Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673
Error in Figure/Table
Reference
- Chen, J.; Ran, F.; Shi, J.; Chen, T.; Zhao, Z.; Zhang, Z.; He, L.; Li, W.; Wang, B.; Chen, X.; et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. [Google Scholar] [CrossRef]
Target Region/Gene | Description | Primer | Sequence 5′→3′ | Reference |
---|---|---|---|---|
ITS | Region with ribosomal RNA genes and two internal transcribed spacers | ITS1 | TCCGTAGGTGAACCTGCGG | [49] |
ITS4 | TCCTCCGCTTATTGATATGC | |||
TEF-1α | Translation elongation factor 1-α gene | EF1-728F | CATCGAGAAGTTCGAGAAGG | [50] |
EF1-986R | TACTTGAAGGAACCCTTACC | |||
RPB2 | Second largest subunit of RNA polymerase II | fRPB2-7cR | CCCATRGCTTGTYYRCCCAT | [51] |
RPB2-5F2 | GGGGWGAYCAGAAGAAGGC | [52] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Ran, F.; Shi, J.; Chen, T.; Zhao, Z.; Zhang, Z.; He, L.; Li, W.; Wang, B.; Chen, X.; et al. Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens 2023, 12, 1327. https://doi.org/10.3390/pathogens12111327
Chen J, Ran F, Shi J, Chen T, Zhao Z, Zhang Z, He L, Li W, Wang B, Chen X, et al. Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens. 2023; 12(11):1327. https://doi.org/10.3390/pathogens12111327
Chicago/Turabian StyleChen, Jia, Fei Ran, Jinqiao Shi, Tingting Chen, Zhibo Zhao, Zhuzhu Zhang, Linan He, Wenzhi Li, Bingce Wang, Xuetang Chen, and et al. 2023. "Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673" Pathogens 12, no. 11: 1327. https://doi.org/10.3390/pathogens12111327
APA StyleChen, J., Ran, F., Shi, J., Chen, T., Zhao, Z., Zhang, Z., He, L., Li, W., Wang, B., Chen, X., Wang, W., & Long, Y. (2023). Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens, 12(11), 1327. https://doi.org/10.3390/pathogens12111327