Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border
Abstract
:1. Introduction
2. Results
2.1. Identification of Tick Species
2.2. Detection and Characterization of Rickettsia
2.3. Detection and Characterization of Anaplasmataceae
2.4. Detection and Characterization of Apicomplexa
2.5. Coinfection
3. Discussion
4. Materials and Methods
Organisms | Gene | Primer Name | Expected Size (bp) | Sequence (5′-3′) | Reference |
---|---|---|---|---|---|
Rickettsia | gltA | gltA_Fc gltA_Rc | 580 | CGAACTTACCGCTATTAGAATG CTTTAAGAGCGATAGCTTCAAG | [62] |
ompA | Rr.190.70p Rr.190.602n | 530 | ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT | [65] | |
ompB | 120_3599 120_2788 | 816 | TACTTCCGGTTACAGCAAAGT AAACAATAATCAAGGTACTGT | [66] | |
sca4 | D1f D928r | 928 | ATGAGTAAAGACGGTAACCT AAGCTATTGCGTCATCTCCG | [67] | |
htrA | 17K_3 17K_5 | 552 | TGTCTATCAATTCACAACTTGCC GCTTTACAAAATTCTAAAAACCATATA | [68] | |
Anaplasmataceae | 16S rDNA | EHR16SD EHR16SR | 345 | GGTACCYACAGAAGAAGTCC TAGCACTCATCGTTTACAGC | [63] |
Babesia-Theileria-Hepatozoon | 18S rDNA | BTH-1F BTH-1R | 690 | CCTGMGARACGGCTACCACATCT TTGCGACCATACTCCCCCCA | [64] |
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- de la Fuente, J.; Estrada-Pena, A.; Venzal, J.M.; Kocan, K.M.; Sonenshine, D.E. Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Front. Biosci. 2008, 13, 6938–6946. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Otranto, D.; Dantas-Torres, F.; Giannelli, A.; Latrofa, M.; Cascio, A.; Cazzin, S.; Ravagnan, S.; Montarsi, F.; Zanzani, S.; Manfredi, M.; et al. Ticks infesting humans in Italy and associated pathogens. Parasites Vectors 2014, 7, 328. [Google Scholar] [CrossRef] [Green Version]
- Kernif, T.; Leulmi, H.; Raoult, D.; Parola, P. Emerging Tick-Borne Bacterial Pathogens. Microbiol. Spectr. 2016, 4, 295–310. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.; Nakao, R.; Hang’ombe, B.M.; Sato, K.; Kajihara, M.; Kanchela, S.; Changula, K.; Eto, Y.; Ndebe, J.; Sasaki, M.; et al. Human Borreliosis Caused by a New World Relapsing Fever Borrelia-like Organism in the Old World. Clin. Infect. Dis. 2019, 69, 107–112. [Google Scholar] [CrossRef] [PubMed]
- Raoult, D.; Roux, V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin. Microbiol. Rev. 1997, 10, 694–719. [Google Scholar] [CrossRef]
- Parola, P.; Raoult, D. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef]
- Renvoisé, A.; Mediannikov, O.; Raoult, D. Old and new tick-borne rickettsioses. Int. Health 2009, 1, 17–25. [Google Scholar] [CrossRef]
- Uchida, T.; Uchiyama, T.; Kumano, K.; Walker, D.H. Rickettsia japonica sp. nov., the etiological agent of spotted fever group rickettsiosis in Japan. Int. J. Syst. Bacteriol. 1992, 42, 303–305. [Google Scholar] [CrossRef]
- Lu, Q.; Yu, J.; Yu, L.; Zhang, Y.; Chen, Y.; Lin, M.; Fang, X. Rickettsia japonica Infections in Humans, Zhejiang Province, China, 2015. Emerg. Infect. Dis. 2018, 24, 2077–2079. [Google Scholar] [CrossRef] [Green Version]
- Paddock, C.D.; Sumner, J.W.; Comer, J.A.; Zaki, S.R.; Goldsmith, C.S.; Goddard, J.; McLellan, S.L.F.; Tamminga, C.L.; Ohl, C.A. Rickettsia parkeri: A newly recognized cause of spotted fever rickettsiosis in the United States. Clin. Infect. Dis. 2004, 38, 805–811. [Google Scholar] [CrossRef] [Green Version]
