Neoehrlichia mikurensis—A New Emerging Tick-Borne Pathogen in North-Eastern Poland?
Abstract
1. Introduction
2. Materials and Methods
2.1. Tick Collection
2.2. Extraction of Total Nucleic Acids
2.3. cDNA Synthesis and qPCR Detection of Neoehrlichia mikurensis in Questing Ticks
2.4. qPCR Detection of Neoehrlichia mikurensis in Ticks Removed from Dogs
2.5. Nested PCR Assay
2.6. DNA Sequencing and Data Analysis
2.7. Statistics
3. Results
3.1. Tick Collection
3.2. Molecular Identification of Neoehrlichia mikurensis in Ticks
3.3. Molecular Relationships between Neoehrlichia mikurensis Identified in the Study and Accessions from GenBank
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Larsson, C.; Hvidsten, D.; Stuen, S.; Henningsson, A.J.; Wilhelmsson, P. “Candidatus Neoehrlichia Mikurensis” in Ixodes ricinus ticks collected near the Arctic Circle in Norway. Parasit. Vectors 2018, 11, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Kawahara, M.; Rikihisa, Y.; Isogai, E.; Takahashi, M.; Misumi, H.; Suto, C.; Shibata, S.; Zhang, C.; Tsuji, M. ultrastructure and phylogenetic analysis of “Candidatus Neoehrlichia Mikurensis” in the family Anaplasmataceae, isolated from Wild Rats and Found in Ixodes ovatus ticks. Int. J. Syst. Evol. Microbiol. 2004, 54, 1837–1843. [Google Scholar] [CrossRef] [PubMed]
- Wass, L.; Grankvist, A.; Bell-Sakyi, L.; Bergström, M.; Ulfhammer, E.; Lingblom, C.; Wennerås, C. Cultivation of the causative agent of human neoehrlichiosis from clinical isolates identifies vascular endothelium as a target of infection. Emerg. Microbes Infect 2019, 8, 413–425. [Google Scholar] [CrossRef] [PubMed]
- Portillo, A.; Santibáñez, P.; Palomar, A.M.; Santibáñez, S.; Oteo, J.A. ‘Candidatus Neoehrlichia Mikurensis’ in Europe. New Microbes New Infect. 2018, 22, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Ondruš, J.; Kulich, P.; Sychra, O.; Široký, P. Putative morphology of Neoehrlichia mikurensis in salivary glands of Ixodes ricinus. Sci. Rep. 2020, 10. [Google Scholar] [CrossRef]
- Richter, D.; Matuschka, F.R. “Candidatus Neoehrlichia Mikurensis,” Anaplasma phagocytophilum, and Lyme Disease Spirochetes in Questing European Vector Ticks and in Feeding Ticks Removed from People. J. Clin. Microbiol. 2012, 50, 943–947. [Google Scholar] [CrossRef]
- Krücken, J.; Schreiber, C.; Maaz, D.; Kohn, M.; Demeler, J.; Beck, S.; Schein, E.; Olias, P.; Richter, D.; Matuschka, F.R.; et al. A Novel High-Resolution Melt PCR Assay Discriminates Anaplasma phagocytophilum and “Candidatus Neoehrlichia Mikurensis. J. Clin. Microbiol. 2013, 51, 1958–1961. [Google Scholar] [CrossRef] [PubMed]
- Silaghi, C.; Woll, D.; Mahling, M.; Pfister, K.; Pfeffer, M. Candidatus Neoehrlichia Mikurensis in rodents in an area with sympatric existence of the hard ticks Ixodes ricinus and Dermacentor reticulatus, Germany. Parasit. Vectors 2012, 5. [Google Scholar] [CrossRef]
- Welc-Falȩciak, R.; Siński, E.; Kowalec, M.; Zajkowska, J.; Pancewicz, S.A. Asymptomatic “Candidatus Neoehrlichia Mikurensis” Infections in Immunocompetent Humans. J. Clin. Microbiol. 2014, 52, 3072–3074. [Google Scholar] [CrossRef] [PubMed]
- Welinder-Olsson, C.; Kjellin, E.; Vaht, K.; Jacobsson, S.; Wennerås, C. First Case of Human “Candidatus Neoehrlichia Mikurensis” Infection in a Febrile Patient with Chronic Lymphocytic Leukemia. J. Clin. Microbiol. 2010, 48, 1956–1959. [Google Scholar] [CrossRef]
