Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection, DNA Isolation, and Theileria-Specific PCR
2.2. In Vitro Culture of the T. annulata Infected Bovine Lymphocyte Cell Line (TA)
2.3. ddPCR
2.4. qPCR
2.5. TaSP Quantification through qPCR
2.6. Monitoring Treatment Response
2.7. Ethical Approval and Informed Consent
2.8. Statistical Analysis
3. Results
3.1. Comparing the Sensitivity and Accuracy of ddPCR Assay for T. annulata Detection
3.2. Multiplex ddPCR Assay for Diagnosing Theileria Species and T. annulata Parasites from the Field
3.3. Treatment Efficiency of the ddPCR Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Agina, O.A.; Shaari, M.R.; Isa, N.M.M.; Ajat, M.; Zamri-Saad, M.; Hamzah, H. Clinical Pathology, Immunopathology and Advanced Vaccine Technology in Bovine Theileriosis: A Review. Pathogens 2020, 9, 697. [Google Scholar] [CrossRef] [PubMed]
- Pain, A.; Renauld, H.; Berriman, M.; Murphy, L.; Yeats, C.A.; Weir, W.; Kerhornou, A.; Aslett, M.; Bishop, R.; Bouchier, C.; et al. Genome of the Host-Cell Transforming Parasite Theileria annulata Compared with T. parva. Science 2005, 309, 131–133. [Google Scholar] [CrossRef] [PubMed]
- McKeever, D.J. Bovine Immunity—A Driver for Diversity in Theileria Parasites? Trends Parasitol. 2009, 25, 269–276. [Google Scholar] [CrossRef] [PubMed]
- Narladkar, B.W. Projected Economic Losses Due to Vector and Vector-Borne Parasitic Diseases in Livestock of India and Its Significance in Implementing the Concept of Integrated Practices for Vector Management. Vet. World 2018, 11, 151–160. [Google Scholar] [CrossRef] [PubMed]
- Mhadhbi, M.; Naouach, A.; Boumiza, A.; Chaabani, M.F.; BenAbderazzak, S.; Darghouth, M.A. In Vivo Evidence for the Resistance of Theileria annulata to Buparvaquone. Vet. Parasitol. 2010, 169, 241–247. [Google Scholar] [CrossRef]
- Marsolier, J.; Perichon, M.; DeBarry, J.D.; Villoutreix, B.O.; Chluba, J.; Lopez, T.; Garrido, C.; Zhou, X.Z.; Lu, K.P.; Fritsch, L.; et al. Theileria Parasites Secrete a Prolyl Isomerase to Maintain Host Leukocyte Transformation. Nature 2015, 520, 378–382. [Google Scholar] [CrossRef]
- Sharifiyazdi, H.; Namazi, F.; Oryan, A.; Shahriari, R.; Razavi, M. Point Mutations in the Theileria annulata Cytochrome b Gene Is Associated with Buparvaquone Treatment Failure. Vet. Parasitol. 2012, 187, 431–435. [Google Scholar] [CrossRef]
- Chatanga, E.; Mosssad, E.; Abdo Abubaker, H.; Amin Alnour, S.; Katakura, K.; Nakao, R.; Salim, B. Evidence of Multiple Point Mutations in Theileria annulata Cytochrome b Gene Incriminated in Buparvaquone Treatment Failure. Acta Trop. 2019, 191, 128–132. [Google Scholar] [CrossRef]
- Uilenberg, G. Theilerial Species of Domestic Livestock. In Advances in the Control of Theileriosis: Proceedings of an International Conference held at the International Laboratory for Research on Animal Diseases in Nairobi, 9–13th February, 1981; Irvin, A.D., Cunningham, M.P., Young, A.S., Eds.; Current Topics in Veterinary Medicine and Animal Science; Springer: Dordrecht, The Netherlands, 1981; pp. 4–37. ISBN 9789400983465. [Google Scholar]
