Genome-Wide Analysis Reveals Key Genes and MicroRNAs Related to Pathogenic Mechanism in Wuchereria bancrofti
Abstract
1. Introduction
2. Materials and Methods
2.1. Overview of Our Analysis Workflow
2.2. Data Collection and Software Information
2.3. Identify EST Sequences Containing Potential miRNA Sequences
- (1)
- Sequence alignment. To identify potential miRNAs in W. bancrofti, we conducted a comparative analysis by aligning miRNA sequences from a diverse range of known animal species against the EST sequences of W. bancrofti. This approach enabled us to identify conserved RNA fragments that mapped to the W. bancrofti genome, suggesting these regions as candidates for novel miRNAs;
- (2)
- Information extraction. This involved the systematic retrieval of detailed characteristics for each fragment, including the accession number, alignment length, start and end positions within the W. bancrofti genome, and the number of mismatches. These data were crucial for further analysis and validation of potential miRNA candidates;
- (3)
- Eliminate redundancy. We conducted a thorough assessment of the alignment results to eliminate redundant data. Specifically, we manually inspected EST sequences that occurred in multiple alignments to ensure that only distinct sequences were preserved. When an individual EST sequence aligned with two or more potential miRNAs, we prioritized the sequences with the fewest mismatches for subsequent analysis.
2.4. Secondary Structure Prediction
- (1)
- The miRNA candidate should not contain N;
- (2)
- The miRNA candidate has less than three mismatches compared to the known miRNA;
- (3)
- The miRNA candidate has the same length compared to the known miRNA, i.e., gap number = 0;
- (4)
- The values of the minimum free energy (MFE) and minimum free energy index (MFEI) of the predicted secondary structure should be significantly negative;
- (5)
- The predicted pre-miRNA is capable of folding into a stem-loop hairpin structure, and the predicted mature miRNA sequence site must be on one arm of the hairpin structure.
2.5. Homologous Distribution Analysis of W. bancrofti miRNAs
2.6. Analysis of Protein Homology and Functional Annotation
2.7. Identify Pathogenic Proteins in W. bancrofti
2.8. Network Analysis
3. Results
3.1. Overview of miRNA Identification Work
3.2. Secondary Structure of miRNA in W. bancrofti
3.3. Homologous Distribution of W. bancrofti miRNAs
3.4. Protein Homology Distribution
3.5. Protein Functional Annotation
3.6. Pathogenic Proteins in W. bancrofti
3.7. Results of Network Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sureshan, M.; Prabhu, D.; Rajamanikandan, S.; Saraboji, K. Discovery of potent inhibitors targeting Glutathione S-transferase of Wuchereria bancrofti: A step toward the development of effective anti-filariasis drugs. Mol. Divers. 2024, 28, 765–785. [Google Scholar] [CrossRef] [PubMed]
