The Prevalence and Genetic Diversity of PCV3 and PCV2 in Colombia and PCV4 Survey during 2015–2016 and 2018–2019
Abstract
1. Introduction
2. Results
2.1. Detection of PCV2, PCV3, PCV4 and Co-Infections between Them
2.2. Sequence Analysis of PCV3 and PCV2
3. Discussion
4. Materials and Methods
4.1. Samples
4.2. Nucleic Acid Extraction and Detection by PCR of PCV2, PCV3 and PCV4
4.3. Sequencing of the PCV2-ORF2 and PCV3 Complete Genome
4.4. Phylogenetic Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lefkowitz, E.J.; Dempsey, D.M.; Hendrickson, R.C.; Orton, R.J.; Siddell, S.G.; Smith, D.B. Virus taxonomy: The database of the International Committee on Taxonomy of Viruses (ICTV). Nucleic Acids Res. 2018, 46, D708–D717. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.-H.; Hu, W.-Q.; Li, J.-Y.; Liu, T.-N.; Zhou, J.-Y.; Opriessnig, T.; Xiao, C.-T. Novel circovirus species identified in farmed pigs designated as Porcine circovirus 4, Hunan province, China. Transbound. Emerg. Dis. 2020, 67, 1057–1061. [Google Scholar] [CrossRef] [PubMed]
- Tischer, I.; Mields, W.; Wolff, D.; Vagt, M.; Griem, W. Studies on epidemiology and pathogenicity of porcine circovirus. Arch. Virol. 1986, 91, 271–276. [Google Scholar] [CrossRef]
- Ellis, J.; Hassard, L.; Clark, E.; Harding, J.; Allan, G.; Willson, P.; Strokappe, J.; Martin, K.; McNeilly, F.; Meehan, B.; et al. Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can. Vet. J. 1998, 39, 44–51. [Google Scholar] [PubMed]
- Segalés, J.; Olvera, A.; Grau-Roma, L.; Charreyre, C.; Nauwynck, H.; Larsen, L.; Dupont, K.; McCullough, K.; Ellis, J.; Krakowka, S.; et al. PCV-2 genotype definition and nomenclature. Vet. Rec. 2008, 162, 867–868. [Google Scholar] [CrossRef]
- Guo, L.J.; Lu, Y.H.; Wei, Y.W.; Huang, L.P.; Liu, C.M. Porcine circovirus type 2 (PCV2): Genetic variation and newly emerging genotypes in China. Virol. J. 2010, 7, 273. [Google Scholar] [CrossRef]
- Davies, B.; Wang, X.; Dvorak, C.M.T.; Marthaler, D.; Murtaugh, M.P. Diagnostic phylogenetics reveals a new Porcine circovirus 2 cluster. Virus Res. 2016, 217, 32–37. [Google Scholar] [CrossRef]
- Bao, F.; Mi, S.; Luo, Q.; Guo, H.; Tu, C.; Zhu, G.; Gong, W. Retrospective study of porcine circovirus type 2 infection reveals a novel genotype PCV2f. Transbound. Emerg. Dis. 2018, 65, 432–440. [Google Scholar] [CrossRef]
- Franzo, G.; Segalés, J. Porcine circovirus 2 (PCV-2) genotype update and proposal of a new genotyping methodology. PLoS ONE 2018, 13, e0208585. [Google Scholar] [CrossRef]
- Segalés, J.; Kekarainen, T.; Cortey, M. The natural history of porcine circovirus type 2: From an inoffensive virus to a devastating swine disease? Vet. Microbiol. 2013, 165, 13–20. [Google Scholar] [CrossRef]
- Franzo, G.; Cortey, M.; Segalés, J.; Hughes, J.; Drigo, M. Phylodynamic analysis of porcine circovirus type 2 reveals global waves of emerging genotypes and the circulation of recombinant forms. Mol. Phylogenet. Evol. 2016, 100, 269–280. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.G.; Giannitti, F.; Rossow, S.; Marthaler, D.; Knutson, T.P.; Li, L.; Deng, X.; Resende, T.; Vannucci, F.; Delwart, E. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol. J. 2016, 13, 184. [Google Scholar] [CrossRef] [PubMed]
- Palinski, R.; Piñeyro, P.; Shang, P.; Yuan, F.; Guo, R.; Fang, Y.; Byers, E.; Hause, B.M. A Novel Porcine Circovirus Distantly Related to Known Circoviruses Is Associated with Porcine Dermatitis and Nephropathy Syndrome and Reproductive Failure. J. Virol. 2017, 91, e01879-16. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.; Berg, M.; Fossum, C.; Wallgren, P.; Blomström, A.-L. Detection and genetic characterisation of porcine circovirus 3 from pigs in Sweden. Virus Genes 2018, 54, 466–469. [Google Scholar] [CrossRef]
- Sun, J.; Wei, L.; Lu, Z.; Mi, S.; Bao, F.; Guo, H.; Tu, C.; Zhu, Y.; Gong, W. Retrospective study of porcine circovirus 3 infection in China. Transbound. Emerg. Dis. 2018, 65, 607–613. [Google Scholar] [CrossRef]
- Klaumann, F.; Franzo, G.; Sohrmann, M.; Correa-Fiz, F.; Drigo, M.; Núñez, J.I.; Sibila, M.; Segalés, J. Retrospective detection of Porcine circovirus 3 (PCV-3) in pig serum samples from Spain. Transbound. Emerg. Dis. 2018, 65, 1290–1296. [Google Scholar] [CrossRef]
- Franzo, G.; Legnardi, M.; Hjulsager, C.K.; Klaumann, F.; Larsen, L.E.; Segales, J.; Drigo, M. Full-genome sequencing of porcine circovirus 3 field strains from Denmark, Italy and Spain demonstrates a high within-Europe genetic heterogeneity. Transbound. Emerg. Dis. 2018, 65, 602–606. [Google Scholar] [CrossRef]
- Molini, U.; Marruchella, G.; Matheus, F.; Hemberger, Y.M.; Chiwome, B.; Khaiseb, S.; Cattoli, G.; Franzo, G. Molecular investigation of porcine circovirus type 3 infection in pigs in namibia. Pathogens 2021, 10, 585. [Google Scholar] [CrossRef]
- Tochetto, C.; Lima, D.A.; Varela, A.P.M.; Loiko, M.R.; Paim, W.P.; Scheffer, C.M.; Herpich, J.I.; Cerva, C.; Schmitd, C.; Cibulski, S.P.; et al. Full-Genome Sequence of Porcine Circovirus type 3 recovered from serum of sows with stillbirths in Brazil. Transbound. Emerg. Dis. 2018, 65, 5–9. [Google Scholar] [CrossRef] [PubMed]
- Vargas-Bermudez, D.S.; Campos, F.S.; Bonil, L.; Mogollon, D.; Jaime, J. First detection of porcine circovirus type 3 in Colombia and the complete genome sequence demonstrates the circulation of PCV3a1 and PCV3a2. Vet. Med. Sci. 2019, 5, 182–188. [Google Scholar] [CrossRef]
- Rubilar, P.S.; Tognarelli, J.; Fernández, J.; Valdés, C.; Broitman, F.; Mandakovic, D.; Pulgar, R. Swine viral detection by adapted Next-Generation Sequencing (NGS) for RNA and DNA species reveals first detection of porcine circovirus type 3 (PCV3) in Chile. bioRxiv 2020. [Google Scholar] [CrossRef]
- Serena, M.S.; Cappuccio, J.A.; Barrales, H.; Metz, G.E.; Aspitia, C.G.; Lozada, I.; Perfumo, C.J.; Quiroga, M.A.; Piñeyro, P.; Echeverría, M.G. First detection and genetic characterization of porcine circovirus type 3 (PCV3) in Argentina and its association with reproductive failure. Transbound. Emerg. Dis. 2020, 68, 1761–1766. [Google Scholar] [CrossRef]
- Zheng, S.; Wu, X.; Zhang, L.; Xin, C.; Liu, Y.; Shi, J.; Peng, Z.; Xu, S.; Fu, F.; Yu, J.; et al. The occurrence of porcine circovirus 3 without clinical infection signs in Shandong Province. Transbound. Emerg. Dis. 2017, 64, 1337–1341. [Google Scholar] [CrossRef] [PubMed]
- Kwon, T.; Yoo, S.J.; Park, C.-K.; Lyoo, Y.S. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet. Microbiol. 2017, 207, 178–180. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.-H.; Park, J.-Y.; Jung, J.-Y.; Kim, H.-Y.; Park, Y.-R.; Lee, K.-K.; Lyoo, Y.S.; Yeo, S.-G.; Park, C.-K. Detection and genetic characterization of porcine circovirus 3 from aborted fetuses and pigs with respiratory disease in Korea. J. Vet. Sci. 2018, 19, 721–724. [Google Scholar] [CrossRef]
- Kedkovid, R.; Woonwong, Y.; Arunorat, J.; Sirisereewan, C.; Sangpratum, N.; Lumyai, M.; Kesdangsakonwut, S.; Teankum, K.; Jittimanee, S.; Thanawongnuwech, R. Porcine circovirus type 3 (PCV3) infection in grower pigs from a Thai farm suffering from porcine respiratory disease complex (PRDC). Vet. Microbiol. 2018, 215, 71–76. [Google Scholar] [CrossRef]
- Chen, G.H.; Mai, K.J.; Zhou, L.; Wu, R.T.; Tang, X.Y.; Wu, J.L.; He, L.L.; Lan, T.; Xie, Q.M.; Sun, Y.; et al. Detection and genome sequencing of porcine circovirus 3 in neonatal pigs with congenital tremors in South China. Transbound. Emerg. Dis. 2017, 64, 1650–1654. [Google Scholar] [CrossRef]
- Zhai, S.-L.; Zhou, X.; Zhang, H.; Hause, B.M.; Lin, T.; Liu, R.; Chen, Q.-L.; Wei, W.-K.; Lv, D.-H.; Wen, X.-H.; et al. Comparative epidemiology of porcine circovirus type 3 in pigs with different clinical presentations. Virol. J. 2017, 14, 222. [Google Scholar] [CrossRef]
- Mora-Díaz, J.; Piñeyro, P.; Shen, H.; Schwartz, K.; Vannucci, F.; Li, G.; Arruda, B.; Giménez-Lirola, L. Isolation of PCV3 from Perinatal and Reproductive Cases of PCV3-Associated Disease and In Vivo Characterization of PCV3 Replication in CD/CD Growing Pigs. Viruses 2020, 12, 219. [Google Scholar] [CrossRef]
- Vargas-Bermúdez, D.S.; Vargas-Pinto, M.A.; Mogollón, J.D.; Jaime, J. Field infection of a gilt and its litter demonstrates vertical transmission and effect on reproductive failure caused by porcine circovirus type 3 (PCV3). BMC Vet. Res. 2021, 17, 150. [Google Scholar] [CrossRef]
- Saporiti, V.; Franzo, G.; Sibila, M.; Segalés, J. Porcine circovirus 3 (PCV-3) as a causal agent of disease in swine and a proposal of PCV-3 associated disease case definition. Transbound. Emerg. Dis. 2021, 68, 2936–2948. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Noll, L.; Lu, N.; Porter, E.; Stoy, C.; Zheng, W.; Liu, X.; Peddireddi, L.; Niederwerder, M.; Bai, J. Genetic diversity and prevalence of porcine circovirus type 3 (PCV3) and type 2 (PCV2) in the Midwest of the USA during 2016-2018. Transbound. Emerg. Dis. 2020, 67, 1284–1294. [Google Scholar] [CrossRef] [PubMed]