- Criado-Fornelio, A.; Rey-Valeiron, C.; Buling, A.; Barba-Carretero, J.C.; Jefferies, R.; Irwin, P. New Advances in Molecular Epizootiology of Canine Hematic Protozoa from Venezuela, Thailand and Spain. Vet. Parasitol. 2007, 144, 261–269. [Google Scholar] [CrossRef]
- Mans, B.J.; Pienaar, R.; Latif, A.A. A Review of Theileria Diagnostics and Epidemiology. Int. J. Parasitol. Parasites Wildl. 2015, 4, 104–118. [Google Scholar] [CrossRef]
- Shayan, P.; Biermann, R.; Schein, E.; Gerdes, J.; Ahmed, J.S. Detection and Differentiation of Theileria annulata and Theileria parva Using Macroschizont-Derived DNA Probes. Ann. N. Y. Acad. Sci. 1998, 849, 88–95. [Google Scholar] [CrossRef]
- Ghosh, S.; Bansal, G.C.; Gupta, S.C.; Ray, D.; Khan, M.Q.; Irshad, H.; Shahiduzzaman, M.; Seitzer, U.; Ahmed, J.S. Status of Tick Distribution in Bangladesh, India and Pakistan. Parasitol. Res. 2007, 101, 207–216. [Google Scholar] [CrossRef]
- Bilgic, H.B.; Bakırcı, S.; Kose, O.; Unlu, A.H.; Hacılarlıoglu, S.; Eren, H.; Weir, W.; Karagenc, T. Prevalence of Tick-Borne Haemoparasites in Small Ruminants in Turkey and Diagnostic Sensitivity of Single-PCR and RLB. Parasites Vectors 2017, 10, 211. [Google Scholar] [CrossRef]
- Santos, M.; Soares, R.; Costa, P.; Amaro, A.; Inácio, J.; Gomes, J. Revisiting the Tams1-Encoding Gene as a Species-Specific Target for the Molecular Detection of Theileria annulata in Bovine Blood Samples. Ticks Tick-Borne Dis. 2013, 4, 72–77. [Google Scholar] [CrossRef]
- Kundave, V.R.; Patel, A.K.; Patel, P.V.; Hasnani, J.J.; Joshi, C.G. Qualitative and Quantitative Assessment of Theileria annulata in Cattle and Buffaloes Polymerase Chain Reaction. Trop. Biomed. 2014, 31, 728–735. [Google Scholar]
- Dandasena, D.; Bhandari, V.; Sreenivasamurthy, G.S.; Murthy, S.; Roy, S.; Bhanot, V.; Arora, J.S.; Singh, S.; Sharma, P. A Real-Time PCR Based Assay for Determining Parasite to Host Ratio and Parasitaemia in the Clinical Samples of Bovine Theileriosis. Sci. Rep. 2018, 8, 15441. [Google Scholar] [CrossRef]
- Ros-García, A.; Nicolás, A.; García-Pérez, A.L.; Juste, R.A.; Hurtado, A. Development and Evaluation of a Real-Time PCR Assay for the Quantitative Detection of Theileria annulata in Cattle. Parasites Vectors 2012, 5, 171. [Google Scholar] [CrossRef]
- Selim, A.M.; Das, M.; Senapati, S.K.; Jena, G.R.; Mishra, C.; Nath, I.; Senapati, S.; Sethi, M. Molecular Detection of Theileria annulata Infection in Cattle by Conventional PCR and Quantitative Real Time PCR in India. J. Parasit. Dis. 2021, 45, 72–77. [Google Scholar] [CrossRef]
- Chaisi, M.E.; Janssens, M.E.; Vermeiren, L.; Oosthuizen, M.C.; Collins, N.E.; Geysen, D. Evaluation of a Real-Time PCR Test for the Detection and Discrimination of Theileria Species in the African Buffalo (Syncerus caffer). PLoS ONE 2013, 8, e75827. [Google Scholar] [CrossRef]
- Hostettler, I.; Müller, J.; Stephens, C.E.; Haynes, R.; Hemphill, A. A Quantitative Reverse-Transcriptase PCR Assay for the Assessment of Drug Activities against Intracellular Theileria annulata Schizonts. Int. J. Parasitol. Drugs Drug Resist. 2014, 4, 201–209. [Google Scholar] [CrossRef] [PubMed]
- Ziam, H.; Kelanamer, R.; Aissi, M.; Ababou, A.; Berkvens, D.; Geysen, D. Prevalence of Bovine Theileriosis in North Central Region of Algeria by Real-Time Polymerase Chain Reaction with a Note on Its Distribution. Trop. Anim. Health Prod. 2015, 47, 787–796. [Google Scholar] [CrossRef] [PubMed]
- Rutsaert, S.; Bosman, K.; Trypsteen, W.; Nijhuis, M.; Vandekerckhove, L. Digital PCR as a Tool to Measure HIV Persistence. Retrovirology 2018, 15, 16. [Google Scholar] [CrossRef] [PubMed]
- Papić, B.; Pate, M.; Henigman, U.; Zajc, U.; Gruntar, I.; Biasizzo, M.; Ocepek, M.; Kušar, D. New Approaches on Quantification of Campylobacter Jejuni in Poultry Samples: The Use of Digital PCR and Real-Time PCR against the ISO Standard Plate Count Method. Front. Microbiol. 2017, 8, 331. [Google Scholar] [CrossRef]
- Hayden, R.T.; Gu, Z.; Ingersoll, J.; Abdul-Ali, D.; Shi, L.; Pounds, S.; Caliendo, A.M. Comparison of Droplet Digital PCR to Real-Time PCR for Quantitative Detection of Cytomegalovirus. J. Clin. Microbiol. 2013, 51, 540–546. [Google Scholar] [CrossRef]
- Wang, M.; Yang, J.; Gai, Z.; Huo, S.; Zhu, J.; Li, J.; Wang, R.; Xing, S.; Shi, G.; Shi, F.; et al. Comparison between Digital PCR and Real-Time PCR in Detection of Salmonella Typhimurium in Milk. Int. J. Food Microbiol. 2018, 266, 251–256. [Google Scholar] [CrossRef]
- Roberts, C.H.; Last, A.; Molina-Gonzalez, S.; Cassama, E.; Butcher, R.; Nabicassa, M.; McCarthy, E.; Burr, S.E.; Mabey, D.C.; Bailey, R.L.; et al. Development and Evaluation of a Next-Generation Digital PCR Diagnostic Assay for Ocular Chlamydia Trachomatis Infections. J. Clin. Microbiol 2013, 51, 2195–2203. [Google Scholar] [CrossRef]
- Mancusi, A.; Giordano, A.; Bosco, A.; Girardi, S.; Proroga, Y.T.R.; Morena, L.; Pinto, R.; Sarnelli, P.; Cringoli, G.; Rinaldi, L.; et al. Development of a Droplet Digital Polymerase Chain Reaction Tool for the Detection of Toxoplasma Gondii in Meat Samples. Parasitol. Res. 2022, 121, 1467–1473. [Google Scholar] [CrossRef]
- Ramírez, J.D.; Herrera, G.; Hernández, C.; Cruz-Saavedra, L.; Muñoz, M.; Flórez, C.; Butcher, R. Evaluation of the Analytical and Diagnostic Performance of a Digital Droplet Polymerase Chain Reaction (DdPCR) Assay to Detect Trypanosoma Cruzi DNA in Blood Samples. PLoS Negl. Trop. Dis. 2018, 12, e0007063. [Google Scholar] [CrossRef]
- Ramírez, J.D.; Herrera, G.; Muskus, C.; Mendez, C.; Duque, M.C.; Butcher, R. Development of a Digital Droplet Polymerase Chain Reaction (DdPCR) Assay to Detect Leishmania DNA in Samples from Cutaneous Leishmaniasis Patients. Int. J. Infect. Dis. 2019, 79, 1–3. [Google Scholar] [CrossRef]
- Yang, R.; Paparini, A.; Monis, P.; Ryan, U. Comparison of Next-Generation Droplet Digital PCR (DdPCR) with Quantitative PCR (QPCR) for Enumeration of Cryptosporidium Oocysts in Faecal Samples. Int. J. Parasitol. 2014, 44, 1105–1113. [Google Scholar] [CrossRef]
- Srisutham, S.; Saralamba, N.; Malleret, B.; Rénia, L.; Dondorp, A.M.; Imwong, M. Four Human Plasmodium Species Quantification Using Droplet Digital PCR. PLoS ONE 2017, 12, e0175771. [Google Scholar] [CrossRef] [PubMed]
- Koepfli, C.; Nguitragool, W.; Hofmann, N.E.; Robinson, L.J.; Ome-Kaius, M.; Sattabongkot, J.; Felger, I.; Mueller, I. Sensitive and Accurate Quantification of Human Malaria Parasites Using Droplet Digital PCR (DdPCR). Sci. Rep. 2016, 6, 39183. [Google Scholar] [CrossRef] [PubMed]
- Maggi, R.; Breitschwerdt, E.B.; Qurollo, B.; Miller, J.C. Development of a Multiplex Droplet Digital PCR Assay for the Detection of Babesia, Bartonella, and Borrelia Species. Pathogens 2021, 10, 1462. [Google Scholar] [CrossRef] [PubMed]
- Wilson, M.; Glaser, K.C.; Adams-Fish, D.; Boley, M.; Mayda, M.; Molestina, R.E. Development of Droplet Digital PCR for the Detection of Babesia microti and Babesia duncani. Exp. Parasitol. 2015, 149, 24–31. [Google Scholar] [CrossRef]
- Seitzer, U.; Bakheit, M.A.; Salih, D.E.A.; Ali, A.; Haller, D.; Yin, H.; Schnittger, L.; Ahmed, J. From Molecule to Diagnostic Tool: Theileria annulata Surface Protein TaSP. Parasitol. Res. 2007, 101, 217–223. [Google Scholar] [CrossRef]
- Bilgic, H.B.; Karagenç, T.; Shiels, B.; Tait, A.; Eren, H.; Weir, W. Evaluation of Cytochrome b as a Sensitive Target for PCR Based Detection of T. annulata Carrier Animals. Vet. Parasitol. 2010, 174, 341–347. [Google Scholar] [CrossRef]
- George, N.; Bhandari, V.; Reddy, D.P.; Sharma, P. Molecular and Phylogenetic Analysis Revealed New Genotypes of Theileria annulata Parasites from India. Parasites Vectors 2015, 8, 468. [Google Scholar] [CrossRef]
- Mhadhbi, M.; Chaouch, M.; Ajroud, K.; Darghouth, M.A.; BenAbderrazak, S. Sequence Polymorphism of Cytochrome b Gene in Theileria annulata Tunisian Isolates and Its Association with Buparvaquone Treatment Failure. PLoS ONE 2015, 10, e0129678. [Google Scholar] [CrossRef]



| Primers | Sequence 5′-3′ | 
|---|---|
| Sense TaSP (F) | AAACCATTCGTGCCCAAG | 
| Antisense TaSP (R) | CAGTCAAACGCTACAGTGA | 
| Sense 18S rRNA (F) | ACAGGGAGGTAGTGACAAGA | 
| Antisense 18S rRNA (R) | CGCTATTGGAGCCGGAATTA | 
| Probes | Sequence 5′-3′ | 
| TaSP FAM | TCGCAATGTTGTGGATCATACTTCACA | 
| 18SRNA HEX | TATCAATTGGAGGGCAAGTCTGGTGC | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Murthy, S.; Suresh, A.; Dandasena, D.; Singh, S.; Subudhi, M.; Bhandari, V.; Bhanot, V.; Arora, J.S.; Sharma, P. Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis. Pathogens 2023, 12, 296. https://doi.org/10.3390/pathogens12020296
Murthy S, Suresh A, Dandasena D, Singh S, Subudhi M, Bhandari V, Bhanot V, Arora JS, Sharma P. Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis. Pathogens. 2023; 12(2):296. https://doi.org/10.3390/pathogens12020296
Chicago/Turabian StyleMurthy, Shweta, Akash Suresh, Debabrata Dandasena, Sakshi Singh, Madhusmita Subudhi, Vasundhra Bhandari, Vandna Bhanot, Jaspreet Singh Arora, and Paresh Sharma. 2023. "Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis" Pathogens 12, no. 2: 296. https://doi.org/10.3390/pathogens12020296
APA StyleMurthy, S., Suresh, A., Dandasena, D., Singh, S., Subudhi, M., Bhandari, V., Bhanot, V., Arora, J. S., & Sharma, P. (2023). Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis. Pathogens, 12(2), 296. https://doi.org/10.3390/pathogens12020296
 
        

 
       