- Pedersen, B.N.; Jenkins, A.; Paulsen, K.M.; Okbaldet, Y.B.; Edgar, K.S.; Lamsal, A.; Soleng, A.; Andreassen, Å.K. Distribution of Neoehrlichia Mikurensis in Ixodes ricinus ticks along the coast of Norway: The Western seaboard is a low-prevalence region. Zoonoses Public Health 2020, 67, 130–137. [Google Scholar] [CrossRef] [PubMed]
- Wass, L.; Quarsten, H.; Lindgren, P.E.; Forsberg, P.; Skoog, E.; Nilsson, K.; Lingblom, C.; Wennerås, C. Cytokine responses of immunosuppressed and immunocompetent patients with Neoehrlichia mikurensis Infection. Med. Microbiol. Immunol. 2022, 211, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Sjöwall, J.; Kling, K.; Ochoa-Figueroa, M.; Zachrisson, H.; Wennerås, C. Neoehrlichia Mikurensis Causing Thrombosis and Relapsing Fever in a Lymphoma Patient Receiving Rituximab. Microorganisms 2021, 9. [Google Scholar] [CrossRef]
- Nowak-Chmura, M. Fauna Kleszczy (Ixodida) Europy Środkowej; Wydawnictwo Naukowe Uniwersytetu Pedagogicznego: Kraków, Poland, 2013; pp. 1–300. [Google Scholar]
- Black, W.C.; Piesmant, J. Phylogeny of Hard-and Soft-Tick Taxa (Acari: Ixodida) Based on Mitochondrial 16S RDNA Sequences. Proc. Natl. Acad. Sci. USA 1994, 91, 10034–10038. [Google Scholar] [CrossRef]
- Sandelin, L.L.; Tolf, C.; Larsson, S.; Wilhelmsson, P.; Salaneck, E.; Jaenson, T.G.T.; Lindgren, P.E.; Olsen, B.; Waldenström, J. Candidatus Neoehrlichia mikurensis in Ticks from Migrating Birds in Sweden. PLoS ONE 2015, 10. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NTe. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Johnson, N.; Phipps, L.P.; Hansford, K.M.; Folly, A.J.; Fooks, A.R.; Medlock, J.M.; Mansfield, K.L. One Health Approach to Tick and Tick-Borne Disease Surveillance in the United Kingdom. Int. J. Environ. Res. Public Health 2022, 19, 5833. [Google Scholar] [CrossRef] [PubMed]
- Kubiak, K.; Sielawa, H.; Dziekońska-Rynko, J.; Kubiak, D.; Rydzewska, M.; Dzika, E. Dermacentor reticulatus ticks (Acari: Ixodidae) distribution in North-Eastern Poland: An endemic area of tick-borne Diseases. Exp. Appl. Acarol. 2018, 75, 289–298. [Google Scholar] [CrossRef]
- Kowalec, M.; Szewczyk, T.; Welc-Falęciak, R.; Siński, E.; Karbowiak, G.; Bajer, A. Rickettsiales Occurrence and Co-Occurrence in Ixodes ricinus Ticks in Natural and Urban Areas. Microb. Ecol. 2019, 77, 890–904. [Google Scholar] [CrossRef]
- Welc-Falȩciak, R.; Kowalec, M.; Karbowiak, G.; Bajer, A.; Behnke, J.M.; Siński, E. Rickettsiaceae and Anaplasmataceae infections in Ixodes ricinus ticks from urban and natural forested areas of Poland. Parasit. Vectors 2014, 7, 121. [Google Scholar] [CrossRef]
- Földvári, G.; Široký, P.; Szekeres, S.; Majoros, G.; Sprong, H. Dermacentor Reticulatus: A Vector on the Rise. Parasit. Vectors 2016, 9, 1–29. [Google Scholar] [CrossRef] [PubMed]
- Król, N.; Obiegala, A.; Pfeffer, M.; Lonc, E.; Kiewra, D. Detection of selected pathogens in ticks collected from cats and dogs in the Wrocław Agglomeration, South-West Poland. Parasit. Vectors 2016, 9, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Hornok, S.; Meli, M.L.; Gönczi, E.; Hofmann-Lehmann, R. First Evidence of Candidatus Neoehrlichia mikurensis in Hungary. Parasit. Vectors 2013, 6, 267. [Google Scholar] [CrossRef] [PubMed]