- Kelly, P.J.; Beati, L.; Mason, P.R.; Matthewman, L.A.; Roux, V.; Raoult, D. Rickettsia africae sp. nov., the etiological agent of African tick bite fever. Int. J. Syst. Bacteriol. 1996, 46, 611–614. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.M.; Dumler, J.S.; Bakken, J.S.; Walker, D.H. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 1994, 32, 589–595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mtshali, K.; Khumalo, Z.; Nakao, R.; Grab, D.J.; Sugimoto, C.; Thekisoe, O. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces. J. Vet. Med. Sci. 2016, 77, 1573–1579. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woldehiwet, Z. Anaplasma phagocytophilum in ruminants in Europe. Ann. N. Y. Acad. Sci. 2006, 1078, 446–460. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.; Kaneko, C.; Kajihara, M.; Ngonda, S.; Simulundu, E.; Muleya, W.; Thu, M.J.; Hang’Ombe, M.B.; Katakura, K.; Takada, A.; et al. Tick-borne haemoparasites and Anaplasmataceae in domestic dogs in Zambia. Ticks Tick Borne Dis. 2018, 9, 988–995. [Google Scholar] [CrossRef] [Green Version]
- Arraga-Alvarado, C.M.; Qurollo, B.A.; Parra, O.C.; Berrueta, M.A.; Hegarty, B.C.; Breitschwerdt, E.B. Molecular Evidence of Anaplasma platys Infection in Two Women from Venezuela. Am. J. Trop. Med. Hyg. 2014, 91, 1161–1165. [Google Scholar] [CrossRef]
- Maggi, R.G.; Mascarelli, P.E.; Havenga, L.N.; Naidoo, V.; Breitschwerdt, E.B. Co-infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasites Vectors 2013, 6, 103. [Google Scholar] [CrossRef] [Green Version]
- Vannier, E.G.; Diuk-Wasser, M.A.; Ben Mamoun, C.; Krause, P.J. Babesiosis. Infect. Dis. Clin. N. Am. 2015, 29, 357–370. [Google Scholar] [CrossRef] [Green Version]
- Solano-Gallego, L.; Baneth, G. Babesiosis in dogs and cats—Expanding parasitological and clinical spectra. Vet. Parasitol. 2011, 181, 48–60. [Google Scholar] [CrossRef]
- Alonso, M.; Arellano-Sota, C.; Cereser, V.H.; Cordoves, C.O.; Guglielmone, A.A.; Kessler, R.; Mangold, A.J.; Nari, A.; Patarroyo, J.H.; Solari, M.A.; et al. Epidemiology of bovine anaplasmosis and babesiosis in Latin America and the Caribbean. Rev. Sci. Tech. 1992, 11, 713–733. [Google Scholar] [CrossRef] [Green Version]
- Chauvin, A.; Moreau, E.; Bonnet, S.; Plantard, O.; Malandrin, L. Babesia and its hosts: Adaptation to long-lasting interactions as a way to achieve efficient transmission. Vet. Res. 2009, 40, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bishop, R.; Musoke, A.; Morzaria, S.; Gardner, M.; Nene, V. Theileria: Intracellular protozoan parasites of wild and domestic ruminants transmitted by ixodid ticks. Parasitology 2004, 129, S271–S283. [Google Scholar] [CrossRef] [PubMed]
- Bishop, R.P.; Odongo, D.; Ahmed, J.; Mwamuye, M.; Fry, L.M.; Knowles, D.P.; Nanteza, A.; Lubega, G.; Gwakisa, P.; Clausen, P.H.; et al. A review of recent research on Theileria parva: Implications for the infection and treatment vaccination method for control of East Coast fever. Transbound. Emerg. Dis. 2020, 67, 56–67. [Google Scholar] [CrossRef] [PubMed]
- Baneth, G.; Barta, J.R.; Shkap, V.; Martin, D.S.; Macintire, D.K.; Vincent-Johnson, N. Genetic and Antigenic Evidence Supports the Separation of Hepatozoon canis and Hepatozoon americanum at the Species Level. J. Clin. Microbiol. 2000, 38, 1298–1301. [Google Scholar] [CrossRef] [Green Version]
- Moonga, L.C.; Hayashida, K.; Nakao, R.; Lisulo, M.; Kaneko, C.; Nakamura, I.; Eshita, Y.; Mweene, A.S.; Namangala, B.; Sugimoto, C.; et al. Molecular detection of Rickettsia felis in dogs, rodents and cat fleas in Zambia. Parasites Vectors 2019, 12, 168. [Google Scholar] [CrossRef] [Green Version]
- Qiu, Y.; Simuunza, M.; Kajihara, M.; Chambaro, H.; Harima, H.; Eto, Y.; Simulundu, E.; Squarre, D.; Torii, S.; Takada, A.; et al. Screening of tick-borne pathogens in argasid ticks in Zambia: Expansion of the geographic distribution of Rickettsia lusitaniae and Rickettsia hoogstraalii and detection of putative novel Anaplasma species. Ticks Tick Borne Dis. 2021, 12, 101720. [Google Scholar] [CrossRef]
- Qiu, Y.; Nakao, R.; Namangala, B.; Sugimoto, C. First Genetic Detection of Coxiella burnetii in Zambian Livestock. Am. J. Trop. Med. Hyg. 2013, 89, 518–519. [Google Scholar] [CrossRef] [Green Version]
- Qiu, Y.; Squarre, D.; Nakamura, Y.; Lau, A.C.C.; Moonga, L.C.; Kawai, N.; Ohnuma, A.; Hayashida, K.; Nakao, R.; Yamagishi, J.; et al. Evidence of Borrelia theileri in Wild and Domestic Animals in the Kafue Ecosystem of Zambia. Microorganisms 2021, 9, 2405. [Google Scholar] [CrossRef]
- Vlahakis, P.A.; Chitanga, S.; Simuunza, M.C.; Simulundu, E.; Qiu, Y.; Changula, K.; Chambaro, H.M.; Kajihara, M.; Nakao, R.; Takada, A.; et al. Molecular detection and characterization of zoonotic Anaplasma species in domestic dogs in Lusaka, Zambia. Ticks Tick Borne Dis. 2018, 9, 39–43. [Google Scholar] [CrossRef]
- Muleya, W.; Namangala, B.; Simuunza, M.; Nakao, R.; Inoue, N.; Kimura, T.; Ito, K.; Sugimoto, C.; Sawa, H. Population genetic analysis and sub-structuring of Theileria parva in the northern and eastern parts of Zambia. Parasites Vectors 2012, 5, 255. [Google Scholar] [CrossRef] [Green Version]
- Barradas, P.F.; Mesquita, J.R.; Ferreira, P.; Gärtner, F.; Carvalho, M.; Inácio, E.; Chivinda, E.; Katimba, A.; Amorim, I. Molecular identification and characterization of Rickettsia spp. and other tick-borne pathogens in cattle and their ticks from Huambo, Angola. Ticks Tick Borne Dis. 2021, 12, 101583. [Google Scholar] [CrossRef] [PubMed]
- Kubelová, M.; Mazancová, J.; Široký, P. Theileria, Babesia, and Anaplasma detected by PCR in ruminant herds at Bié Province, Angola. Parasite 2012, 19, 417–422. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jensenius, M.; Fournier, P.-E.; Kelly, P.; Myrvang, B.; Raoult, D. African tick bite fever. Lancet Infect. Dis. 2003, 3, 557–564. [Google Scholar] [CrossRef]
- Demoncheaux, J.-P.; Socolovschi, C.; Davoust, B.; Haddad, S.; Raoult, D.; Parola, P. First detection of Rickettsia aeschlimannii in Hyalomma dromedarii ticks from Tunisia. Ticks Tick Borne Dis. 2012, 3, 398–402. [Google Scholar] [CrossRef]
- Chitanga, S.; Chambaro, H.M.; Moonga, L.C.; Hayashida, K.; Yamagishi, J.; Muleya, W.; Changula, K.; Mubemba, B.; Simbotwe, M.; Squarre, D.; et al. Rickettsia lusitaniae in Ornithodoros porcinus Ticks, Zambia. Pathogens 2021, 10, 1306. [Google Scholar] [CrossRef]
- Nakayima, J.; Hayashida, K.; Nakao, R.; Ishii, A.; Ogawa, H.; Nakamura, I.; Moonga, L.; Hang’Ombe, B.M.; Mweene, A.S.; Thomas, Y.; et al. Detection and characterization of zoonotic pathogens of free-ranging non-human primates from Zambia. Parasites Vectors 2014, 7, 490. [Google Scholar] [CrossRef]
- Chitimia-Dobler, L.; Dobler, G.; Schaper, S.; Küpper, T.; Kattner, S.; Wölfel, S. First detection of Rickettsia conorii sp. caspia in Rhipicephalus sanguineus in Zambia. Parasitol. Res. 2017, 116, 3249–3251. [Google Scholar] [CrossRef]
- Moonga, L.C.; Hayashida, K.; Mulunda, N.R.; Nakamura, Y.; Chipeta, J.; Moonga, H.B.; Namangala, B.; Sugimoto, C.; Mtonga, Z.; Mutengo, M.; et al. Molecular Detection and Characterization of Rickettsia asembonensis in Human Blood, Zambia. Emerg. Infect. Dis. 2021, 27, 2237–2239. [Google Scholar] [CrossRef]
- Chitanga, S.; Chibesa, K.; Sichibalo, K.; Mubemba, B.; Nalubamba, K.S.; Muleya, W.; Changula, K.; Simulundu, E. Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks Collected from Cattle in Southern Zambia. Front. Vet. Sci. 2021, 8, 684487. [Google Scholar] [CrossRef]
- Aguiar, D.M.; Ziliani, T.F.; Zhang, X.; Melo, A.L.T.; Braga, Í.A.; Witter, R.; Freitas, L.C.; Rondelli, A.L.H.; Luis, M.A.; Sorte, E.C.B.; et al. A novel Ehrlichia genotype strain distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical manifestations associated with ehrlichiosis. Ticks Tick Borne Dis. 2014, 5, 537–544. [Google Scholar] [CrossRef]
- Iweriebor, B.C.; Mmbaga, E.J.; Adegborioye, A.; Igwaran, A.; Obi, L.C.; Okoh, A.I. Genetic profiling for Anaplasma and Ehrlichia species in ticks collected in the Eastern Cape Province of South Africa. BMC Microbiol. 2017, 17, 45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peter, S.G.; Aboge, G.O.; Kariuki, H.W.; Kanduma, E.G.; Gakuya, D.W.; Maingi, N.; Mulei, C.M.; Mainga, A.O. Molecular prevalence of emerging Anaplasma and Ehrlichia pathogens in apparently healthy dairy cattle in peri-urban Nairobi, Kenya. BMC Vet. Res. 2020, 16, 364. [Google Scholar] [CrossRef] [PubMed]
- Hailemariam, Z.; Krücken, J.; Baumann, M.; Ahmed, J.S.; Clausen, P.-H.; Nijhof, A.M. Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia. PLoS ONE 2017, 12, e0188248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cabezas-Cruz, A.; Zweygarth, E.; Vancová, M.; Broniszewska, M.; Grubhoffer, L.; Passos, L.M.F.; Ribeiro, M.F.B.; Alberdi, P.; de la Fuente, J. Ehrlichia minasensis sp. nov., isolated from the tick Rhipicephalus microplus. Int. J. Syst. Evol. Microbiol. 2016, 66, 1426–1430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carvalho, I.T.S.; Melo, A.L.T.; Freitas, L.C.; Verçoza, R.V.; Alves, A.S.; Costa, J.S.; Chitarra, C.S.; Nakazato, L.; Dutra, V.; Pacheco, R.C.; et al. Minimum infection rate of Ehrlichia minasensis in Rhipicephalus microplus and Amblyomma sculptum ticks in Brazil. Ticks Tick Borne Dis. 2016, 7, 849–852. [Google Scholar] [CrossRef] [PubMed]
- Cicculli, V.; Masse, S.; Capai, L.; de Lamballerie, X.; Charrel, R.; Falchi, A. First detection of Ehrlichia minasensis in Hyalomma marginatum ticks collected from cattle in Corsica, France. Vet. Med. Sci. 2019, 5, 243–248. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Liu, X.; Mu, J.; Yu, X.; Fei, Y.; Chang, J.; Bi, Y.; Zhou, Y.; Ding, Z.; Yin, R. Emergence of a Novel Ehrlichia minasensis Strain, Harboring the Major Immunogenic Glycoprotein trp36 with Unique Tandem Repeat and C-Terminal Region Sequences, in Haemaphysalis hystricis Ticks Removed from Free-Ranging Sheep in Hainan Province, China. Microorganisms 2019, 7, 369. [Google Scholar] [CrossRef] [Green Version]