- Tamadaho, R.S.E.; Osei-Mensah, J.; Arndts, K.; Debrah, L.B.; Debrah, A.Y.; Layland, L.E.; Hoerauf, A.; Pfarr, K.; Ritter, M. Reduced Type 2 Innate Lymphocyte Cell Frequencies in Patent Wuchereria bancrofti-Infected Individuals. Pathogens 2023, 12, 665. [Google Scholar] [CrossRef] [PubMed]
- Pi-Bansa, S.; Osei, J.H.N.; Frempong, K.K.; Elhassan, E.; Akuoko, O.K.; Agyemang, D.; Ahorlu, C.; Appawu, M.A.; Koudou, B.G.; Wilson, M.D.; et al. Potential factors influencing lymphatic filariasis transmission in “hotspot” and “control” areas in Ghana: The importance of vectors. Infect. Dis. Poverty 2019, 8, 9. [Google Scholar] [CrossRef] [PubMed]
- Hertz, M.I.; Rush, A.; Nutman, T.B.; Weil, G.J.; Bennuru, S.; Budge, P.J. Characterization of glycan determinants that mediate recognition of the major Wuchereria bancrofti circulating antigen by diagnostic antibodies. Mol. Biochem. Parasitol. 2020, 240, 111317. [Google Scholar] [CrossRef] [PubMed]
- Setegn, A.; Amare, G.A.; Mihret, Y. Wolbachia and Lymphatic Filarial Nematodes and Their Implications in the Pathogenesis of the Disease. J. Parasitol. Res. 2024, 2024, 3476951. [Google Scholar] [CrossRef]
- Scott, J.L.; Mayfield, H.J.; Sinclair, J.E.; Martin, B.M.; Howlett, M.; Muttucumaru, R.; Won, K.Y.; Thomsen, R.; Viali, S.; Tofaeono-Pifeleti, R. Field laboratory comparison of STANDARD Q Filariasis Antigen Test (QFAT) with Bioline Filariasis Test Strip (FTS) for the detection of Lymphatic Filariasis in Samoa, 2023. PLoS Negl. Trop. Dis. 2024, 18, e0012386. [Google Scholar] [CrossRef]
- Mnkai, J.; Marandu, T.F.; Mhidze, J.; Urio, A.; Maganga, L.; Haule, A.; Kavishe, G.; Ntapara, E.; Chiwerengo, N.; Clowes, P. Step towards elimination of Wuchereria bancrofti in Southwest Tanzania 10 years after mass drug administration with Albendazole and Ivermectin. PLoS Negl. Trop. Dis. 2022, 16, e0010044. [Google Scholar] [CrossRef]
- Mayfield, H.J.; Sartorius, B.; Sheridan, S.; Howlett, M.; Martin, B.M.; Thomsen, R.; Tofaeono-Pifeleti, R.; Viali, S.; Graves, P.M.; Lau, C.L. Ongoing transmission of lymphatic filariasis in Samoa 4.5 years after one round of triple-drug mass drug administration. PLoS Negl. Trop. Dis. 2024, 18, e0012236. [Google Scholar] [CrossRef]
- Debrah, L.B.; Phillips, R.O.; Pfarr, K.; Klarmann-Schulz, U.; Opoku, V.S.; Nausch, N.; Owusu, W.; Mubarik, Y.; Sander, A.-L.; Lämmer, C. The efficacy of doxycycline treatment on Mansonella perstans infection: An open-label, randomized trial in Ghana. Am. J. Trop. Med. Hyg. 2019, 101, 84. [Google Scholar] [CrossRef]
- Rojas-Pirela, M.; Andrade-Alviárez, D.; Quiñones, W.; Rojas, M.V.; Castillo, C.; Liempi, A.; Medina, L.; Guerrero-Muñoz, J.; Fernández-Moya, A.; Ortega, Y.A.; et al. microRNAs: Critical Players during Helminth Infections. Microorganisms 2022, 11, 61. [Google Scholar] [CrossRef]