- Grankvist, A.; Moore, E.R.B.; Stadler, L.S.; Pekova, S.; Bogdan, C.; Geißdörfer, W.; Grip-Lindén, J.; Brandström, K.; Marsal, J.; Andréasson, K.; et al. Multilocus Sequence Analysis of Clinical “Candidatus Neoehrlichia mikurensis” Strains from Europe. J. Clin. Microbiol. 2015, 53, 3126–3132. [Google Scholar] [CrossRef] [PubMed]
- Ivanova, A.; Geller, J.; Katargina, O.; Värv, K.; Lundkvist, Å.; Golovljova, I. Detection of Candidatus Neoehrlichia mikurensis and Ehrlichia muris in Estonian ticks. Ticks Tick Borne Dis. 2017, 8, 13–17. [Google Scholar] [CrossRef]
- Grankvist, A.; Jaén-Luchoro, D.; Wass, L.; Sikora, P.; Wennerås, C. Comparative Genomics of Clinical Isolates of the Emerging Tick-Borne Pathogen Neoehrlichia mikurensis. Microorganisms 2021, 9, 1488. [Google Scholar] [CrossRef]
- Fehr, J.S.; Bloemberg, G.V.; Ritter, C.; Hombach, M.; Lüscher, T.F.; Weber, R.; Keller, P.M. Septicemia caused by tick-borne bacterial pathogen Candidatus Neoehrlichia mikurensis. Emerg. Infect. Dis. 2010, 16, 1127–1129. [Google Scholar] [CrossRef]
- von Loewenich, F.D.; Geißdörfer, W.; Disqué, C.; Matten, J.; Schett, G.; Sakka, S.G.; Bogdan, C. Detection of “Candidatus neoehrlichia mikurensis” in Two Patients with Severe Febrile Illnesses: Evidence for a European Sequence Variant. J. Clin. Microbiol. 2010, 48, 2630–2635. [Google Scholar] [CrossRef]
- Pekova, S.; Vydra, J.; Kabickova, H.; Frankova, S.; Haugvicova, R.; Mazal, O.; Cmejla, R.; Hardekopf, D.W.; Jancuskova, T.; Kozak, T. Candidatus Neoehrlichia mikurensis infection identified in 2 hematooncologic patients: Benefit of molecular techniques for rare pathogen detection. Diagn. Microbiol. Infect. Dis. 2011, 69, 266–270. [Google Scholar] [CrossRef]
- Grankvist, A.; Andersson, P.O.; Mattsson, M.; Sender, M.; Vaht, K.; Höper, L.; Sakiniene, E.; Trysberg, E.; Stenson, M.; Fehr, J.; et al. Infections with the tick-borne bacterium “Candidatus Neoehrlichia mikurensis” mimic noninfectious conditions in patients with B cell malignancies or autoimmune diseases. Clin. Infect. Dis. 2014, 58, 1716–1722. [Google Scholar] [CrossRef] [PubMed]
- Maurer, F.P.; Keller, P.M.; Beuret, C.; Joha, C.; Achermann, Y.; Gubler, J.; Bircher, D.; Karrer, U.; Fehr, J.; Zimmerli, L.; et al. Close Geographic Association of Human Neoehrlichiosis and Tick Populations Carrying “Candidatus Neoehrlichia mikurensis” in Eastern Switzerland. J. Clin. Microbiol. 2013, 51, 169–176. [Google Scholar] [CrossRef]
- Boyer, P.H.; Baldinger, L.; Degeilh, B.; Wirth, X.; Kamdem, C.M.; Hansmann, Y.; Zilliox, L.; Boulanger, N.; Jaulhac, B. The emerging tick-borne pathogen Neoehrlichia mikurensis: First French case series and vector epidemiology. Emerg. Microbes Infect. 2021, 10, 1731–1738. [Google Scholar] [CrossRef] [PubMed]
- Andréasson, K.; Jönsson, G.; Lindell, P.; Gülfe, A.; Ingvarsson, R.; Lindqvist, E.; Saxne, T.; Grankvist, A.; Wennerås, C.; Marsal, J. Recurrent fever caused by Candidatus Neoehrlichia mikurensis in a rheumatoid arthritis patient treated with rituximab. Rheumatology 2015, 54, 369–371. [Google Scholar] [CrossRef]
- Wennerås, C.; Goldblatt, D.; Zancolli, M.; Mattsson, M.; Wass, L.; Hörkkö, S.; Rosén, A. Natural IgM antibodies in the immune defence against Neoehrlichiosis. Infect. Dis. 2017, 49, 809–816. [Google Scholar] [CrossRef] [PubMed]