- Sassera, D.; Beninati, T.; Bandi, C.; Bouman, E.A.P.; Sacchi, L.; Fabbi, M.; Lo, N. ‘Candidatus Midichloria mitochondrii’, an endosymbiont of the tick Ixodes ricinus with a unique intramitochondrial lifestyle. Int. J. Syst. Evol. Microbiol. 2006, 56, 2535–2540. [Google Scholar] [CrossRef]
- Williams-Newkirk, A.J.; Rowe, L.A.; Mixson-Hayden, T.R.; Dasch, G.A. Presence, genetic variability, and potential significance of “Candidatus Midichloria mitochondrii” in the lone star tick Amblyomma americanum. Exp. Appl. Acarol. 2012, 58, 291–300. [Google Scholar] [CrossRef] [Green Version]
- Di Lecce, I.; Bazzocchi, C.; Cecere, J.G.; Epis, S.; Sassera, D.; Villani, B.M.; Bazzi, G.; Negri, A.; Saino, N.; Spina, F.; et al. Patterns of Midichloria infection in avian-borne African ticks and their trans-Saharan migratory hosts. Parasites Vectors 2018, 11, 106. [Google Scholar] [CrossRef] [Green Version]
- Harrus, S.; Perlman-Avrahami, A.; Mumcuoglu, K.Y.; Morick, D.; Eyal, O.; Baneth, G. Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel. Clin. Microbiol. Infect. 2011, 17, 459–463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khoo, J.J.; Husin, N.A.; Lim, F.S.; Oslan, S.N.H.; Mohd Azami, S.N.I.; To, S.W.; Abd Majid, M.A.; Lee, H.Y.; Loong, S.K.; Khor, C.S.; et al. Molecular detection of pathogens from ectoparasites recovered from peri-domestic animals, and the first description of a Candidatus Midichloria sp. from Haemaphysalis wellingtoni from rural communities in Malaysia. Parasitol. Int. 2021, 80, 102202. [Google Scholar] [CrossRef] [PubMed]
- Barraza-Guerrero, S.I.; Meza-Herrera, C.A.; García-De La Peña, C.; González-Álvarez, V.H.; Vaca-Paniagua, F.; Díaz-Velásquez, C.E.; Sánchez-Tortosa, F.; Ávila-Rodríguez, V.; Valenzuela-Núñez, L.M.; Herrera-Salazar, J.C. General Microbiota of the Soft Tick Ornithodoros turicata Parasitizing the Bolson Tortoise (Gopherus flavomarginatus) in the Mapimi Biosphere Reserve, Mexico. Biology 2020, 9, 275. [Google Scholar] [CrossRef]
- Olivieri, E.; Epis, S.; Castelli, M.; Varotto Boccazzi, I.; Romeo, C.; Desiro, A.; Bazzocchi, C.; Bandi, C.; Sassera, D. Tissue tropism and metabolic pathways of Midichloria mitochondrii suggest tissue-specific functions in the symbiosis with Ixodes ricinus. Ticks Tick Borne Dis. 2019, 10, 1070–1077. [Google Scholar] [CrossRef] [PubMed]
- Tembo, S.; Collins, N.E.; Sibeko-Matjila, K.P.; Troskie, M.; Vorster, I.; Byaruhanga, C.; Oosthuizen, M.C. Occurrence of tick-borne haemoparasites in cattle in the Mungwi District, Northern Province, Zambia. Ticks Tick Borne Dis. 2018, 9, 707–717. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Squarre, D.; Nakamura, Y.; Hayashida, K.; Kawai, N.; Chambaro, H.; Namangala, B.; Sugimoto, C.; Yamagishi, J. Investigation of the piroplasm diversity circulating in wildlife and cattle of the greater Kafue ecosystem, Zambia. Parasites Vectors 2020, 13, 599. [Google Scholar] [CrossRef] [PubMed]
- Tomassone, L.; Pagani, P.; De Meneghi, D. Detection of Babesia caballi in Amblyomma variegatum ticks (Acari: Ixodidae) collected from cattle in the Republic of Guinea. Parassitologia 2005, 47, 247–251. [Google Scholar]
- Deem, S.L. A review of heartwater and the threat of introduction of Cowdria ruminantium and Amblyomma spp. ticks to the American mainland. J. Zoo Wildl. Med. 1998, 29, 109–113. [Google Scholar]
- Barre, N.; Garris, G.; Camus, E. Propagation of the tick Amblyomma variegatum in the Caribbean. Rev. Sci. Tech. 1995, 14, 841–855. [Google Scholar] [CrossRef] [Green Version]
- Baneth, G.; Mathew, J.S.; Shkap, V.; Macintire, D.K.; Barta, J.R.; Ewing, S.A. Canine hepatozoonosis: Two disease syndromes caused by separate Hepatozoon spp. Trends Parasitol. 2003, 19, 27–31. [Google Scholar] [CrossRef]
- Walker, A.R.; Bouattour, A.; Camicas, J.L.; Estrada-Peña, A.; Horak, I.G.; Latif, A.A.; Pegram, R.G.; Preston, P.M. Ticks of Domestic Animals in Africa: A Guide to Identification of Species, 2nd ed.; Bioscience Reports: Edinburgh, UK, 2014. [Google Scholar]
- Gaowa, N.O.; Minami Aochi, W.; Dongxing Wu, Y.Y.; Fumihiko Kawamori, T.H.; Hiromi Fujita, N.T.; Yosaburo Oikawa, H.K.; Shuji Ando, T.K. Rickettsiae in Ticks, Japan, 2007–2011. Emerg. Infect. Dis. 2013, 19, 338–340. [Google Scholar] [CrossRef]
- Parola, P.; Roux, V.; Camicas, J.-L.; Baradji, I.; Brouqui, P.; Raoult, D. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 707–708. [Google Scholar] [CrossRef]
- Criado-Fornelio, A.; Martinez-Marcos, A.; Buling-Saraña, A.; Barba-Carretero, J.C. Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe: Part I. Epizootiological aspects. Vet. Parasitol. 2003, 113, 189–201. [Google Scholar] [CrossRef]
- Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [Green Version]
- Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sekeyova, Z.; Roux, V.; Raoult, D. Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int. J. Syst. Evol. Microbiol. 2001, 51, 1353–1360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Labruna, M.B.; Whitworth, T.; Bouyer, D.H.; McBride, J.; Camargo, L.M.A.; Camargo, E.P.; Popov, V.; Walker, D.H. Rickettsia bellii and Rickettsia amblyommii in Amblyomma Ticks from the State of Rondônia, Western Amazon, Brazil. J. Med. Entemol. 2004, 41, 1073–1081. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
Host Species | Tick Species | Female | Male |
---|---|---|---|
Dogs | Amblyomma variegatum | 0 | 2 |
Rhipicephalus lunulatus | 12 | 19 | |
R. sanguineus | 10 | 13 | |
Rhipicephalus spp. | 0 | 3 | |
Cattle | A. pomposum | 0 | 1 |
A. variegatum | 7 | 36 | |
Hyalomma marginatum | 1 | 0 | |
H. truncatum | 14 | 34 | |
R. appendiculatus | 3 | 0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qiu, Y.; Simuunza, M.; Kajihara, M.; Ndebe, J.; Saasa, N.; Kapila, P.; Furumoto, H.; Lau, A.C.C.; Nakao, R.; Takada, A.; et al. Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border. Pathogens 2022, 11, 566. https://doi.org/10.3390/pathogens11050566
Qiu Y, Simuunza M, Kajihara M, Ndebe J, Saasa N, Kapila P, Furumoto H, Lau ACC, Nakao R, Takada A, et al. Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border. Pathogens. 2022; 11(5):566. https://doi.org/10.3390/pathogens11050566
Chicago/Turabian StyleQiu, Yongjin, Martin Simuunza, Masahiro Kajihara, Joseph Ndebe, Ngonda Saasa, Penjani Kapila, Hayato Furumoto, Alice C. C. Lau, Ryo Nakao, Ayato Takada, and et al. 2022. "Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border" Pathogens 11, no. 5: 566. https://doi.org/10.3390/pathogens11050566
APA StyleQiu, Y., Simuunza, M., Kajihara, M., Ndebe, J., Saasa, N., Kapila, P., Furumoto, H., Lau, A. C. C., Nakao, R., Takada, A., & Sawa, H. (2022). Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border. Pathogens, 11(5), 566. https://doi.org/10.3390/pathogens11050566