- Xia, D.; Huang, L.; Xie, Y.; Zhang, X.; Wei, Y.; Liu, D.; Zhu, H.; Bian, H.; Feng, L.; Liu, C. The prevalence and genetic diversity of porcine circovirus types 2 and 3 in Northeast China from 2015 to 2018. Arch. Virol. 2019, 164, 2435–2449. [Google Scholar] [CrossRef]
- Guo, Z.; Ruan, H.; Qiao, S.; Deng, R.; Zhang, G. Co-infection status of porcine circoviruses (PCV2 and PCV3) and porcine epidemic diarrhea virus (PEDV) in pigs with watery diarrhea in Henan province, central China. Microb. Pathog. 2020, 142, 104047. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Huang, Y.; Ye, M.; Li, S.; Xiao, Y.; Cui, B.; Zhu, J. Co-infection status of classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circoviruses (PCV2 and PCV3) in eight regions of China from 2016 to 2018. Infect. Genet. Evol. 2019, 68, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Opriessnig, T.; Gauger, P.C.; Faaberg, K.S.; Shen, H.; Beach, N.M.; Meng, X.-J.; Wang, C.; Halbur, P.G. Effect of porcine circovirus type 2a or 2b on infection kinetics and pathogenicity of two genetically divergent strains of porcine reproductive and respiratory syndrome virus in the conventional pig model. Vet. Microbiol. 2012, 158, 69–81. [Google Scholar] [CrossRef]
- Opriessnig, T.; Halbur, P.G. Concurrent infections are important for expression of porcine circovirus associated disease. Virus Res. 2012, 164, 20–32. [Google Scholar] [CrossRef]
- Franzo, G.; He, W.; Correa-Fiz, F.; Li, G.; Legnardi, M.; Su, S.; Segalés, J. A Shift in Porcine Circovirus 3 (PCV-3) History Paradigm: Phylodynamic Analyses Reveal an Ancient Origin and Prolonged Undetected Circulation in the Worldwide Swine Population. Adv. Sci. 2019, 6, 1901004. [Google Scholar] [CrossRef]
- Fu, X.; Fang, B.; Ma, J.; Liu, Y.; Bu, D.; Zhou, P.; Wang, H.; Jia, K.; Zhang, G. Insights into the epidemic characteristics and evolutionary history of the novel porcine circovirus type 3 in southern China. Transbound. Emerg. Dis. 2018, 65, e296–e303. [Google Scholar] [CrossRef]
- Fux, R.; Söckler, C.; Link, E.K.; Renken, C.; Krejci, R.; Sutter, G.; Ritzmann, M.; Eddicks, M. Full genome characterization of porcine circovirus type 3 isolates reveals the existence of two distinct groups of virus strains. Virol. J. 2018, 15, 25. [Google Scholar] [CrossRef]
- Franzo, G.; Delwart, E.; Fux, R.; Hause, B.; Su, S.; Zhou, J.; Segalés, J. Genotyping Porcine Circovirus 3 (PCV-3) Nowadays: Does It Make Sense? Viruses 2020, 12, 265. [Google Scholar] [CrossRef]
- Saporiti, V.; Cruz, T.F.; Correa-Fiz, F.; Núñez, J.I.; Sibila, M.; Segalés, J. Similar frequency of Porcine circovirus 3 (PCV-3) detection in serum samples of pigs affected by digestive or respiratory disorders and age-matched clinically healthy pigs. Transbound. Emerg. Dis. 2020, 67, 199–205. [Google Scholar] [CrossRef] [PubMed]
- Dvorak, C.M.T.; Yang, Y.; Haley, C.; Sharma, N.; Murtaugh, M.P. National reduction in porcine circovirus type 2 prevalence following introduction of vaccination. Vet. Microbiol. 2016, 189, 86–90. [Google Scholar] [CrossRef]
- Segalés, J.; Mateu, E. Immunosuppression as a feature of postweaning multisystemic wasting syndrome. Vet. J. 2006, 171, 396–397. [Google Scholar] [CrossRef] [PubMed]
- Monroy, M.A.R.; Ramirez-Nieto, G.C.; Vera, V.J.; Correa, J.J.; Mogollón-Galvis, J.D. Detection and molecular characterization of porcine circovirus type 2 from piglets with porcine circovirus associated diseases in Colombia. Virol. J. 2014, 11, 143. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Xiao, C.-T.; Harmon, K.M.; Halbur, P.G.; Opriessnig, T. PCV2d-2 is the predominant type of PCV2 DNA in pig samples collected in the U.S. during 2014-2016. Vet. Microbiol. 2016, 197, 72–77. [Google Scholar] [CrossRef]
- Woźniak, A.; Miłek, D.; Matyba, P.; Stadejek, T. Real-Time PCR Detection Patterns of Porcine Circovirus Type 2 (PCV2) in Polish Farms with Different Statuses of Vaccination against PCV2. Viruses 2019, 11, 1135. [Google Scholar] [CrossRef]
- Pejsak, Z.; Kusior, G.; Pomorska-Mól, M.; Podgórska, K. Influence of long-term vaccination of a breeding herd of pigs against PCV2 on reproductive parameters. Pol. J. Vet. Sci. 2012, 15, 37–42. [Google Scholar] [CrossRef]
- Vargas-Bermudez, D.S.; Díaz, A.; Mogollón, J.D.; Jaime, J. Longitudinal comparison of the humoral immune response and viral load of Porcine Circovirus Type 2 in pigs with different vaccination schemes under field conditions. F1000Research 2018, 7, 42. [Google Scholar] [CrossRef]
- Jiang, H.; Wang, D.; Wang, J.; Zhu, S.; She, R.; Ren, X.; Tian, J.; Quan, R.; Hou, L.; Li, Z.; et al. Induction of Porcine Dermatitis and Nephropathy Syndrome in Piglets by Infection with Porcine Circovirus Type 3. J. Virol. 2019, 93, e02045-18. [Google Scholar] [CrossRef]
- Li, G.; He, W.; Zhu, H.; Bi, Y.; Wang, R.; Xing, G.; Zhang, C.; Zhou, J.; Yuen, K.-Y.; Gao, G.F.; et al. Origin, genetic diversity, and evolutionary dynamics of novel porcine circovirus 3. Adv. Sci. 2018, 5, 1800275. [Google Scholar] [CrossRef]
- Sun, W.; Du, Q.; Han, Z.; Bi, J.; Lan, T.; Wang, W.; Zheng, M. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 2021, 773, 145384. [Google Scholar] [CrossRef] [PubMed]
- Tian, R.-B.; Zhao, Y.; Cui, J.-T.; Zheng, H.-H.; Xu, T.; Hou, C.-Y.; Wang, Z.-Y.; Li, X.-S.; Zheng, L.-L.; Chen, H.-Y. Molecular detection and phylogenetic analysis of Porcine circovirus 4 in Henan and Shanxi Provinces of China. Transbound. Emerg. Dis. 2021, 68, 276–282. [Google Scholar] [CrossRef] [PubMed]
- Ha, Z.; Yu, C.; Xie, C.; Wang, G.; Zhang, Y.; Hao, P.; Li, J.; Li, Z.; Li, Y.; Rong, F.; et al. Retrospective surveillance of porcine circovirus 4 in pigs in Inner Mongolia, China, from 2016 to 2018. Arch. Virol. 2021, 166, 1951–1959. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Xiao, Y.; Li, X.; Li, S.; Xie, N.; Yan, X.; Li, X.; Zhu, J. Development and application of a quadruplex real-time PCR assay for differential detection of porcine circoviruses (PCV1 to PCV4) in Jiangsu province of China from 2016 to 2020. Transbound. Emerg. Dis. 2020, 68, 1615–1624. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, V.-G.; Do, H.-Q.; Huynh, T.-M.-L.; Park, Y.-H.; Park, B.-K.; Chung, H.-C. Molecular based detection, genetic characterization and phylogenetic analysis of porcine circovirus 4 from Korean domestic swine farms. Transbound. Emerg. Dis. 2021, 69, 538–548. [Google Scholar] [CrossRef]
- Hou, C.-Y.; Zhang, L.-H.; Zhang, Y.-H.; Cui, J.-T.; Zhao, L.; Zheng, L.-L.; Chen, H.-Y. Phylogenetic analysis of porcine circoviruses 4 in Henan Province of China: A retrospective study from 2011 to 2021. Transbound. Emerg. Dis. 2021, 68, 1–12. [Google Scholar] [CrossRef]
- Franzo, G.; Ruiz, A.; Grassi, L.; Sibila, M.; Drigo, M.; Segalés, J. Lack of Porcine circovirus 4 Genome Detection in Pig Samples from Italy and Spain. Pathogens 2020, 9, 433. [Google Scholar] [CrossRef]
- Yang, K.; Jiao, Z.; Zhou, D.; Guo, R.; Duan, Z.; Tian, Y. Development of a multiplex PCR to detect and discriminate porcine circoviruses in clinical specimens. BMC Infect. Dis. 2019, 19, 778. [Google Scholar] [CrossRef]
- Oliver-Ferrando, S.; Segalés, J.; López-Soria, S.; Callén, A.; Merdy, O.; Joisel, F.; Sibila, M. Evaluation of natural porcine circovirus type 2 (PCV2) subclinical infection and seroconversion dynamics in piglets vaccinated at different ages. Vet. Res. 2016, 47, 121. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]


| Province | PCV3 | PCV2 | PCV4 | PCV2/PCV3 Co-Infection |
|---|---|---|---|---|
| Amazonas | 0/5 (0) * | 1/5 (20) * | 0/5 (0) * | 0/9 (0) # |
| Antioquia | 0/72 (0) | 8/72 (11.1) | 0/72 (0) | 0/9 (0) |
| Arauca | 0/17 (0) | 1/17 (5.88) | 0/17 (0) | 0/9 (0) |
| Atlántico | 1/7 (14.2) | 2/7 (28.5) | 0/7 (0) | 1/9 (11.1) |
| Boyacá | 0/38 (0) | 2/38 (5.26) | 0/38 (0) | 0/9 (0) |
| Bolívar | 0/35 (0) | 4/35 (12.5) | 0/35 (0) | 0/9 (0) |
| Caldas | 0/16 (0) | 3/16 (18.75) | 0/16 (0) | 0/9 (0) |
| Caquetá | 0/34 (0) | 9/34 (26.4) | 0/34 (0) | 0/9 (0) |
| Casanare | 0/21 (0) | 0/21 (0) | 0/21 (0) | 0/9 (0) |
| Cauca | 2/9 (22.2) | 1/9 (11.1) | 0/9 (0) | 0/9 (0) |
| Cesar | 0/26 (0) | 0/26 (0) | 0/26 (0) | 0/9 (0) |
| Chocó | 0/2 (0) | 0/2 (0) | 0/2 (0) | 0/9 (0) |
| Córdoba | 2/80 (2.5) | 4/80 (5) | 0/80 (0) | 0/9 (0) |
| Cundinamarca | 2/49 (4) | 13/49 (26.5) | 0/49 (0) | 0/9 (0) |
| Guainía | 0/5 (0) | 0/5(0) | 0/5 (0) | 0/9 (0) |
| Guajira | 0/20 (0) | 3/20 (15) | 0/20 (0) | 0/9 (0) |
| Guaviare | 0/5 (0) | 0/5 (0) | 0/5 (0) | 0/9 (0) |
| Huila | 0/26 (0) | 0/26 (0) | 0/26 (0) | 0/9 (0) |
| Magdalena | 0/22 (0) | 1/22 (4.5) | 0/26 (0) | 0/9 (0) |
| Meta | 0/2 (0) | 1/2 (50) | 0/2 (0) | 0/9 (0) |
| Nariño | 1/62 (1.61) | 1/62 (1.6) | 0/62 (0) | 0/9 (0) |
| Norte Santander | 0/72 (0) | 5/72 (6.9) | 0/72 (0) | 0/9 (0) |
| Putumayo | 0/11 (0) | 1/11 (9) | 0/11 (0) | 0/9 (0) |
| Quindío | 0/2 (0) | 0/2 (0) | 0/2 (0) | 0/9 (0) |
| Risaralda | 0/3 (0) | 1/3 (33.3) | 0/3 (0) | 0/9 (0) |
| San Andrés | 1/5 (20) | 1/5 (20) | 0/5 (0) | 0/9 (0) |
| Santander | 0/23 (0) | 0/23 (0) | 0/23 (0) | 0/9 (0) |
| Sucre | 0/32 (0) | 6/32 (18.75) | 0/32 (0) | 0/9 (0) |
| Tolima | 0/34 (0%) | 1/34 (2.9) | 0/34 (0) | 0/9 (0) |
| Valle | 0/9 (0%) | 0/9 (0) | 0/9 (0) | 0/9 (0) |
| Vaupés | 0/6 (0%) | 0/6 (0) | 0/6 (0) | 0/9 (0) |
| Vichada | 0/5 (0%) | 0/5 (0) | 0/5 (0) | 0/9 (0) |
| Total | 9/755 (1.19%) | 69/755 (9.13%) | 0/755 (0%) | 1/9 (11.1%) |
| Province | PCV3 | PCV2 | PCV4 | PCV2/PCV3 Co-Infection | ||||
|---|---|---|---|---|---|---|---|---|
| Sera Pools | Tissues § | Sera Pools | Tissues | Sera Pools | Tissues | Sera Pools | Tissues | |
| Antioquia | 3/9 (33) * | 2/2 (100) * | 0/9 (0) # | 0/2 (0) # | 0/9 (0) ¤ | 0/2 (0) ¤ | 0/47 (0) ¶ | 0/10 (0) ¶ |
| Atlántico | 14/26 (54) | 4/5 (80) | 5/26 (19) | 0/5 (0) | 0/26 (0) | 0/5 (0) | 1/47 (1.7) | 0/10 (0) |
| Cundinamarca | 13/32 (41) | 2/6 (33) | 7/32 (22) | 0/6 (0) | 0/32 (0) | 0/6 (0) | 2/47 (3.5) | 0/10 (0) |
| Risaralda | 7/24 (29) | 2/4 (50) | 0/24 (0) | 0/4 (0) | 0/24 (0) | 0/4 (0) | 0/47 (0) | 0/10 (0) |
| Valle | 10/17 (59) | 0/2 (0) | 0/17 (0) | 0/2 (0) | 017 (0) | 0/2 (0) | 0/47 (0) | 0/10 (0) |
| Total | 47/108 (43.5%) | 10/19 (52.6%) | 12/108 (11.11%) | 0/19 (0%) | 0/108 (0%) | 0/19 (0%) | 3/47 (6.38%) | 0/10 (0%) |
| Period A (2015–2016) | Period B (2018–2019) | |
|---|---|---|
| Geographical origin of the samples | All provinces of the country (n = 32) | Provinces with the highest pork production (n = 5) |
| Type of samples | Stool samples (n = 3875)/pools of 5 (n = 775) | Blood samples (n = 540)/pools of 5 (n = 108) Reproductive tissues * (n = 19) |
| Total samples | n = 775 | n = 127 |
| Primer Name | Sequence 5′-3′ | Product Size | Reference |
|---|---|---|---|
| PCV2F PCV2R | CACATCGAGAAAGCGAAAGGAAC TGCGGGCCAAAAAAGGTACAGTT | 505 bp | [59] |
| PCV3F PCV3R | CCACAGAAGGCGCTATGTC CCGCATAAGGGTCGTCTTG | 340 bp | [13] |
| PCV4F PCV4R | GTTTTTCCCTTCCCCCACATAG ACAGATGCCAATCAGATCTAGGTAC | 391 bp | [53] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vargas-Bermudez, D.S.; Mogollón, J.D.; Jaime, J. The Prevalence and Genetic Diversity of PCV3 and PCV2 in Colombia and PCV4 Survey during 2015–2016 and 2018–2019. Pathogens 2022, 11, 633. https://doi.org/10.3390/pathogens11060633
Vargas-Bermudez DS, Mogollón JD, Jaime J. The Prevalence and Genetic Diversity of PCV3 and PCV2 in Colombia and PCV4 Survey during 2015–2016 and 2018–2019. Pathogens. 2022; 11(6):633. https://doi.org/10.3390/pathogens11060633
Chicago/Turabian StyleVargas-Bermudez, Diana S., José Darío Mogollón, and Jairo Jaime. 2022. "The Prevalence and Genetic Diversity of PCV3 and PCV2 in Colombia and PCV4 Survey during 2015–2016 and 2018–2019" Pathogens 11, no. 6: 633. https://doi.org/10.3390/pathogens11060633
APA StyleVargas-Bermudez, D. S., Mogollón, J. D., & Jaime, J. (2022). The Prevalence and Genetic Diversity of PCV3 and PCV2 in Colombia and PCV4 Survey during 2015–2016 and 2018–2019. Pathogens, 11(6), 633. https://doi.org/10.3390/pathogens11060633