- Sawczyn-Domańska, A.; Wójcik-Fatla, A. Candidatus Neoehrlichia Mikurensis—Distribution and evaluation of potential risk exposure for human health. Medycyna Ogólna i Nauki o Zdrowiu 2019, 25, 63–69. [Google Scholar] [CrossRef]


| Method | Target Gene | Primer Name | Primer Sequence 5′-3′ | Product Size [bp] | Reference |
|---|---|---|---|---|---|
| PCR | 16S rDNA | Tick_16S_F | CTGCTCAATGATTTTTTAAATTGCTGTGG | 460 | [15] |
| Tick_16S_R | CCGGTCTGAACTCAGATCAAGT | ||||
| qPCR | 16S rRNA | Neo_16S_F | GTAAAGGGCATGTAGGCGGTTTAA | 107 | [16] |
| Neo_16S_R | TCCACTATCCTCTCTCGATCTCTAGTTTAA | ||||
| nPCR | 16S rRNA | Neo_16S_95_F | TTAGTGGCAGACGGGTGAGTAATG | 1321 | |
| Neo_16S_1393_R | TCCTTACGGTTAGCTCACCAGCTT | ||||
| Neo_16S_127_F | TCTGCCTAGTAGTATGGAATAGCTG | 1259 | |||
| Neo_16S_1363_R | AAACCAATTTCCAGGGCATGACGG |
| Collection Site | Ixodes ricinus | Dermacentor reticulatus | |||
|---|---|---|---|---|---|
| Nymph; % (95% CI) | Female; % (95% CI) | Male; % (95% CI) | Female; % (95% CI) | Male; % (95% CI) | |
| Purda | 9/70; 12.8 (6.1–23.0) | 1/11; 9.1 (0.2–41.3) | 4/17; 23.5 (6.8–49.9) | – | – |
| Zazdrość | 0/11; 0.0 (0.0–28.5) | 0/3; 0.0 (0.0–70.8) | 0/4; 0.0 (0.0–60.2) | – | – |
| Pieczewo | – | 3/4; 75.0 (19.4–99.4) | 1/4; 25.0 (0.6–80.6) | 3/9; 33.3 (7.5–70.1) | 6/7; 85.7 (42.1–99.6) |
| Subtotal | 9/81; 11.1 (5.2–20.0) | 4/18; 22.2 (6.4–47.6) | 5/25; 20.0 (6.8–40.7) | 3/9; 33.3 (7.5–70.1) | 6/7; 85.7 (42.1–99.6) |
| 18/124 (14.5%; 95% CI: 8.8–22.0) | 9/16 (56.3%; 95% CI: 29.9–80.2) | ||||
| Total | 27/140 (19.3%; 95% CI: 13.1–26.8) | ||||
| Collection Site | Ixodes ricinus | Dermacentor reticulatus | ||
|---|---|---|---|---|
| Female; % (95% CI) | Male; % (95% CI) | Female; % (95% CI) | Male; % (95% CI) | |
| Dajtki | 0/20; 0.0 (0.0–16.8) | 0/20; 0.0 (0.0–16.8) | 0/20; 0.0 (0.0–16.8) | 0/20; 0.0 (0.0–16.8) |
| Zatorze | 3/20; 15.0 (3.2–37.9) | 0/20; 0.0 (0.0–16.8) | 4/20; 20.0 (5.7–43.7) | 0/20; 0.0 (0.0–16.8) |
| Jaroty | 5/20; 25.0 (8.7–49.1) | 0/5; 0.0 (0.0–52.2) | 2/18; 11.1 (1.4–34.7) | 0/5; 0.0 (0.0–52.2) |
| Subtotal | 8/60; 13.3 (5.9–24.6) | 0/45; 0.0 (0.0–7.9) | 6/58; 10.3 (3.9–21.2) | 0/45; 0.0 (0.0–7.9) |
| 8/105 (7.6%; 95% CI: 3.3–14.5) | 6/103 (5.8%; 95% CI: 2.2–12.2) | |||
| Total | 14/208 (6.7%; 95% CI: 3.7–11.0) | |||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szczotko, M.; Kubiak, K.; Michalski, M.M.; Moerbeck, L.; Antunes, S.; Domingos, A.; Dmitryjuk, M. Neoehrlichia mikurensis—A New Emerging Tick-Borne Pathogen in North-Eastern Poland? Pathogens 2023, 12, 307. https://doi.org/10.3390/pathogens12020307
Szczotko M, Kubiak K, Michalski MM, Moerbeck L, Antunes S, Domingos A, Dmitryjuk M. Neoehrlichia mikurensis—A New Emerging Tick-Borne Pathogen in North-Eastern Poland? Pathogens. 2023; 12(2):307. https://doi.org/10.3390/pathogens12020307
Chicago/Turabian StyleSzczotko, Magdalena, Katarzyna Kubiak, Mirosław Mariusz Michalski, Leonardo Moerbeck, Sandra Antunes, Ana Domingos, and Małgorzata Dmitryjuk. 2023. "Neoehrlichia mikurensis—A New Emerging Tick-Borne Pathogen in North-Eastern Poland?" Pathogens 12, no. 2: 307. https://doi.org/10.3390/pathogens12020307
APA StyleSzczotko, M., Kubiak, K., Michalski, M. M., Moerbeck, L., Antunes, S., Domingos, A., & Dmitryjuk, M. (2023). Neoehrlichia mikurensis—A New Emerging Tick-Borne Pathogen in North-Eastern Poland? Pathogens, 12(2), 307. https://doi.org/10.3390/pathogens12020307