- Rojas-Pirela, M.; Andrade-Alviárez, D.; Medina, L.; Castillo, C.; Liempi, A.; Guerrero-Muñoz, J.; Ortega, Y.; Maya, J.D.; Rojas, V.; Quiñones, W.; et al. MicroRNAs: Master regulators in host-parasitic protist interactions. Open Biol. 2022, 12, 210395. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, S.; Nagpure, N.S.; Srivastava, P.; Kumar, R.; Pandey, M.; Srivastava, S.; Jena, J.K.; Das, P.; Kushwaha, B. In Silico Mining of Conserved miRNAs of Indian Catfish Clarias batrachus (Linnaeus, 1758) from the Contigs, ESTs, and BAC End Sequences. Appl. Biochem. Biotechnol. 2017, 182, 956–966. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Shi, M.; Zhang, X.; Yao, D. Genome-Wide Screening for Pathogenic Proteins and microRNAs Associated with Parasite-Host Interactions in Trypanosoma brucei. Insects 2022, 13, 968. [Google Scholar] [CrossRef] [PubMed]
- Köbölkuti, Z.A.; Benke, A.; Cseke, K.; Borovics, A.; Tóth, E.G. In silico analysis of key regulatory networks related to microfibril angle in Populus trichocarpa Hook. Biologia 2023, 78, 675–688. [Google Scholar] [CrossRef]
- Selvaraj, D.; Mugunthan, S.P.; Chandra, H.M.; Govindasamy, C.; Al-Numair, K.S.; Balasubramani, R. In silico identification of novel and conserved microRNAs and targets in peppermint (Mentha piperita) using expressed sequence tags (ESTs). J. King Saud Univ.-Sci. 2023, 35, 102604. [Google Scholar] [CrossRef]
- Ghaffar, A.; Khan, N.; Saleem, M.Z.; Ali, I.; Rehman, A.U.; Shah, W.A.; Samiullah. Identification and Characterization of Evolutionary Conserved Muskmelon Non-coding miRNAs and Their Target Proteins. Biochem. Genet. 2024, 5, 1–22. [Google Scholar] [CrossRef]
- Small, S.T.; Reimer, L.J.; Tisch, D.J.; King, C.L.; Christensen, B.M.; Siba, P.M.; Kazura, J.W.; Serre, D.; Zimmerman, P.A. Population genomics of the filarial nematode parasite Wuchereria bancrofti from mosquitoes. Mol. Ecol. 2016, 25, 1465–1477. [Google Scholar] [CrossRef]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef]
- Consortium, U. UniProt: The Universal Protein Knowledgebase in 2023. Nucleic Acids Res. 2023, 51, D523–D531. [Google Scholar] [CrossRef]
- Gruber, A.R.; Bernhart, S.H.; Lorenz, R. The ViennaRNA Web Services. RNA Bioinform. 2015, 1269, 307–326. [Google Scholar] [CrossRef]
- Bardou, P.; Mariette, J.; Escudié, F.; Djemiel, C.; Klopp, C. jvenn: An interactive Venn diagram viewer. BMC Bioinform. 2014, 15, 293. [Google Scholar] [CrossRef]
- Huang, H.Y.; Lin, Y.C.; Cui, S.; Huang, Y.; Tang, Y.; Xu, J.; Bao, J.; Li, Y.; Wen, J.; Zuo, H.; et al. miRTarBase update 2022: An informative resource for experimentally validated miRNA-target interactions. Nucleic Acids Res. 2022, 50, D222–D230. [Google Scholar] [CrossRef]
- McGeary, S.E.; Lin, K.S.; Shi, C.Y.; Pham, T.M.; Bisaria, N.; Kelley, G.M.; Bartel, D.P. The biochemical basis of microRNA targeting efficacy. Science 2019, 366, eaav1741. [Google Scholar] [CrossRef]
- Sticht, C.; De La Torre, C.; Parveen, A.; Gretz, N. miRWalk: An online resource for prediction of microRNA binding sites. PLoS ONE 2018, 13, e0206239. [Google Scholar] [CrossRef]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
- Ahmed, F.; Bappy, M.N.I.; Islam, M.S. Identification of conserved miRNAs and their targets in Jatropha curcas: An in silico approach. J. Genet. Eng. Biotechnol. 2023, 21, 43. [Google Scholar] [CrossRef]
- Kumar, D.; Kumar, S.; Ayachit, G.; Bhairappanavar, S.B.; Ansari, A.; Sharma, P.; Soni, S.; Das, J. Cross-Kingdom Regulation of Putative miRNAs Derived from Happy Tree in Cancer Pathway: A Systems Biology Approach. Int. J. Mol. Sci. 2017, 18, 1191. [Google Scholar] [CrossRef]
- Zhang, B.H.; Pan, X.P.; Cox, S.B.; Cobb, G.P.; Anderson, T.A. Evidence that miRNAs are different from other RNAs. Cell. Mol. Life Sci. CMLS 2006, 63, 246–254. [Google Scholar] [CrossRef]
- Singh, I.; Hoti, S.L.; Chauhan, N.; Joshi, R.K.; Prasad, T.S.K.; Sarikhani, M.; Kaushik, M.; Unger, B.S.; Jadhav, P.; Modi, P.K. Immunomodulation of streptozotocin induced Type 1 diabetes mellitus in mouse model by Macrophage migration inhibitory factor-2 (MIF-2) homologue of human lymphatic filarial parasite, Wuchereria bancrofti. Acta Trop. 2024, 252, 107142. [Google Scholar] [CrossRef]
- Das, N.C.; Gupta, P.S.S.; Panda, S.K.; Rana, M.K.; Mukherjee, S. Reverse vaccinology assisted design of a novel multi-epitope vaccine to target Wuchereria bancrofti cystatin: An immunoinformatics approach. Int. Immunopharmacol. 2023, 115, 109639. [Google Scholar] [CrossRef]
- Khawsak, P.; Kanjanavas, P.; Kiatsomchai, P.; Chansiri, K. Expression and characterization of Cu/Zn superoxide dismutase from Wuchereria bancrofti. Parasitol. Res. 2012, 110, 629–636. [Google Scholar] [CrossRef]
- Mukherjee, S.; Joardar, N.; Sinha Babu, S.P. Exploring the homolog of a novel proinflammatory microfilarial sheath protein (MfP) of Wuchereria bancrofti in the adult-stage bovine filarial parasite Setaria cervi. J. Helminthol. 2018, 94, e15. [Google Scholar] [CrossRef]
- Yasin, N.; Laxmanappa, H.S.; Muddapur, U.M.; Cheruvathur, J.; Prakash, S.M.U.; Thulasiram, H.V. Structural, molecular, functional and immunological characterization of Wuchereria bancrofti-galectin. Int. J. Biol. Macromol. 2020, 150, 206–217. [Google Scholar] [CrossRef]
- Sharma, O.P.; Vadlamudi, Y.; Liao, Q.; Strodel, B.; Suresh Kumar, M. Molecular modeling, dynamics, and an insight into the structural inhibition of cofactor independent phosphoglycerate mutase isoform 1 from Wuchereria bancrofti using cheminformatics and mutational studies. J. Biomol. Struct. Dyn. 2013, 31, 765–778. [Google Scholar] [CrossRef]
- Yadav, S.; Sharma, P.; Sharma, A.; Ganga, L.; Saxena, J.K.; Srivastava, M. Immunization with Brugia malayi Calreticulin Protein Generates Robust Antiparasitic Immunity and Offers Protection during Experimental Lymphatic Filariasis. ACS Infect. Dis. 2021, 7, 790–799. [Google Scholar] [CrossRef]
- Thirugnanam, S.; Munirathinam, G.; Veerapathran, A.; Dakshinamoorthy, G.; Reddy, M.V.; Ramaswamy, K. Cloning and characterization of high mobility group box protein 1 (HMGB1) of Wuchereria bancrofti and Brugia malayi. Parasitol. Res. 2012, 111, 619–627. [Google Scholar] [CrossRef]
- Cobo, F. Determinants of parasite drug resistance in human lymphatic filariasis. Rev. Esp. Quimioter. 2016, 29, 288–295. [Google Scholar]
- Bortoluzzi, S.; Bisognin, A.; Biasiolo, M.; Guglielmelli, P.; Biamonte, F.; Norfo, R.; Manfredini, R.; Vannucchi, A.M. Characterization and discovery of novel miRNAs and moRNAs in JAK2V617F-mutated SET2 cells. Blood 2012, 119, e120–e130. [Google Scholar] [CrossRef]
- Tili, E.; Michaille, J.J.; Costinean, S.; Croce, C.M. MicroRNAs, the immune system and rheumatic disease. Nat. Clin. Pract. Rheumatol. 2008, 4, 534–541. [Google Scholar] [CrossRef]
- Jike, W.; Sablok, G.; Bertorelle, G.; Li, M.; Varotto, C. In silico identification and characterization of a diverse subset of conserved microRNAs in bioenergy crop Arundo donax L. Sci. Rep. 2018, 8, 16667. [Google Scholar] [CrossRef]
- Zhang, B.; Wang, Q.; Wang, K.; Pan, X.; Liu, F.; Guo, T.; Cobb, G.P.; Anderson, T.A. Identification of cotton microRNAs and their targets. Gene 2007, 397, 26–37. [Google Scholar] [CrossRef]
- Curcio, J.S.; Batista, M.P.; Paccez, J.D.; Novaes, E.; Soares, C.M.A. In silico characterization of microRNAs-like sequences in the genome of Paracoccidioides brasiliensis. Genet. Mol. Biol. 2019, 42, 95–107. [Google Scholar] [CrossRef]
- Singh, N.; Srivastava, S.; Sharma, A. Identification and analysis of miRNAs and their targets in ginger using bioinformatics approach. Gene 2016, 575, 570–576. [Google Scholar] [CrossRef]
- Gul, Z.; Barozai, M.Y.K.; Din, M. In-silico based identification and functional analyses of miRNAs and their targets in Cowpea (Vigna unguiculata L.). AIMS Genet. 2017, 4, 138–165. [Google Scholar] [CrossRef]
- Esperante, D.; Flisser, A.; Mendlovic, F. The many faces of parasite calreticulin. Front. Immunol. 2023, 14, 1101390. [Google Scholar] [CrossRef]
- Briquet, S.; Lawson-Hogban, N.; Boisson, B.; Soares, M.P.; Péronet, R.; Smith, L.; Ménard, R.; Huerre, M.; Mécheri, S.; Vaquero, C. Disruption of parasite hmgb2 gene attenuates Plasmodium berghei ANKA pathogenicity. Infect. Immun. 2015, 83, 2771–2784. [Google Scholar] [CrossRef]



| W. bancrofti miRNA | miRNA Sequence | Length | EST Accession | Mismatches |
|---|---|---|---|---|
| wba-miR-619-5p | GCUGGGAUUACAGGCAUGAGCC | 22 | CK725669.1 | 0 |
| wba-miR-1973 | ACCGUGCAAAGGUAGCAUA | 19 | CD455789.1 | 0 |
| wba-miR-2361 | GUUGUGUUAUUUUUUUUUG | 19 | CD374128.1 | 1 |
| wba-miR-3135 | AGGCUGGAGUGCAGUGGCG | 19 | CK726218.1 | 1 |
| wba-miR-2917 | AUGAAUGACAUGGACU | 16 | CD374529.1 | 1 |
| wba-miR-709 | GGAGGCUGAGGCAAGAGGA | 19 | CK850624.1 | 1 |
| wba-miR-147 | UGUGCGGAGAAGCUUUCG | 18 | CD374323.1 | 2 |
| wba-miR-4000b-1-3p | UCCUUUGCAACAGGUUUUGC | 20 | CD374779.1 | 2 |
| wba-miR-6894-5p | AGGAGGAUGGAGAACUGGGACAG | 23 | CD374262.1 | 2 |
| wba-miR-755-3p | UGACAUUCAACUAUUUCAAC | 20 | CK855350.1 | 2 |
| wba-miR-153-5p | CCAUUUUGGGGAUUUGCAGCU | 21 | CD455816.1 | 2 |
| wba-miR-103-5p | GCCUCCUGACGGUGCUGC | 18 | CD454997.1 | 2 |
| wba-miR-4468 | AGAGCCGAAGGAUGUGAU | 18 | CD374125.1 | 2 |
| wba-miR-4736 | AGGCCAGUUAUCUGGGCU | 18 | CK850118.1 | 2 |
| wba-miR-6241 | CACGGGGGCUGGAAAUCC | 18 | CK850101.1 | 2 |
| wba-miR-7010-3p | GGUUCUCCUUUGCUCUGCAG | 20 | CD455797.1 | 2 |
| wba-miR-1198-3p | AAGCUGGUCUCUAACUCCUGGC | 22 | CK850143.1 | 3 |
| wba-let-7e-5p | UGAGGUAAUAGGUUGAUUAAUU | 22 | CD455426.1 | 3 |
| wba-miR-2444 | UUUUUGUUUUGUUUUGUUUU | 20 | CD374705.1 | 3 |
| wba-miR-10093-5p | UGCGGUUCCGAGAAGCAACUU | 21 | CK850105.1 | 3 |
| miRNA | Nucleotide Number | PL | (AU)% | (GC)% | MFE | AMFE | MFEI |
|---|---|---|---|---|---|---|---|
| wba-miR-147 | A(18)U(18)G(16)C(15)N(3) | 70 | 51.43 | 44.29 | −18.1 | −25.86 | −0.58 |
| wba-miR-2361 | A(25)U(31)G(9)C(5)N(0) | 70 | 80.00 | 20.00 | −6.5 | −9.29 | −0.46 |
| wba-miR-4000b-1-3p | A(15)U(33)G(15)C(20)N(0) | 83 | 57.83 | 42.17 | −14.6 | −17.59 | −0.42 |
| wba-miR-6894-5p | A(20)U(19)G(29)C(24)N(0) | 92 | 42.39 | 57.61 | −34.7 | −37.72 | −0.65 |
| wba-miR-755-3p | A(32)U(17)G(10)C(11)N(0) | 70 | 70.00 | 30.00 | −10.5 | −15.00 | −0.50 |
| wba-miR-153-5p | A(15)U(24)G(15)C(15)N(2) | 71 | 54.93 | 42.25 | −17.5 | −24.65 | −0.58 |
| wba-miR-3135 | A(13)U(21)G(22)C(29)N(0) | 85 | 40.00 | 60.00 | −27.8 | −32.71 | −0.55 |
| wba-miR-103-5p | A(18)U(17)G(25)C(18)N(0) | 78 | 44.87 | 55.13 | −19.2 | −24.62 | −0.45 |
| wba-miR-1198-3p | A(14)U(18)G(17)C(24)N(0) | 73 | 43.84 | 56.16 | −27.3 | −37.40 | −0.67 |
| wba-let-7e-5p | A(37)U(36)G(15)C(15)N(0) | 103 | 70.87 | 29.13 | −11.2 | −10.87 | −0.37 |
| wba-miR-619-5p | A(14)U(15)G(19)C(25)N(0) | 73 | 39.73 | 60.27 | −18.7 | −25.62 | −0.43 |
| wba-miR-1973 | A(21)U(19)G(19)C(15)N(0) | 74 | 54.05 | 45.95 | −21.1 | −28.51 | −0.62 |
| wba-miR-2917 | A(19)U(25)G(13)C(13)N(1) | 71 | 61.97 | 36.62 | −13.8 | −19.44 | −0.53 |
| wba-miR-4468 | A(17)U(24)G(29)C(18)N(0) | 88 | 46.59 | 53.41 | −23.1 | −26.25 | −0.49 |
| wba-miR-4736 | A(30)U(20)G(16)C(22)N(0) | 88 | 56.82 | 43.18 | −21.5 | −24.43 | −0.57 |
| wba-miR-6241 | A(20)U(25)G(38)C(25)N(0) | 108 | 41.67 | 58.33 | −40.4 | −37.41 | −0.64 |
| wba-miR-7010-3p | A(11)U(37)G(22)C(27)N(3) | 100 | 48.00 | 49.00 | −17.8 | −17.80 | −0.36 |
| wba-miR-709 | A(18)U(16)G(23)C(22)N(0) | 79 | 43.04 | 56.96 | −37.4 | −47.34 | −0.83 |
| wba-miR-2444 | A(15)U(34)G(16)C(10)N(0) | 75 | 65.33 | 34.67 | −10.1 | −13.47 | −0.39 |
| wba-miR-10093-5p | A(15)U(16)G(25)C(15)N(0) | 71 | 43.66 | 56.34 | −25.1 | −35.35 | −0.63 |
| Homologous miRNA | Mammal | Non-Mammal | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| hsa | mmu | rno | bta | cja | oan | cgr | cin | sma | hpo | cpi | gmo | xla | aca | cli | pbv | xtr | |
| hsa-miR-619-5p | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| hsa-miR-1973 | P | - | - | - | - | - | P | - | - | - | - | - | - | - | - | - | - |
| bta-miR-2361 | - | - | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - |
| cja-miR-3135 | - | - | - | - | P | - | - | - | - | - | - | - | - | - | - | - | - |
| bta-miR-2917 | - | - | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - |
| rno-miR-709 | - | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| oan-miR-147 | - | - | - | - | - | P | - | - | - | - | - | - | - | - | - | - | - |
| cin-miR-4000b-1-3p | - | - | - | - | - | - | - | P | - | - | - | - | - | - | - | - | - |
| hsa-miR-6894-5p | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| sma-miR-755-3p | - | - | - | - | - | - | - | - | P | - | - | - | - | - | - | - | - |
| cpi-miR-153-5p | - | - | - | - | - | - | - | - | - | - | P | - | P | P | P | - | |
| gmo-miR-103-5p | - | - | - | - | - | - | - | - | - | - | - | P | - | - | - | - | - |
| hsa-miR-4468 | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| hsa-miR-4736 | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| mmu-miR-6241 | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| mmu-miR-7010-3p | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| mmu-miR-1198-3p | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| xla-let-7e-5p | - | - | - | - | - | - | - | - | - | - | - | - | P | - | - | - | P |
| bta-miR-2444 | - | - | - | P | - | - | - | - | - | - | - | - | - | - | - | - | - |
| hpo-miR-10093-5p | - | - | - | - | - | - | - | - | - | P | - | - | - | - | - | - | - |
| Group | Association | Species | Homolog | Total | Homologs Percentage | 95% CI in Similarity Percentage |
|---|---|---|---|---|---|---|
| Mammal | Infected host | Homo sapiens | 1661 | 20,428 | 8.13% | [46.22%, 47.70%] |
| Mus musculus | 1704 | 17,184 | 9.92% | [45.55%, 47.01%] | ||
| Rattus norvegicus | 3852 | 20,715 | 18.60% | [44.66%, 45.58%] | ||
| Mosquito | Transmitted vector | Culex quinquefasciatus | 1703 | 20,075 | 8.48% | [46.58%, 48.08%] |
| Culex pipiens | 1382 | 39,617 | 3.49% | [45.33%, 46.93%] | ||
| Anopheles gambiae | 1673 | 26,179 | 6.39% | [45.55%, 47.03%] | ||
| Aedes aegypti | 1055 | 39,617 | 2.66% | [43.55%, 45.33%] | ||
| Filaria | Cause same disease | Brugia timori | 5385 | 19,496 | 27.62% | [91.54%, 91.98%] |
| Brugia malayi | 1428 | 39,617 | 3.60% | [89.87%, 90.83%] |
| Protein | Homolog | Gene Symbol | Our Annotation | Identity |
|---|---|---|---|---|
| A0A1I8EHN2 | XP_001891657.2 | RAC1 | Ras-related protein Rac1 | 100.00% |
| J9EGK5 | MCP9257968.1 | RAB2 | Ras-related protein Rab-2 | 99.53% |
| A0A1I8EH73 | KAK6101950.1 | SEL1 | Sel1 repeat family protein | 98.87% |
| J9EZZ7 | KAK6106685.1 | HMBOX | Homeobox domain family protein | 98.64% |
| J9FC50 | XP_042932147.1 | RAB30 | Ras-related protein Rab-30, putative | 98.38% |
| J9AVT2 | KAK6112434.1 | IER | Immediate early response protein (IER) family protein | 98.25% |
| A0A1I8EA78 | KAK6111993.1 | TMCC2 | Putative transmembrane and coiled-coil 2 family protein | 97.40% |
| A0A3P7EC68 | KAK6110404.1 | ARHGDIB | Rho GDP-dissociation inhibitor 2 | 96.94% |
| J9EDE1 | XP_042936681.1 | MRPS30 | 28S ribosomal protein S30, mitochondrial, putative | 96.20% |
| A0A3P7EHJ5 | KAK6101881.1 | RPN13 | Proteasome complex subunit Rpn13 | 96.19% |
| J9F9J0 | KAK6101659.1 | RPS18 | Ribosomal protein S18 family protein | 96.05% |
| A0A183XMK3 | XP_001894312.1 | MTX1 | Metaxin 1 homolog, putative | 95.91% |
| A0A1I8ERM1 | KAK6107604.1 | MEMO1 | Protein MEMO1 | 95.50% |
| J9EIB4 | XP_042936799.1 | NTF2 | Nuclear transport factor 2 (NTF-2), putative | 95.30% |
| A0A183XB90 | XP_042938130.1 | MRPS2 | 28S ribosomal protein S2, mitochondrial, putative | 95.16% |
| No. | Gene Symbol | Protein Accession | Protein Detail | PubMed ID |
|---|---|---|---|---|
| 1 | MIF-2 | A0A088FMA5 | Macrophage migration inhibitory factor-2 | 38331083 |
| 2 | CST3 | A0A3P7E9H2 | Cystatin domain-containing protein | 36586276 |
| 3 | CALR | A0A3P7DSX6 | Calreticulin family protein | 33667079 |
| 4 | GST | E3UV59 | Glutathione S-transferase | 36797509 |
| 5 | SOD | A1XI87 | Superoxide dismutase | 21796387 |
| 6 | TCTP | J9FBX2 | Translationally-controlled tumor protein | 11985867 |
| 7 | MFP | J9AIW9 | Major microfilarial sheath protein | 30477598 |
| 8 | GAL | A0A183XCC6 | Galectin | 32035155 |
| 9 | HMGB1 | J9BAQ5 | HMG box family protein | 22402610 |
| 10 | IPGM | B4XK96 | Independent phosphoglycerate mutase | 22908983 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, C.; Yan, Y.; Feng, Y.; Sun, J.; Mu, M.; Yang, Z. Genome-Wide Analysis Reveals Key Genes and MicroRNAs Related to Pathogenic Mechanism in Wuchereria bancrofti. Pathogens 2024, 13, 1088. https://doi.org/10.3390/pathogens13121088
Zhu C, Yan Y, Feng Y, Sun J, Mu M, Yang Z. Genome-Wide Analysis Reveals Key Genes and MicroRNAs Related to Pathogenic Mechanism in Wuchereria bancrofti. Pathogens. 2024; 13(12):1088. https://doi.org/10.3390/pathogens13121088
Chicago/Turabian StyleZhu, Caoli, Yicheng Yan, Yaning Feng, Jiawei Sun, Mingdao Mu, and Zhiyuan Yang. 2024. "Genome-Wide Analysis Reveals Key Genes and MicroRNAs Related to Pathogenic Mechanism in Wuchereria bancrofti" Pathogens 13, no. 12: 1088. https://doi.org/10.3390/pathogens13121088
APA StyleZhu, C., Yan, Y., Feng, Y., Sun, J., Mu, M., & Yang, Z. (2024). Genome-Wide Analysis Reveals Key Genes and MicroRNAs Related to Pathogenic Mechanism in Wuchereria bancrofti. Pathogens, 13(12), 1088. https://doi.org/10.3390/pathogens13121088
