Next Article in Journal
Genomic Mutations in SARS-CoV-2 Genome following Infection in Syrian Golden Hamster and Associated Lung Pathologies
Previous Article in Journal
Anisakid Presence in the European Conger, Conger conger, from Spanish Mediterranean Waters
Previous Article in Special Issue
Genetic Mapping, Candidate Gene Identification and Marker Validation for Host Plant Resistance to the Race 4 of Fusarium oxysporum f. sp. cubense Using Musa acuminata ssp. malaccensis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Correction

Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673

1
Research Center for Engineering Technology of Kiwifruit, Institute of Crop Protection, College of Agriculture, Guizhou University, Guiyang 550025, China
2
Teaching Experimental Field of Guizhou University, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Pathogens 2023, 12(11), 1327; https://doi.org/10.3390/pathogens12111327
Submission received: 26 October 2023 / Accepted: 30 October 2023 / Published: 8 November 2023
(This article belongs to the Special Issue Current Research on Fusarium)

Error in Figure/Table

In the original publication [1], there was a mistake in Figure 4A and Table 3 as published. The original Figure 4A incorrectly included two identical plates. The corrected Figure 4 is shown below. The reference numbers in the original Table 3 are not correct. The correct reference numbers should be [49–52], instead of [26–29]. The corrected Table 3 is shown below.
The authors apologize for any inconvenience caused and state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.

Reference

  1. Chen, J.; Ran, F.; Shi, J.; Chen, T.; Zhao, Z.; Zhang, Z.; He, L.; Li, W.; Wang, B.; Chen, X.; et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. [Google Scholar] [CrossRef]
Figure 4. (A) Mycelial growth inhibition of Fusarium graminearum isolate CY2 after the application of different active ingredients of biological fungicides under a series of concentrations, with fungicide free plates (CK) as the control. (B) EC50 value of different fungicides applied to isolate CY2. The error bar indicates standard deviations (SD), each value is the mean ± SD of three replicates, and different lower-case letters represent significant differences at the 5% level (p < 0.05).
Figure 4. (A) Mycelial growth inhibition of Fusarium graminearum isolate CY2 after the application of different active ingredients of biological fungicides under a series of concentrations, with fungicide free plates (CK) as the control. (B) EC50 value of different fungicides applied to isolate CY2. The error bar indicates standard deviations (SD), each value is the mean ± SD of three replicates, and different lower-case letters represent significant differences at the 5% level (p < 0.05).
Pathogens 12 01327 g004
Table 3. Primers used in the present study.
Table 3. Primers used in the present study.
Target Region/GeneDescriptionPrimerSequence 5′→3′Reference
ITSRegion with ribosomal RNA genes and two internal transcribed spacersITS1TCCGTAGGTGAACCTGCGG[49]
ITS4TCCTCCGCTTATTGATATGC
TEF-1αTranslation elongation factor 1-α geneEF1-728FCATCGAGAAGTTCGAGAAGG[50]
EF1-986RTACTTGAAGGAACCCTTACC
RPB2Second largest subunit of RNA polymerase IIfRPB2-7cRCCCATRGCTTGTYYRCCCAT[51]
RPB2-5F2GGGGWGAYCAGAAGAAGGC[52]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, J.; Ran, F.; Shi, J.; Chen, T.; Zhao, Z.; Zhang, Z.; He, L.; Li, W.; Wang, B.; Chen, X.; et al. Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens 2023, 12, 1327. https://doi.org/10.3390/pathogens12111327

AMA Style

Chen J, Ran F, Shi J, Chen T, Zhao Z, Zhang Z, He L, Li W, Wang B, Chen X, et al. Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens. 2023; 12(11):1327. https://doi.org/10.3390/pathogens12111327

Chicago/Turabian Style

Chen, Jia, Fei Ran, Jinqiao Shi, Tingting Chen, Zhibo Zhao, Zhuzhu Zhang, Linan He, Wenzhi Li, Bingce Wang, Xuetang Chen, and et al. 2023. "Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673" Pathogens 12, no. 11: 1327. https://doi.org/10.3390/pathogens12111327

APA Style

Chen, J., Ran, F., Shi, J., Chen, T., Zhao, Z., Zhang, Z., He, L., Li, W., Wang, B., Chen, X., Wang, W., & Long, Y. (2023). Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens, 12(11), 1327. https://doi.org/10.3390/pathogens12111327

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop