Hoshi, H.; Kondo, K.; Talukdar, P.K.; Sarker, M.R.; Yamamoto, S.; Kamata, Y.; Miyake, M. In vitro cytotoxicity induced by Clostridium perfringens isolate carrying a chromosomal cpe gene is exclusively dependent on sporulation and enterotoxin production. Microb. Pathog. 2015, 85, 1–10. [Google Scholar] [CrossRef] [PubMed]
  17. Löffler, A.; Labbe, R.G. Intracellular proteases during sporulation and enterotoxin formation by Clostridium perfringens type A. Curr. Microbiol. 1983, 8, 187–190. [Google Scholar] [CrossRef]
  18. Atlas, R.M. Handbook of Microbiological Media; CRC Press: Boca Raton, FL, USA, 2010. [Google Scholar]
  19. De Jong, A.E.I.; Beumer, R.R.; Rombouts, F.M. Optimizing sporulation of Clostridium perfringens. J. Food Prot. 2002, 65, 1457–1462. [Google Scholar] [CrossRef] [PubMed]
  20. Wang, C.; Defoirdt, T.; Rajkovic, A. The impact of indole and mucin on sporulation, biofilm formation and enterotoxin production in foodborne Clostridium perfringens. J. Appl. Microbiol. 2024, 135, lxae083. [Google Scholar] [CrossRef] [PubMed]
  21. Meer, R.R.; Songer, J.G. Multiplex polymerase chain reaction assay for genotyping Clostridium perfringens. Am. J. Vet. Res. 1997, 58, 702–705. [Google Scholar] [CrossRef] [PubMed]
  22. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  23. Yang, Q.; Defoirdt, T. Quorum sensing positively regulates flagellar motility in pathogenic Vibrio harveyi. Environ. Microbiol. 2015, 17, 960–968. [Google Scholar] [CrossRef] [PubMed]
  24. Melville, S.B.; Labbe, R.; Sonensheinl, A.L. Expression from the Clostridium perfringens cpe promoter in C. perfringens and Bacillus subtilis. Infect. Immun. 1994, 62, 5550–5558. [Google Scholar] [CrossRef] [PubMed]
  25. Sambuy, Y.; De Angelis, G.; Ranaldi, M.L.; Scarino, A.; Stammati, F.; Zucco, F. The Caco-2 cell line as a model of the intestinal barrier: Influence of cell and culture-related factors on Caco-2 cell functional characteristics. Cell Biol. Toxicol. 2005, 21, 1–26. [Google Scholar] [CrossRef] [PubMed]
  26. Paredes-Sabja, D.; Sarker, M.R. Interactions between Clostridium perfringens spores and Raw 264.7 macrophages. Anaerobe 2012, 18, 148–156. [Google Scholar] [CrossRef] [PubMed]
  27. Briolat, V.; Reysset, G. Identification of the Clostridium perfringens genes involved in the adaptive response to oxidative stress. J. Bacteriol. 2002, 184, 2333–2343. [Google Scholar] [CrossRef] [PubMed]
  28. Jean, D.; Briolat, V.; Reysset, G. Oxidative stress response in Clostridium perfringens. Microbiology 2004, 150, 1649–1659. [Google Scholar] [CrossRef]
  29. Vidal, J.E.; Ohtani, K.; Shimizu, T.; McClane, B.A. Contact with enterocyte-like Caco-2 cells induces rapid upregulation of toxin production by Clostridium perfringens type C isolates. Cell. Microbiol. 2009, 11, 1306–1328. [Google Scholar] [CrossRef]
  30. Kendall, M.M.; Sperandio, V. What a dinner party! Mechanisms and functions of interkingdom signaling in host-pathogen associations. mBio 2016, 7, e01748. [Google Scholar] [CrossRef] [PubMed]
  31. Li, Z.; Quan, G.; Jiang, X.; Yang, Y.; Ding, X.; Zhang, D.; Wang, X.; Hardwidge, P.R.; Ren, W.; Zhu, G. Effects of metabolites derived from gut microbiota and hosts on pathogens. Front. Cell. Infect. Microbiol. 2018, 8, 314. [Google Scholar] [CrossRef] [PubMed]
  32. Song, W.Y.; Aihara, Y.; Hashimoto, T.; Kanazawa, K.; Mizuno, M. (−)-Epigallocatechin-3-gallate induces secretion of anorexigenic gut hormones. J. Clin. Biochem. Nutr. 2015, 57, 164–169. [Google Scholar] [CrossRef] [PubMed]
  33. Van Klinken, B.J.; Oussoren, E.; Weenink, J.J.; Strous, G.J.; Büller, H.A.; Dekker, J.; Einerhand, A.W. The human intestinal cell lines Caco-2 and LS174T as models to study cell-type specific mucin expression. Glycoconj. J. 1996, 13, 757–768. [Google Scholar] [CrossRef] [PubMed]
Pathogens 13 00433 g001
Figure 1. Growth, sporulation, and cpe expression of C. perfringens in modified Duncan Strong medium. (A) Total C. perfringens cell counts, spore counts, and OD600 measurements. (B) Relative cpe mRNA levels of C. perfringens during incubation in modified Duncan Strong medium. The expression level at 9 h was set at 1 and the levels at the other time points were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. The error bars represent the standard deviations of 3 biological replicates. Different letters indicate significant differences in cpe mRNA levels (one-way ANOVA, followed by Dunnett’s post hoc test; p < 0.05).
Figure 1. Growth, sporulation, and cpe expression of C. perfringens in modified Duncan Strong medium. (A) Total C. perfringens cell counts, spore counts, and OD600 measurements. (B) Relative cpe mRNA levels of C. perfringens during incubation in modified Duncan Strong medium. The expression level at 9 h was set at 1 and the levels at the other time points were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. The error bars represent the standard deviations of 3 biological replicates. Different letters indicate significant differences in cpe mRNA levels (one-way ANOVA, followed by Dunnett’s post hoc test; p < 0.05).
Pathogens 13 00433 g001
Pathogens 13 00433 g002
Figure 2. Survival, sporulation, and cpe expression of C. perfringens in co-culture with Caco-2 cells compared to the PBS control treatment. (A) Total C. perfringens cell counts, spore counts and OD600 over time. (B) Relative cpe mRNA levels of C. perfringens with/without Caco-2 cells. The expression level in the PBS treatment after 6 h was set at 1, and the expression levels for all treatments at the other time points were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. The initial ratio C. perfringens: Caco-2 cells in the co-culture was 100:1 (MOI = 100). Experiments were conducted in three biological replicates and the error bars present the standard deviations. Different letters (capitals for the PBS treatment; small letters for the co-culture) indicate significant differences in cpe mRNA levels at different time points within each treatment (Two-way ANOVA, followed by Tukey’s post hoc test; p < 0.05). p values for the comparison between PBS and co-culture at each time point are also indicated.
Figure 2. Survival, sporulation, and cpe expression of C. perfringens in co-culture with Caco-2 cells compared to the PBS control treatment. (A) Total C. perfringens cell counts, spore counts and OD600 over time. (B) Relative cpe mRNA levels of C. perfringens with/without Caco-2 cells. The expression level in the PBS treatment after 6 h was set at 1, and the expression levels for all treatments at the other time points were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. The initial ratio C. perfringens: Caco-2 cells in the co-culture was 100:1 (MOI = 100). Experiments were conducted in three biological replicates and the error bars present the standard deviations. Different letters (capitals for the PBS treatment; small letters for the co-culture) indicate significant differences in cpe mRNA levels at different time points within each treatment (Two-way ANOVA, followed by Tukey’s post hoc test; p < 0.05). p values for the comparison between PBS and co-culture at each time point are also indicated.
Pathogens 13 00433 g002
Pathogens 13 00433 g003
Figure 3. Survival, sporulation, and cpe expression of C. perfringens in Caco-2 cell supernatants (CCM) compared to the PBS control treatment. (A) Total C. perfringens cell counts, spore counts and OD600 over time. (B) Relative cpe mRNA levels. The expression level in the PBS treatment after 6 h was set at 1, and the expression levels for all treatments at the other time points were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. Experiments were done in three biological replicates and the error bars present the standard deviations. Different letters (capitals for the PBS treatment; small letters for the co-culture) indicate significant differences in cpe mRNA levels at different time points within each treatment (Two-way ANOVA, followed by Tukey’s post hoc test; p < 0.05). p values for the comparison between PBS and co-culture at each time point are also indicated.
Figure 3. Survival, sporulation, and cpe expression of C. perfringens in Caco-2 cell supernatants (CCM) compared to the PBS control treatment. (A) Total C. perfringens cell counts, spore counts and OD600 over time. (B) Relative cpe mRNA levels. The expression level in the PBS treatment after 6 h was set at 1, and the expression levels for all treatments at the other time points were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. Experiments were done in three biological replicates and the error bars present the standard deviations. Different letters (capitals for the PBS treatment; small letters for the co-culture) indicate significant differences in cpe mRNA levels at different time points within each treatment (Two-way ANOVA, followed by Tukey’s post hoc test; p < 0.05). p values for the comparison between PBS and co-culture at each time point are also indicated.
Pathogens 13 00433 g003
Pathogens 13 00433 g004
Figure 4. Relative cpe mRNA level of C. perfringens in different media (modified Duncan Strong medium, PBS, Caco-2 cell supernatants, and co-culture with Caco-2 cells) after 12 h of incubation. The initial ratio C. perfringens: Caco-2 cells in the co-culture was 100:1 (MOI = 100). The expression level in the modified Duncan Strong medium was set at 1 and the levels in the other treatments were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. Experiments were conducted with at least two biological replicates and the error bars represent standard deviations. Different letters indicate significant differences in cpe mRNA levels between treatments (Two-way ANOVA, followed by Tukey’s post hoc test; p < 0.05).
Figure 4. Relative cpe mRNA level of C. perfringens in different media (modified Duncan Strong medium, PBS, Caco-2 cell supernatants, and co-culture with Caco-2 cells) after 12 h of incubation. The initial ratio C. perfringens: Caco-2 cells in the co-culture was 100:1 (MOI = 100). The expression level in the modified Duncan Strong medium was set at 1 and the levels in the other treatments were normalized accordingly using the 2−ΔΔCT method. The gapdh gene was used as the reference gene. Experiments were conducted with at least two biological replicates and the error bars represent standard deviations. Different letters indicate significant differences in cpe mRNA levels between treatments (Two-way ANOVA, followed by Tukey’s post hoc test; p < 0.05).
Pathogens 13 00433 g004
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, C.; Defoirdt, T.; Rajkovic, A. The Effect of Caco-2 Cells on Sporulation and Enterotoxin Expression by Foodborne Clostridium perfringens. Pathogens 2024, 13, 433. https://doi.org/10.3390/pathogens13060433

AMA Style

Wang C, Defoirdt T, Rajkovic A. The Effect of Caco-2 Cells on Sporulation and Enterotoxin Expression by Foodborne Clostridium perfringens. Pathogens. 2024; 13(6):433. https://doi.org/10.3390/pathogens13060433

Chicago/Turabian Style

Wang, Chao, Tom Defoirdt, and Andreja Rajkovic. 2024. "The Effect of Caco-2 Cells on Sporulation and Enterotoxin Expression by Foodborne Clostridium perfringens" Pathogens 13, no. 6: 433. https://doi.org/10.3390/pathogens13060433

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop