Next Article in Journal
H3K4 Methylation and Demethylation in Fungal Pathogens: The Epigenetic Toolbox for Survival and Adaptation in the Host
Next Article in Special Issue
Clinical Cases of Tick-Borne Diseases in Dogs During the Autumn-Winter Season in Poland
Previous Article in Journal
Effect of Lactic Acid Bacteria-Derived Postbiotic Supplementation on Tuberculosis in Wild Boar Populations
 
 
Due to scheduled maintenance work on our servers, there may be short service disruptions on this website between 11:00 and 12:00 CEST on March 28th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Seasonal Dynamics of Ticks and Tick-Borne Pathogens in Republic of Korea

1
Department of Biomedical Laboratory Science, College of Software and Digital Healthcare Convergence, Yonsei University, Wonju 26493, Republic of Korea
2
Department of Clinical Laboratory Science, Cheju Halla University, Jeju 63092, Republic of Korea
3
Department of Tropical Medicine and Institute of Tropical Medicine, Yonsei University College of Medicine, Seoul 03722, Republic of Korea
4
Department of Medical Environmental Biology and Tropical Medicine, School of Medicine, Kangwon National University, Chuncheon 24341, Republic of Korea
5
Gangwon State Veterinary Service & Research Institute, Chuncheon 24203, Republic of Korea
6
Chungbuk Province Veterinary Service & Research Institute, Cheongju 28135, Republic of Korea
7
Bacterial and Parasitic Disease Division, Department of Animal & Plant Health Research, Animal and Plant Quarantine Agency, Gimcheon 39660, Republic of Korea
8
Department of Veterinary Internal Medicine, College of Veterinary Medicine, Jeju National University, Jeju 63243, Republic of Korea
9
Division of Zoonotic and Vector Borne Disease Research, Center for Infectious Diseases Research, Korea National Institute of Health, Cheongju 28159, Republic of Korea
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Pathogens 2024, 13(12), 1079; https://doi.org/10.3390/pathogens13121079
Submission received: 4 November 2024 / Revised: 3 December 2024 / Accepted: 6 December 2024 / Published: 8 December 2024

Abstract

Tick-borne diseases are a public health problem and a significant burden on the livestock industry. The seasonal abundance of ticks and tick-borne pathogens strongly correlates with the prevalence of these diseases. To investigate the seasonal variation in ticks and tick-borne pathogens, ticks were collected from Gangwon State, Korea, and the tick-borne pathogens Borrelia, Anaplasma, Babesia, and Theileria were examined. In total, 14,748 ticks were collected, comprising ticks from two genera and three species: Haemaphysalis longicornis, Haemaphysalis flava, and Ixodes nipponensis, with H. longicornis being the predominant species. Of 7445 ticks (455 pools) examined for pathogens, Theileria was detected in 61 pools, whereas Borrelia and Anaplasma were observed in 17 pools. H. longicornis nymphs and adults were collected beginning in April, with nymph numbers peaking in May and June and adult ticks peaking in June and July. In contrast, the larvae were collected in May and peaked in September. Tick-borne pathogens were detected in April, peaking in July and September. Borrelia, the causative agent of Lyme disease, exhibits a temporal association between its detection in ticks and its occurrence in humans. In conclusion, tick-borne diseases seem to be closely linked not only to changes in tick numbers throughout the seasons but also to the seasonal variations of the pathogens within them.

1. Introduction

Ticks are obligate blood-sucking arthropods that feed on the blood of mammals, birds, reptiles, and amphibians and can transmit viruses, bacteria, and protozoa [1]. Ticks are important vectors for various diseases that affect humans, livestock, and other animals. The risk of tick-borne disease transmission is increasing worldwide, and tick-borne pathogens are becoming increasingly important as they cause zoonotic diseases that affect humans, livestock, and wildlife [2].
Ticks transmit bacterial diseases such as ehrlichiosis, bartonellosis, Q fever, Lyme disease, anaplasmosis, and tick-borne rickettsiosis; protozoal diseases including babesi- osis and theileriosis; and viral diseases such as Crimean-Congo hemorrhagic fever, severe fever with thrombocytopenia (SFTS), tick-borne encephalitis, Heartland, and Powassan virus disease [1,2,3].
Borrelia is a tick-borne spirochete that causes Lyme disease, clinically expressed by fever, erythema migrans, musculoskeletal pain, and neurological symptoms in humans [4]. Borrelia spp. are divided into the Lyme disease group, which includes Borrelia burgdorferi sensu lato, and the relapsing fever group, with the reptile group recently added [5]. The Korea Disease Control and Prevention Agency designated Lyme disease a statutory infectious disease in 2010 and it occurs continually yearly [6]. B. burgdorferi, a causative agent of Lyme disease, was first isolated from Ixodes ticks in Korea in 1992 [7], and B. burgdorferi sensu stricto, Borrelia afzelii, and Borrelia garinii were detected in ticks of Ixodes nippponensis, Haemaphysalis longicornis, and Amblyoma [8].
Anaplasma is a Gram-negative intracellular bacteria that causes an acute febrile illness known as anaplasmosis in animals or human granulocytic anaplasmosis [9]. Human granulocytic anaplasmosis was reported in the United States in 1994 and in 2014 in Korea, where it occurs sporadically [10,11,12]. In animals, A. phagocytophilum infection has been reported in dogs [13], and A. bovis and A. carpa infections have been reported in cattle and goats [14]. I. scapularis and I. ricinus are vectors of Anaplasma in the United States [15] and western Europe [16], and Anaplasma has been detected in H. longicornis, I. nipponensis, and I. persulcatus in Korea [17].
Babesia and Theileria are intraerythrocytic piroplasmas that belong to the phylum Apicomplexa. Babesia is a zoonotic pathogen that causes babesiosis in humans and animals, whereas Theileria causes infections in livestock and wild animals. In humans, Babesia microti, Babesia divergens, and Babesia venatorum cause infections [18], whereas Babesia canis and Babesia gibsonii infect dogs [19]. In Korea, a case of human babesiosis was reported in 2005 [20]. Theileria annulata and Theileria parva cause tropical theileriosis and East Coast fever in cattle, respectively [21]. Additionally, Theileria species, such as T. orientalis, T. luwenshuni, and T. ovis cause anemia, jaundice, and anorexia in domestic animals and wildlife [22]. The main vectors of Babesia and Theileria are Ixodes ricinus and Ixodes scapularis in Europe and the United States, respectively [23].
Tick-borne diseases are influenced by a variety of factors, including ticks and their life cycle, pathogens, hosts, and climate. In tropical and subtropical regions, ticks live year-round; however, in temperate regions, tick life cycles are seasonal, which may be related to the occurrence of tick-borne diseases. Although many studies have been conducted on the detection of pathogens in ticks, very few have focused on seasonal changes in ticks and pathogens and their relevance to outbreaks of tick-borne diseases.
This study aimed to investigate the seasonal prevalence of ticks and tick-borne pathogens, namely Borrelia, Anaplasma, Babesia, and Theileria, in Korea and their association with human or animal outbreaks.

2. Results

2.1. Species of Ticks and Their Seasonal Prevalence

A total of 14,784 ticks were collected from four localities in Gangwon State, Korea (Figure 1 and Table 1). The collected ticks belonged to two genera and three species, H. longicornis, H. flava, and I. nipponensis. Overall, H. longicornis (adults 1130, nymphs 11,596, larvae 1868) accounted for 98.7%, followed by H. flava (1.1%; adults 13, nymphs 154), and I. nipponensis (0.2%; adults 21, nymphs 2).
The highest number of ticks was collected in Chuncheon, accounting for 58.2% (8554 ticks), followed by Hoengseong with 2995 ticks (20.3%), Yanggu with 2400 ticks (16.5%), and Hwacheon with 750 ticks (5.1%).
The seasonal distributions of H. longicornis, H. flava, and I. niponensis are presented in Table 2 and Figure 2. Adult female and male H. longicornis ticks were collected from April to July and from April to September, respectively, with more frequent collection from April to July. Nymphs were collected from April to October, with a high number collected from April to July, with peaks in May and June. Larvae were collected from May to October, reaching a peak in September. H. flava nymphs were collected from April to October, with a peak in May. A few I. nipponensis samples were also collected.

2.2. Detection of Tick-Borne Pathogens

A total of 455 pools from 7445 ticks were tested for tick-borne pathogens, Borrelia spp., Anaplasma spp., and Babesia/Theileria spp. (Table 3). Of the 455 tick pools tested, 17 (infection rate [IR], 3.74%; minimum infection rate [MIR], 0.23%) and 16 (IR, 3.52%; MIR, 0.21%) were positive for Borrelia spp. and Anaplasma spp., respectively. Theileria spp. were detected most frequently, with 61 positive pools of the 455 tick pools (IR: 13.41%, MIR:0.82%) (Theileria spp. vs Borrelia spp.: χ2 = 27.2, p < 0.001; Theileria spp. vs Anaplasma spp.: χ2 = 28.7, p < 0.001).
Both Borrelia spp. and Anaplasma spp. were primarily detected from H. longicornis; H. flava and I. niponensis were also positive for Borrelia spp. and Anaplasma spp. Borrelia spp. was detected in all developmental stages of H. longicornis, whereas Anaplasma spp. were detected in all developmental stages except in male adult ticks. Anaplasma spp. were identified as A. phagocytophilum through sequencing; however, the Borrelia spp.-positive PCR products could not be sequenced.
Of the 61 Theileria spp.-positive pools, 58 belonged to H. longicornis, accounting for 95.1%, and 1 (1.6%) and 2 pools (3.3%) belonged to H. flava and I. niponensis, respectively (H. longicornis vs. H. flava: χ2 = 4.6, p < 0.05). Of the 188 pools of female adult H. longicornis ticks, 20 (IR: 16.95%, MIR: 3.93%) were positive for Theileria spp., and 2 of 28 pools (IR: 7.14%, MIR: 2.82%) of male adult ticks were Theileria spp.-positive. In H. longicornis nymphs, 28 of 222 pools (IR: 7.14%, MIR: 2.82%) were Theileria spp.-positive and 8 of 35 pools (IR: 22.86%, MIR: 0.85%) of H. longicornis larvae were Theileria spp.-positive. Theileria spp. were detected in all developmental stages of H. longicornis, with the highest positive IR, 22.86% in H. longicornis larvae; there was no significant difference in Theileria-positive rates among tick developmenthal stages. Sixteen Theileria spp.-positive PCR products were successfully sequenced, 12 of which were identified as T. luwenshuni and 4 as T. capreoli. Theileria spp. IRs were high in ticks, but Babesia spp. were not detected.
In the regional distribution of tick-borne pathogens, the IR of Theileria spp. by region ranged from 12.07% to 15.91% (Table 3 and Figure 1). By region, the IRs of ticks for Borrelia spp. and Anaplasma spp. ranged from 1.72% to 4.55% and 1.72% to 6.82%, respectively. In Hoengseong, where the cattle pastures were located, the infection rates of Theileria spp., Borrelia spp., and Anaplasma spp. were somewhat high, but there were no significant differences compared to other localities.

2.3. Seasonal Distribution of Ticks and Tick-Borne Pathogens

The seasonal distribution of tick-borne pathogens, Borrelia spp., Anaplasma spp., and Theileria spp. are shown in Figure 2B. Borrelia spp. were detected in June and peaked in July. However, there was a slight increase in Borrelia-positive ticks in September, with no ticks testing positive in August. Anaplasma spp. were detected from May to October except August. Theileria spp. was detected in ticks from April to October, peaking in July, decreasing dramatically in August, and increasing again in September. Tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. showed similar patterns, peaking in July, decreasing or not being detected in August, and showing a slight increase in September.
The seasonal changes in tick-borne pathogens during the developmental stages of H. longicornis, the predominant tick species, are shown in Figure 3. The number of H. longicornis adult females and males increased rapidly from March and peaked in June, whereas tick-borne pathogens were detected in May, peaked in July, and then decreased. The number of nymphs peaked in May and showed a sharp decline, and tick-borne pathogens were detected in July and September, when the number of nymphs decreased. Larvae were detected from May and peaked in September. For larvae, the detection of tick-borne pathogens was proportional to the number of larvae, but for adults and nymphs, it was not proportional to the number of ticks and increased at a certain point in time, namely in July.
To examine the relationship between tick-borne Borrelia spp. and human Lyme disease, we compared their seasonal patterns (Figure 4). Borrelia spp. were detected in ticks in June, peaked in July, and increased again in September. In the Lyme disease data reported to the Korea Disease Control and Prevention Agency, Lyme disease increased from March, peaked in August, decreased in October, and then increased again in November. The detection of Borrelia spp. in ticks showed peaks in July and September, whereas human Lyme disease had peaks in August and November, with an interval of approximately a month. This might be related to the incubation period of Lyme disease, which is the period from Borrelia spp. infection via a tick biting to the onset of symptoms of human borreliosis.

2.4. Phylogenetic Analysis of Tick-Borne Pathogens

Phylogenetic analysis of Anaplasma spp. and Theileria spp. was performed based on the sequences of 16S rRNA and 18S rRNA, respectively (Figure 5). Theileria spp. detected in H. longicornis ticks were divided into Theileria luwenshuni and Theileria capreoli (Figure 5A). Theileria luwenshuni sequences were highly homologous to a Theileria luwenshuni sequence (KU356908) detected from deer keds in Korea with an identity value of 98.9–99.5%, and Theileria capreoli sequences were close to Theileria capreoli sequences, MN463019 from red deer in Turkey and KJ188219.1 from Qilian Mountain red deer in China, with identity values of 95.6–96.0% and 95.8–96.1%, respectively, and appeared to form a new cluster.
Anaplasma spp. detected from the ticks in Yaggu were identified as A. phagocytophilum, which is very close to KF569911.1 found in China and also close to A. phagocytophilum sequences reported in Korea.

3. Discussion

In this study, we investigated the bacterial and protozoan tick-borne pathogens, Borrelia spp., Anaplasma spp., and Babesia/Theileria spp., from ticks collected in Gangwon province, a forested area in Korea.
Among the ticks collected in this study, H. longicornis was predominant, followed by H. flava, and I. niponensis. At the Chuncheon sites, the number of collected ticks was highest, but there was no significant difference in the numbers of collected ticks between collection sites located near cattle and goat farms. This is consistent with several previous reports that H. longicornis is a major tick in Korea [17]; the high tick density in Chuncheon is likely related to the fact that SFTS, a tick-borne disease, occurred in this region with the highest number of cases in Gangwon province [24].
Ticks collected were tested for Borrelia spp., Anaplasma spp., and Babesia/Theileria spp. using PCR, and Borrelia spp., Anaplasma spp., and Theileria spp. were detected, but not Babesia spp. Borrelia spp., the causative agents of Lyme disease, were detected in H. longicornis and H. flava, and the infection rate was 3.97% (MIR, 0.22%) and 3.13% (MIR, 1.06%), respectively. Borrelia spp. was detected in all collection sites in Gangwon State and is presumed to be widespread. This is consistent with the fact that Borrelia afzeli was detected in I. nipponensis and H. longicornis [25,26]. In particular, infection rate of Borrelia in I. nipponensis (MIR: 0.34%) was high [27]. This could be evidence that the first case of Lyme disease was reported in Gangwon State, and it occurs every year [6].
Anaplasma spp. were detected in H. longicornis and I. nipponensis, with infection rates of 3.72% (MIR, 0.20%) and 5% (MIR, 5%), respectively, but not in H. flava. I. scapularis and I. ricinus have been reported to be the vectors of Anaplasma spp. [28]. In Korea, Anaplasma phagocytophilum has been detected in H. longicornis, I. nipponensis, and I. persulcatus [29]. Because H. longicornis is the predominant tick in Korea, it is considered the primary vector of Anaplasma spp. and may transmit Anaplasma spp. not only in humans but also in dogs, cattle, and goats.
Theileria spp. were detected in H. longicornis, H. flava, and I. niponensis, and the average infection rate of Theileria spp. in ticks was quite high at 13.41% (MIR: 0.82%) (Table 2). Theileria spp. were detected at all collected sites and are presumed to be widely distributed throughout Gangwon State. Two Theileria spp. were detected in the sequence analysis: T. luwenshuni and T. capreoli. In Korea, T. orientalis has been detected in cattle and T. luwenshuni has been detected in cattle and deer [30,31,32]. In the previous study in Korea, Theileria was detected in H. longicornis, H. flava, and I. nipponesis, and the infection rate of Theileria in H. longicornis was 39% (MIR: 3.05%) [33]. This suggests that T. luwenshuni is transmitted from ticks to domestic cattle, wild animals, and deer. In contrast, T. capreoli was detected in the present study, which is presumed to be the first report of its kind in Korea.
The tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. demonstrated dynamic seasonal changes. Tick-borne pathogens were associated with the tick life cycle but were not proportional to the number of ticks. H. longicornis adults and nymphs peaked in May–June, but pathogen detection peaked later in July. Notably, larval and pathogen detection peaked simultaneously in September and showed a close relationship. This suggests that there is a slight temporal delay between tick populations and pathogens in H. longicornis adults and nymphs, whereas there seems to be a consistent pattern in the case of larvae. There are a couple of reports on the association between ticks and tick-borne pathogens. Seo et al. and Jang et al. showed that the number of ticks and the possession of pathogens are not proportional [34,35]. Seo et al. analyzed the prevalence of ticks and positive rates of SFTSV in ticks [34]. Interestingly, the number of collected ticks increased from April, but the detection rate of SFTSV in ticks decreased inversely. In addition, the number of H. longicornis larvae increased significantly in September, but the detection rates of SFTSV in larvae decreased sharply. Jang et al. collected ticks from wild animals and detected SFTSV in ticks. The number of ticks collected from wild animals increased significantly in June and September, whereas the SFTSV in ticks was detected in May and September. This indicates that the prevalence of ticks and the detection of pathogen are not proportional. This implies that ticks do not always carry pathogens and might get pathogens by sucking blood from wild animals [36]. Further research is needed on the transmission of tick-borne pathogens between wildlife and ticks.
Lyme disease was designated as a statutory infectious disease in 2010 in Korea, and outbreaks have continued since the first case in 2012. The seasonal incidence of Lyme disease increased in March, peaked in August, decreased in October, increased again in November, and then decreased thereafter (Figure 4). Among ticks, Borrelia spp. were detected in June, peaked in July, declined in August, and increased again in September. There seems to be a gap of approximately a month between the peak period of Borrelia spp. in ticks in July and the peak period of Lyme disease in humans in August. This may be related to the incubation period after the Borrelia spp. infection.
In Korea, there have been a few reports of Anaplasma spp. infection in humans and dogs with tick bites [12,13]. In contrast, Theileria spp. have been detected in ticks, but infection is rarely reported in livestock, such as cattle and goats. This phenomenon may be related to the change from grazing to housing in barns.
The populations of the tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. increased until July, peaked, decreased in August, and then increased again. This might be related to the summer rainy season. Korea belongs to a temperate zone, and there is a long rainy season in summer and temperatures drop below zero in winter. The long rainy season lasts from mid-July to early or mid-August. Excessive rainfall or long-term rain during this period seems to reduce tick populations. The number of ticks and pathogens peaks in July, before the rainy season, and then decreases during the long rainy season. Then, the number of larvae increases and reaches a peak in September. As the weather gets colder, the number of larvae decreases rapidly.
In conclusion, ticks were distributed throughout Gangwon State and the main species was H. longicornis. Tick-borne pathogens Borrelia spp., Anaplama spp., and Theileria spp. were detected, and the seasonal pattern of tick-borne pathogens, particularly Borrelia spp., appeared to be associated with the outbreak pattern of human Lyme disease. This provides evidence of a close link between tick-borne pathogens and infections caused by these pathogens in humans and animals.

4. Materials and Methods

4.1. Surveillance Localities and Period

Ticks were collected at four locations: Hoengseong (37°29′41″, 128°10′09″), Yanggu (38°13′32″, 128°04′27″), Hwacheon (38°04′07″, 127°47′47″), and Chuncheon (37°56′14″, 127°46′54″) in Gangwon State, Republic of Korea, to conduct tick-borne disease surveillance from March to October 2022 (Figure 1). The collection sites in Hoengseong, Chuncheon, and Hwacheon were near cattle farms, whereas those in Yanggu were near goat farms.

4.2. Tick Collection and Species Identification

Ticks were collected using carbon dioxide (CO2) gas-based tick traps (Shin-Young Commerce System, Namyangju, Republic of Korea) with dry ice. The traps were made of white tarpaulin and were cylindrical in shape, 36 cm in diameter, and 50 cm in height with an open top. A cylindrical cooler, 25 cm in diameter and 30 cm in height, containing approximately 2 kg of dry ice was placed inside the trap, and CO2 was released to attract the ticks. Three traps were set up at each collection site; the traps were placed between 12:00 and 16:00, and the attracted ticks were subsequently collected.
The collected ticks were examined under a stereomicroscope and identified using morphological criteria for the species and developmental stages, according to the taxonomic key [37].

4.3. Tick Homogenization and DNA Extraction

The ticks were pooled according to species and developmental stage for pathogen detection. The numbers of pooled ticks were 1–50 larvae, 1–30 nymphs, and 1–5 adults (male/female).
The pooled ticks were homogenized with Zirconia 3 mm beads with 200 μL lysis buffer (iNtRON Biotechnology, Seongnam, Republic of Korea) using a Precellys Evolution Touch Homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France) with two cycles of 20 s at 6500 rpm. Following homogenization, the tubes were centrifuged at 16,200× g for 1 min, and DNA was extracted using a G-spin Total DNA extraction kit (iNtRON Biotechnology, Seongnam, Korea) according to the manufacturer’s instructions and stored at –70 °C until further analyses.

4.4. Detection of Tick-Borne Pathogens by Polymerase Chain Reaction

The detection of tick-borne pathogens was performed using polymerase chain reaction (PCR) or nested PCR for Borrelia spp., Anaplasma, and Babesia/Theileria spp. using a T100 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA).
To detect Borrelia spp. in ticks, nested PCR with two sets of primers targeting flagellin B and the 5S-23S rrf-rrl intergenic spacer region was performed (Table 4) [38,39].
PCR was performed using a AccuPower HotStart PCR Premix (Bioneer Co., Daejeon, Republic of Korea). Each PCR reaction was carried out in a 20 μL reaction volume containing 1 µL of 10 nM of each primer, 13 µL of nuclease-free water, and 5 µL of template DNA in a freeze-dried PCR Premix (Bioneer Co.). The amplification conditions for nested PCR were as follows: The first reaction was performed as an initial denaturation at 95 °C for 3 min, followed by 30 cycles of 30 s at 94 °C, 45 s at 50 °C, and 45 s at 72 °C. This was followed by the second reaction: 3 min at 95 °C followed by 35 cycles of 30 s at 95 °C, 30 s at 54 °C, and 45 min at 72 °C, with a final extension at 72 °C for 10 min.
Anaplasma spp. was detected using nested PCR with two sets of primers targeting a fragment of the 16S rRNA gene, as described by Barlough et al. [40] (Table 4). Amplification was performed as follows: an initial denaturation at 95 °C for 3 min, followed by 30 cycles of 30 s at 94 °C, 30 s at 54 °C, and 1 min at 72 °C. This was followed by a second reaction: 3 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at 57 °C, and 1 min at 72 °C, with a final extension at 72 °C for 10 min.
To detect the Babesia/Theileria spp. in ticks, PCR was performed using primers targeting the V4 hypervariable region of 18S rRNA [41]. The thermal conditions for Babesia/Theileria spp. were as follows: initial denaturation at 94 °C for 3 min; 35 cycles of 1 min at 94 °C, 1 min at 55 °C, and 2 min at 72 °C; and a final extension at 72 °C for 10 min. PCR products were analyzed using gel electrophoresis on 1.5% agarose gel.
The prevalence of pathogens was calculated as infection rate (IR) and minimum infection rate (MIR). The IR and MIR for pooled ticks were determined by dividing the number of positive pools by the total number of pools of ticks tested or total number of tested ticks, respectively.
In order to analyze the association between human Lyme disease cases and Borrelia spp., the causative agents of Lyme Disease in ticks, statistical data on the occurrence of infectious diseases in Korea were obtained from the Infectious Disease Statistics, KDCA (https://npt.kdca.go.kr/pot/index.do, accessed on 1 September 2024). Monthly Lyme disease occurrence data from 2011 to 2024 were obtained, and the monthly average number of Lyme disease cases was calculated, and compared with the monthly positive rates of Borrelia spp. in ticks.

4.5. DNA Sequencing and Phylogenetic Analysis

The PCR products were purified using a LaboPass gel and PCR clean-up kit (Cosmogene Tech Co., Ltd., Seoul, Republic of Korea), and sequenced in both directions by Macrogen (Macrogen Inc., Seoul, Republic of Korea). The amplified sequence was identified using the basic local alignment search tool network service (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 1 September 2024), and the identified sequences were aligned using BioEdit Sequence Alignment Editor software (version 7.2.5, Ibis Biosciences Co., Carlsbad, CA, USA). Phylogenetic analysis was performed using the maximum likelihood (ML) tree [42] and bootstrap of the MEGA X program. Genetic distance was calculated using MEGA X, and topologies were evaluated using bootstrap analysis with 1000 iterations.

4.6. Data and Statistical Analysis

Statistical data on the occurrence of infectious diseases in Korea were obtained from the Infectious Disease Statistics, KDCA (https://npt.kdca.go.kr/pot/index.do, accessed on 1 September 2024). Statistical analysis was performed with Pearson’s chi-square test using GraphPad Prism software (ver. 7.03). Statistical difference was considered significant at p values less than 0.05.

Author Contributions

Conceptualization, S.-Y.Y. and Y.-M.Y.; formal analysis, J.K. and C.-H.P.; investigation, H.-S.B., I.-Y.L., and M.H.; methodology, S.M., S.Y., S.P., J.-U.J., and J.K.; resources, S.-Y.Y., S.Y., C.-H.P., H.-S.B., and M.H.; data curation, S.P., I.-Y.L., and H.J.; writing—original draft preparation, S.M. and S.L.; writing—review and editing, H.J. and B.-Y.J.; visualization, S.M., J.-U.J., and S.L.; supervision, S.M., Y.-S.C., and B.-Y.J.; project administration, S.-Y.Y., B.-Y.J., and K.-J.L.; funding acquisition, Y.-M.Y., K.-J.L., and Y.-S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by a grant from the Animal and Plant Quarantine Agency, Korea (Grant No. 1543061-2022-22-01), and a grant from Korea, National Institute of Health Research Project (Project No. 2024-ER2111-00).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are contained within the article.

Acknowledgments

We would like to thank the researchers at the Division of Vectors and Parasitic Diseases, Korea Disease Control and Prevention Agency for their kind advice regarding tick collection and identification.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Madison-Antenucci, S.; Kramer, L.D.; Gebhardt, L.L.; Kauffman, E. Emerging tick-borne diseases. Clin. Microbiol. Rev. 2020, 33, e00083-18. [Google Scholar] [CrossRef]
  2. de la Fuente, J. Controlling ticks and tick-borne diseases… looking forward. Ticks Tick-Borne Dis. 2018, 9, 1354–1357. [Google Scholar] [CrossRef]
  3. Dantas-Torres, F.; Chomel, B.B.; Otranto, D. Ticks and tick-borne diseases: A One Health perspective. Trends Parasitol. 2012, 28, 437–446. [Google Scholar] [CrossRef]
  4. Mead, P.; Hinckley, A.; Kugeler, K. Lyme disease sur veillance and epidemiology in the United States: A historical perspective. J. Infect. Dis. 2024, 230 (Suppl. S1), S11–S17. [Google Scholar] [CrossRef]
  5. Binetruy, F.; Garnier, S.; Boulanger, N.; Talagrand-Reboul, É.; Loire, E.; Faivre, B.; Noël, V.; Buysse, M.; Duron, O. A novel Borrelia species, intermediate between Lyme disease and relapsing fever groups, in neotropical passerine-associated ticks. Sci. Rep. 2020, 10, 10596. [Google Scholar] [CrossRef]
  6. Korea Disease Control and Prevention Agency (KDCA). Statistical Information on Outbreaks of Infectious Disease. Available online: https://npt.kdca.go.kr/pot/index.do (accessed on 1 September 2024).
  7. Park, K.H.; Lee, S.H.; Won, W.J.; Jang, W.J.; Chang, W.H. Isolation of Borrelia burgdorferi, the causative agent of Lyme disease, from Ixodes ticks in Korea. J. Korean Soc. Microbiol. 1992, 27, 307–312. [Google Scholar]
  8. Kim, S.Y.; Kim, T.K.; Kim, T.Y.; Lee, H.I. Geographical Distribution of Borrelia burgdorferi sensu lato in ticks collected from wild rodents in the Republic of Korea. Pathogens 2020, 9, 866. [Google Scholar] [CrossRef]
  9. Schudel, S.; Gygax, L.; Kositz, C.; Kuenzli, E.; Neumayr, A. Human granulocytotropic anaplasmosis-A systematic review and analysis of the literature. PLoS Negl. Trop. Dis. 2024, 18, e0012313. [Google Scholar] [CrossRef]
  10. Chen, S.M.; Dumler, J.S.; Bakken, J.S.; Walker, D.H. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 1994, 32, 589–595. [Google Scholar] [CrossRef]
  11. Lee, S.H.; Park, S.Y.; Jang, M.J.; Choi, K.J.; Lee, H.K.; Cho, Y.U.; Lee, Y.S.; Kim, S.H.; Hwang, S.D. Clinical Isolation of Anaplasma phagocytophilum in South Korea. Am. J. Trop. Med. Hyg. 2017, 97, 1686–1690. [Google Scholar] [CrossRef]
  12. Kim, D.Y.; Seo, J.W.; Yun, N.R.; Kim, C.M.; Kim, D.M. Human granulocytic anaplasmosis in a Single University Hospital in the Republic of Korea. Sci. Rep. 2021, 11, 10860. [Google Scholar] [CrossRef] [PubMed]
  13. Lee, S.; Lee, S.H.; VanBik, D.; Kim, N.H.; Kim, K.T.; Goo, Y.K.; Rhee, M.H.; Kwon, O.K.; Kwak, D. First molecular detection and phylogenetic analysis of Anaplasma phagocytophilum in shelter dogs in Seoul, Korea. Ticks Tick Borne Dis. 2016, 7, 945–950. [Google Scholar] [CrossRef] [PubMed]
  14. Miranda, E.A.; Han, S.W.; Cho, Y.K.; Choi, K.S.; Chae, J.S. Co-Infection with Anaplasma Species and Novel Genetic Variants Detected in Cattle and Goats in the Republic of Korea. Pathogens 2021, 10, 28. [Google Scholar] [CrossRef] [PubMed]
  15. Barlough, J.E.; Madigan, J.E.; Kramer, V.L.; Clover, J.R.; Hui, L.T.; Webb, J.P.; Vredevoe, L.K. Ehrlichia phagocytophila genogroup rickettsiae in ixodid ticks from California collected in 1995 and 1996. J. Clin. Microbiol. 1997, 35, 2018–2021. [Google Scholar] [CrossRef]
  16. Petrovec, M.; Sumner, J.W.; Nicholson, W.L.; Childs, J.E.; Strle, F.; Barlic, J.; Lotric-Furlan, S.; Zupanc, T.A. Identity of ehrlichial DNA sequences derived from Ixodes ricinus ticks with those obtained from patients with human granulocytic ehrlichiosis in Slovenia. J. Clin. Microbiol. 1999, 37, 209–210. [Google Scholar] [CrossRef]
  17. Kim, C.M.; Kim, M.S.; Park, M.S.; Park, J.H.; Chae, J.S. Identification of Ehrlichia chaffeensis, Anaplasma phagocytophilum, and A. bovis in Haemaphysalis longicornis and Ixodes persulcatus ticks from Korea. Vector Borne Zoonotic Dis. 2003, 3, 17–26. [Google Scholar] [CrossRef]
  18. Sanchez, E.; Vannier, E.; Wormser, G.P.; Hu, L.T. Diagnosis, treatment, and prevention of Lyme disease, human granulocytic anaplasmosis, and babesiosis: A review. JAMA 2016, 315, 1767–1777. [Google Scholar] [CrossRef]
  19. Lee, M.J.; Yu, D.H.; Yoon, J.S.; Li, Y.H.; Lee, J.H.; Chae, J.S.; Park, J. Epidemiologic and clinical surveys in dogs infected with Babesia gibsoni in South Korea. Vector Borne Zoonotic Dis. 2009, 9, 681–686. [Google Scholar] [CrossRef]
  20. Kim, J.Y.; Cho, S.H.; Joo, H.N.; Tsuji, M.; Cho, S.R.; Park, I.J.; Chung, G.T.; Ju, J.W.; Cheun, H.I.; Lee, H.W. First case of human babesiosis in Korea: Detection and characterization of a novel type of Babesia sp. (KO1) similar to ovine babesia. J. Clin. Microbiol. 2007, 45, 2084–2087. [Google Scholar] [CrossRef]
  21. Teel, P.D.; Hairgrove, T. Transboundary Tick and Tick-Borne Pathogen Threats to Cattle. Vet. Clin. N. Am. Food Anim. Pract. 2024, 40, 305–316. [Google Scholar] [CrossRef]
  22. Lee, S.H.; Moumouni, P.F.A.; Galon, E.M.; Vudriko, P.; Liu, M.; Benedicto, B.; Tumwebaze, M.A.; Boldbaatar, D.; Umemiya-Shirafuji, R.; Fukumoto, S. Differential diagnosis and molecular characterization of Theileria spp. in sika deer (Cervus nippon) in Hokkaido. Japan Parasitol. Int. 2019, 70, 23–26. [Google Scholar] [CrossRef] [PubMed]
  23. Almazán, C.; Scimeca, R.C.; Reichard, M.V.; Mosqueda, J. Babesiosis and Theileriosis in North America. Pathogens 2022, 11, 168. [Google Scholar] [CrossRef] [PubMed]
  24. Moon, M.Y.; Kim, H.K.; Chung, S.J.; Byun, J.H.; Kim, H.N.; Lee, W.; Lee, S.W.; Monoldorova, S.; Lee, S.; Jeon, B.Y.; et al. Genetic Diversity, Regional Distribution, and Clinical Characteristics of Severe Fever with Thrombocytopenia Syndrome virus in Gangwon Province, Korea, a highly prevalent region, 2019–2021. Microorganisms 2023, 11, 2288. [Google Scholar] [CrossRef] [PubMed]
  25. VanBik, D.; Lee, S.H.; Seo, M.G.; Jeon, B.R.; Goo, Y.K.; Park, S.J.; Rhee, M.H.; Kwon, O.D.; Kim, T.H.; Geraldino, P.G.L.; et al. Borrelia species detected in ticks feeding on wild Korean Water Deer (Hydropotes inermis) using molecular and genotypic analyses. J. Med. Entomol. 2017, 54, 1397–1402. [Google Scholar] [CrossRef] [PubMed]
  26. Lee, S.H.; Chong, S.T.; Kim, H.C.; Klein, T.A.; Park, K.; Lee, J.; Kim, J.A.; Kim, W.K.; Song, J.W. Surveillance and molecular identification of Borrelia species in ticks collected at U.S. Army Garrison Humphreys, Republic of Korea, 2018–2019. J. Med. Entomol. 2022, 59, 363–371. [Google Scholar] [CrossRef]
  27. Lee, H.; Lee, S.H.; Shin, S.S.; Kwak, D. Molecular Identification of Borrelia spp. from ticks in pastures nearby livestock farms in Korea. Insects 2021, 12, 1011. [Google Scholar] [CrossRef]
  28. Bakken, J.S.; Dumler, J.S. Human granulocytic ehrlichiosis. Clin. Infect. Dis. 2000, 31, 554–560. [Google Scholar] [CrossRef]
  29. Kim, K.H.; Yi, J.; Oh, W.S.; Kim, N.K.; Choi, S.J.; Choe, P.G.; Kim, N.J.; Lee, J.K.; Oh, M.D. Human granulocytic anaplasmosis, South Korea, 2013. Emerg. Infect. Dis. 2014, 20, 1708–1711. [Google Scholar] [CrossRef]
  30. Sohn, J.H.; Do, J.C.; Cho, G.J. Detection ratio of bacterial and viral pathogens of diarrhea from Korean indigenous goat feces in Gyeongbuk province. Korean J. Vet. Serv. 2016, 39, 35–39. [Google Scholar] [CrossRef]
  31. Kwak, D.; Seo, M.G. Genetic Diversity of Bovine Hemoprotozoa in South Korea. Pathogens 2020, 9, 768. [Google Scholar] [CrossRef]
  32. Chung, C.U.; Lee, H.; Seo, M.G.; Lee, S.H.; Kim, K.T.; Nazim, K.; Song, J.S.; Bae, D.H.; Rhee, M.H.; Kwon, O.D.; et al. Molecular Detection and Genotyping of Theileria spp. in Deer (Cervidae) in Korea. Microorganisms 2023, 11, 2740. [Google Scholar] [CrossRef] [PubMed]
  33. Alkathiri, B.; Ahn, K.S.; Lee, H.; Cho, Y.S.; Youn, S.Y.; Seo, M.G.; Kwak, D.; Shin, S.S.; Lee, S.H. Molecular epidemiology of Theileria species in ticks and its potential threat to livestock in the Republic of Korea. Acta Trop. 2023, 238, 106780. [Google Scholar] [CrossRef] [PubMed]
  34. Seo, M.G.; Noh, B.E.; Lee, H.S.; Kim, T.K.; Song, B.G.; Lee, H.I. Nationwide Temporal and Geographical Distribution of Tick Populations and Phylogenetic Analysis of Severe Fever with Thrombocytopenia Syndrome Virus in Ticks in Korea, 2020. Microorganisms 2021, 9, 1630. [Google Scholar] [CrossRef] [PubMed]
  35. Jang, H.; Casel, M.A.B.; Jang, S.G.; Choi, J.H.; Gil, J.; Rollon, R.; Cheun, S.Y.; Kim, Y.I.; Song, M.S.; Choi, Y.K. Seasonal dynamics of Haemaphysalis tick species as SFTSV vectors in South Korea. Microbiol. Spectr. 2024, 12, e0048924. [Google Scholar] [CrossRef] [PubMed]
  36. Xu, A.L.; Xue, H.; Li, Y.; Wang, X.; Zheng, J.X.; Shi, F.Y.; Cui, Q.X.; Lu, Y.; Cun, D.J.; Li, L.H. Comprehensive meta-analysis of severe fever with thrombocytopenia syndrome virus infections in humans, vertebrate hosts and questing ticks. Parasit. Vectors 2024, 17, 265. [Google Scholar] [CrossRef]
  37. Yamaguti, N.; Tipton, V.J.; Keegan, H.L.; Toshioka, S.Y. Ticks of Japan, Korea, and the Ryukyu islands. Brigh Young Univ. Sci. Biol. Ser. 1971, 15, 1. [Google Scholar]
  38. Postic, D.; Assous, M.V.; Grimont, P.A.; Baranton, G. Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length polymorphism of rrf (5S)-rrl (23S) intergenic spacer amplicons. Int. J. Syst. Bacteriol. 1994, 44, 743–752. [Google Scholar] [CrossRef]
  39. Chu, C.Y.; Jiang, B.G.; Liu, W.; Zhao, Q.M.; Wu, X.M.; Zhang, P.H.; Zhan, L.; Yang, H.; Cao, W.C. Presence of pathogenic Borrelia burgdorferi sensu lato in ticks and rodents in Zhejiang, south-east China. J. Med. Microbiol. 2008, 57, 980–985. [Google Scholar] [CrossRef]
  40. Barlough, J.E.; Madigan, J.E.; DeRock, E.; Bigornia, L. Nested polymerase chain reaction for detection of Ehrlichia equi genomic DNA in horses and ticks (Ixodes pacificus). Vet. Parasitol. 1996, 63, 319–329. [Google Scholar] [CrossRef]
  41. Georges, K.; Loria, G.; Riili, S.; Greco, A.; Caracappa, S.; Jongejan, F.; Sparagano, O. Detection of haemoparasites in cattle by reverse line blot hybridisation with a note on the distribution of ticks in Sicily. Vet. Parasitol. 2001, 99, 273–286. [Google Scholar] [CrossRef]
  42. Tamura, K.; Stecher, G.; Kumar, S.T. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Map of tick collection sites and geographical distribution of tick-borne pathogens in ticks collected in Gangwon Sate, Korea (areas highlighted in red). Collected ticks were pooled, each pool consisting of 1–5 adult ticks, 1–30 nymphs, or 1–50 larvae, and tested for tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. using PCR.
Figure 1. Map of tick collection sites and geographical distribution of tick-borne pathogens in ticks collected in Gangwon Sate, Korea (areas highlighted in red). Collected ticks were pooled, each pool consisting of 1–5 adult ticks, 1–30 nymphs, or 1–50 larvae, and tested for tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. using PCR.
Pathogens 13 01079 g001
Figure 2. Seasonal distribution of ticks (A) and tick-borne pathogens (B) in ticks collected in Gangwon State, Korea. Collected ticks were pooled and tested for tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. using PCR.
Figure 2. Seasonal distribution of ticks (A) and tick-borne pathogens (B) in ticks collected in Gangwon State, Korea. Collected ticks were pooled and tested for tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. using PCR.
Pathogens 13 01079 g002
Figure 3. Seasonal distribution of tick-borne pathogens according to the developmental stage of ticks collected in Gangwon State, Korea. Collected female adults (A), male adults (B), nymphs (C), and larvae (D) were pooled according to the developmental stage of the ticks and tested for tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. using PCR.
Figure 3. Seasonal distribution of tick-borne pathogens according to the developmental stage of ticks collected in Gangwon State, Korea. Collected female adults (A), male adults (B), nymphs (C), and larvae (D) were pooled according to the developmental stage of the ticks and tested for tick-borne pathogens Borrelia spp., Anaplasma spp., and Theileria spp. using PCR.
Pathogens 13 01079 g003
Figure 4. Seasonal distribution of human cases of Lyme disease in Korea from 2011 to 2024 and number of Borrelia spp.-positive ticks collected in Gangwon state, Korea. Human Lyme disease cases in Korea were based on Statistical Information on Outbreaks of Infectious Disease, KDCA [6] and Borrelia spp. were detected from ticks collected in Gangwon state, Korea using PCR.
Figure 4. Seasonal distribution of human cases of Lyme disease in Korea from 2011 to 2024 and number of Borrelia spp.-positive ticks collected in Gangwon state, Korea. Human Lyme disease cases in Korea were based on Statistical Information on Outbreaks of Infectious Disease, KDCA [6] and Borrelia spp. were detected from ticks collected in Gangwon state, Korea using PCR.
Pathogens 13 01079 g004
Figure 5. Phylogenetic analysis of Anaplasma spp. (A) and Theileria spp. sequences (B) from ticks in Gangwon State, Korea. The phylogenetic trees were generated by MEGA-X (ver. 7.0) software using the maximum likelihood (ML) method. The reliability of the ML trees was assessed by bootstrap analysis with 1000 replicates based on partial sequences of 16S rRNA for Anaplasma spp. and 18S rRNA for Theileria spp. The sequences of tick-borne pathogens from ticks analyzed in this study are indicated by circles (red circle; Anaplasma phagocytophilum, green circle; Theileria luwenshuni, blue circle; Theileria capreoli).
Figure 5. Phylogenetic analysis of Anaplasma spp. (A) and Theileria spp. sequences (B) from ticks in Gangwon State, Korea. The phylogenetic trees were generated by MEGA-X (ver. 7.0) software using the maximum likelihood (ML) method. The reliability of the ML trees was assessed by bootstrap analysis with 1000 replicates based on partial sequences of 16S rRNA for Anaplasma spp. and 18S rRNA for Theileria spp. The sequences of tick-borne pathogens from ticks analyzed in this study are indicated by circles (red circle; Anaplasma phagocytophilum, green circle; Theileria luwenshuni, blue circle; Theileria capreoli).
Pathogens 13 01079 g005aPathogens 13 01079 g005b
Table 1. Number of ticks collected in Gangwon state, Korea.
Table 1. Number of ticks collected in Gangwon state, Korea.
SpeciesDevelopmental StageHeongseongYangguHwacheonChuncheonTotal
Haemaphysalis longicornisAdult (M)2138667132
Adult (F)15213472640998
Nymph25041402516717411,596
Larva2368361236731868
Subtotal29132410717855414,594
Haemaphysalis flavaAdult (M)00134
Adult (F)21429
Nymph82261729154
Subtotal84272234167
Ixodes nipponensisAdult (M)037414
Adult (F)00347
Nymph00112
Larva0000
Subtotal0311923
Total29972440750859814,784
Table 2. Monthly number of larvae, nymph, and adult Ixodid ticks collected in Gangwon state, Korea.
Table 2. Monthly number of larvae, nymph, and adult Ixodid ticks collected in Gangwon state, Korea.
SpeciesDevelopmental StageMarAprMayJunJulAugSepOctTotal
Haemaphysalis longicornisAdult (M)019364631000132
Adult (F)01191633663094010998
Nymph013264037487710321671451211,596
Larva00171782014068332331868
Subtotal0146442535467157361397924514,594
Haemaphysalis flavaAdult (M)011000204
Adult (F)011100339
Nymph039663510022154
Subtotal041683610075167
Ixodes nipponensisAdult (M)5220001414
Adult (F)100000247
Nymph110000002
Subtotal7320003823
Total7150843235503158361398925814,784
Table 3. Infection rates of tick-borne pathogens in ticks collected in Gangwon state, Korea.
Table 3. Infection rates of tick-borne pathogens in ticks collected in Gangwon state, Korea.
SpeciesDevelopmental StageNo. of Tested TicksNo. of Tested Tick Pools aTheileria spp.Borrelia spp.Anaplasma spp.
No. of Positive Tick Pools (IR%, MIR%)
Haemaphysalis longicornisAdult (M)71282 (7.14, 2.82)2 (7.14, 2.82)0 (0.00, 0.00)
Adult (F)50911820 (16.95, 3.93)2 (1.69, 0.39)9 (7.63, 1.77)
Nymph580922228 (12.61, 0.48)11 (4.95, 0.19)3 (1.35, 0.05)
Larva942358 (22.86, 0.85)1 (2.86, 0.11)3 (8.57, 0.32)
Subtotal733140358 (14.39, 0.79)16 (3.97, 0.22)15 (3.72, 0.20)
Haemaphysalis flavaAdult (M)440 (0.00, 0.00)0 (0.00, 0.00)0 (0.00, 0.00)
Adult (F)881 (12.50, 12.50)0 (0.00, 0.00)0 (0.00, 0.00)
Nymph82200 (0.00, 0.00)1 (5.00, 1.22)0 (0.00, 0.00)
Subtotal94321 (3.13, 1.06)1 (3.13, 1.06)0 (0.00, 0.00)
Ixodes nipponensisAdult (M)13131 (7.69, 7.69)0 (0.00, 0.00)0 (0.00, 0.00)
Adult (F)551 (20.00, 20.00)0 (0.00, 0.00)1 (20.00, 20.00)
Nymph220 (0.00, 0.00)0 (0.00, 0.00)0 (0.00, 0.00)
Subtotal20202 (10.00, 10.00)0 (0.00, 0.00)1 (5.00, 5.00)
Total744545561 (13.41, 0.82)17 (3.74, 0.23)16 (3.52, 0.21)
a Half of the collected ticks were pooled, each pool consisted of 1–5 adult ticks, 1–30 nymphs, or 1–50 larvae, and were used for the detection of pathogens, IR: infection rate, number of positive pool(s)/total number of the tested tick pools × 100%; MIR: minimum infection rate, number of positive pool(s)/total number of tested ticks × 100%.
Table 4. Primer information for the detection of tick-borne pathogens from the collected ticks in Korea.
Table 4. Primer information for the detection of tick-borne pathogens from the collected ticks in Korea.
Target SpeciesPrimersSequences (5′-3′)Target GeneSize (bp)Ref.
Borrelia spp.Borrelia IGS-FGGGTAATTAGTATTAGTCAGCTTAflagellin B
5S-23S IGS
413[38]
Borrelia IGS-RGCTTTAAGGCGAAGAAGGTCG
B5S-23S_FCTGCGAGTTCGCGGGAGA225–266[39]
B5S-23S-RTCCTAGGCATTCACCATA
Anaplasma spp.EE1TCCTGGCTCAGAACGAACGCTGGCGGC16S rRNA1433[40]
EE2AGTCACTGACCCAACCTTAAATGGCTG
EE3GTCGAACGGATTATTCTTTATAGCTTGC926
EE4CCCTTCCGTTAAGAAGGATCTAATCTCC
Babesia/Theileria spp.RLB-F2GACACAGGGAGGTAGTGA CAAG18S rRNA460–540[41]
RLB-R2CTAAGCATTTCACCTCTGACA GT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Monoldorova, S.; Lee, S.; Yun, S.; Park, S.; Jeong, J.-U.; Kim, J.; Lee, I.-Y.; Jun, H.; Park, C.-H.; Byeon, H.-S.; et al. Seasonal Dynamics of Ticks and Tick-Borne Pathogens in Republic of Korea. Pathogens 2024, 13, 1079. https://doi.org/10.3390/pathogens13121079

AMA Style

Monoldorova S, Lee S, Yun S, Park S, Jeong J-U, Kim J, Lee I-Y, Jun H, Park C-H, Byeon H-S, et al. Seasonal Dynamics of Ticks and Tick-Borne Pathogens in Republic of Korea. Pathogens. 2024; 13(12):1079. https://doi.org/10.3390/pathogens13121079

Chicago/Turabian Style

Monoldorova, Sezim, Sungkyeong Lee, Seungri Yun, Sunho Park, Jong-Uk Jeong, Jiro Kim, In-Yong Lee, Hojong Jun, Chan-Ho Park, Hyeon-Seop Byeon, and et al. 2024. "Seasonal Dynamics of Ticks and Tick-Borne Pathogens in Republic of Korea" Pathogens 13, no. 12: 1079. https://doi.org/10.3390/pathogens13121079

APA Style

Monoldorova, S., Lee, S., Yun, S., Park, S., Jeong, J.-U., Kim, J., Lee, I.-Y., Jun, H., Park, C.-H., Byeon, H.-S., Han, M., Youn, S.-Y., Cho, Y.-S., Yun, Y.-M., Lee, K.-J., & Jeon, B.-Y. (2024). Seasonal Dynamics of Ticks and Tick-Borne Pathogens in Republic of Korea. Pathogens, 13(12), 1079. https://doi.org/10.3390/pathogens13121079

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop