Next Article in Journal
Prevention of HBV Reactivation in Hemato-Oncologic Setting during COVID-19
Next Article in Special Issue
Detection of Ticks and Tick-Borne Pathogens of Urban Stray Dogs in South Africa
Previous Article in Journal
Simplifying Schistosome Surveillance: Using Molecular Cercariometry to Detect and Quantify Cercariae in Water
Previous Article in Special Issue
Molecular Detection and Genetic Diversity of Tick-Borne Pathogens in Goats from the Southern Part of Thailand
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border

1
Division of International Research Promotion, International Institute for Zoonosis Control, Hokkaido University, N 20 W 10, Kita-ku, Sapporo 001-0020, Japan
2
Department of Disease Control, School of Veterinary Medicine, The University of Zambia, P.O. Box 32379, Lusaka 10101, Zambia
3
Division of Global Epidemiology, International Institute for Zoonosis Control, Hokkaido University, N 20 W 10, Kita-ku, Sapporo 001-0020, Japan
4
Japan International Cooperation Agency in Zambia, P.O. Box 30027, Lusaka 10101, Zambia
5
Laboratory of Wildlife Biology and Medicine, Department of Environmental Veterinary Sciences, Faculty of Veterinary Medicine, Hokkaido University, N 18 W 9, Kita-ku, Sapporo 060-0818, Japan
6
Laboratory of Parasitology, Department of Disease Control, Faculty of Veterinary Medicine, Hokkaido University, N 18 W 9, Kita-ku, Sapporo 060-0818, Japan
7
International Collaboration Unit, International Institute for Zoonosis Control, Hokkaido University, N 20 W 10, Kita-ku, Sapporo 001-0020, Japan
8
One Health Research Center, Hokkaido University, N 20 W 10, Kita-ku, Sapporo 001-0020, Japan
9
Division of Molecular Pathobiology, International Institute for Zoonosis Control, Hokkaido University, N 20 W 10, Kita-ku, Sapporo 001-0020, Japan
*
Author to whom correspondence should be addressed.
Pathogens 2022, 11(5), 566; https://doi.org/10.3390/pathogens11050566
Submission received: 24 March 2022 / Revised: 30 April 2022 / Accepted: 8 May 2022 / Published: 10 May 2022

Abstract

Tick-borne diseases (TBDs), including emerging and re-emerging zoonoses, are of public health importance worldwide; however, TBDs tend to be overlooked, especially in countries with fewer resources, such as Zambia and Angola. Here, we investigated Rickettsia, Anaplasmataceae, and Apicomplexan pathogens in 59 and 96 adult ticks collected from dogs and cattle, respectively, in Shangombo, a town at the Zambia–Angola border. We detected Richkettsia africae and Rickettsia aeschilimannii in 15.6% of Amblyomma variegatum and 41.7% of Hyalomma truncatum ticks, respectively. Ehrlichia minasensis was detected in 18.8% of H. truncatum, and Candidatus Midichloria mitochondrii was determined in Hyalomma marginatum. We also detected Babesia caballi and Theileria velifera in A. variegatum ticks with a 4.4% and 6.7% prevalence, respectively. In addition, Hepatozoon canis was detected in 6.5% of Rhipicephalus lunulatus and 4.3% of Rhipicephalus sanguineus. Coinfection of R. aeshilimannii and E. minasensis were observed in 4.2% of H. truncatum. This is the first report of Ca. M. mitochondrii and E. minasensis, and the second report of B. caballi, in the country. Rickettsia africae and R. aeschlimannii are pathogenic to humans, and E. minasensis, B. caballi, T. velifera, and H. canis are pathogenic to animals. Therefore, individuals, clinicians, veterinarians, and pet owners should be aware of the distribution of these pathogens in the area.

1. Introduction

Ticks are important blood-sucking arthropods in medical and veterinary science, second to mosquitos. They not only cause anemia in their hosts, but also carry and transmit a broad range of viruses, bacteria, and protozoa. Some of these microorganisms cause tick-borne diseases (TBDs), which include emerging and re-emerging infectious diseases [1,2]. To date, TBDs have been considered a focal point for human and animal health worldwide. The identification of novel viral and bacterial TBD-causing agents has increased in recent times [3]. An example of emerging TBD agents is Borrelia fainii, which was first isolated from a febrile patient in Zambia in 2019 [4]. Ornithodoros faini ticks and Rousettus aegyptiacus bats are considered as a vector and natural reservoir of Borrelia fainii, respectively [4]; however, TBDs tend to be overlooked, especially in low-resource countries, because of limitations in diagnostic infrastructure.
Tick-borne bacterial pathogens include Rickettsia, Anaplasma, Ehrlichia, Coxiella, Orientia, and Borrelia. Among them, Rickettsia are obligate intracellular Gram-negative bacteria, and are recognized as the causative agents of important emerging TBDs [5,6]. The symptoms of human rickettsiosis include chills, high fever, headache, skin rash, and photophobia [7]. Species of the agents of human rickettsiosis differ region-wise. For example, R. japonica causes Japanese spotted fever prevalent in East Asia, R. parkeri causes American Boutonneuse Fever in the USA, and R. africae causes African tick bite fever in Africa [8,9,10,11]. Furthermore, Anaplasma and Ehrlichia are obligate intracellular bacteria belonging to the family Anaplasmataceae. Some of these bacteria cause TBDs in humans and animals. For example, A. phagocytophilum causes human granulocytic anaplasmosis and has been reported worldwide, including in Africa [12,13,14]. Anaplasma platys has primarily been isolated from dogs with cyclic thrombocytopenia; it has also been reported in Africa [15]. Importantly, human infection with A. platys has also been reported in Venezuela and South Africa [16,17].
The common tick-borne protozoan pathogens are members of the phylum Apicomplexa and belong to the genera Babesia, Theileria, and Hepatozoon. Babesia microti, B. divergens, B. venatorum, and B. duncani are the major etiological agents of human babesiosis. Most human cases of babesiosis have been reported in the USA, but this disease has also been reported in Asia, Africa, Australia, Europe, and South America [18]. Babesia gibsoni, B. canis, B. rossi, and B. vogeli are widely known as causative agents of canine babesiosis [19]. Babesia bigemina and B. bovis are agents of bovine babesiosis [20,21]. Theileria species, particularly T. annulata and T. parva, have caused the most significant economic losses in livestock production worldwide. Theileria annulata causes tropical theileriosis in several tropical regions in southern Europe, northern Africa, and Asia [22]. Conversely, T. parva causes East Coast fever, which is distributed in the eastern, central, and southern parts of Africa [23]. Hepatozoon canis and H. americanum have been reported to cause canine and feline hepatozoonoses worldwide, which are the most common and important tick-borne hepatozoonoses [24].
Studies on tick-borne pathogens in Zambia, such as Rickettsia, Anaplasmataceae, and Apicomplexa, have primarily been conducted in the southern, central, and eastern parts of the country [15,25,26,27,28,29,30,31]. Angola is a neighboring country and shares borders with the western region of Zambia. A few studies on tick-borne pathogens have also been reported in Angola, primarily in the central and western regions [31,32]. Geographically, wildlife can easily pass through the Zambia–Angola border, and ticks might be attached to the bodies of animals during transit. Therefore, the investigation of ticks and tick-borne pathogens in the Zambia–Angola border may provide valuable information for a better understanding of the distribution of TBDs in western Zambia and eastern Angola. In this study, we performed the molecular-level screening and characterization of Rickettsia, Anaplasmataceae, and Apicomplexa detected from ticks in Shangombo at the Zambia–Angola border.

2. Results

2.1. Identification of Tick Species

Overall, we collected 59 and 96 adult ticks infesting dogs and cattle, respectively, in Shangombo, a town in the Zambia–Angola border region (Figure 1). Morphological identification revealed that 2 Amblyomma variegatum (males), 31 Rhipicephalus lunulatus (12 females and 19 males), 23 R. sanguineus (10 females and 13 males), and 3 Rhipicephalus spp. (males) ticks were collected from dogs, and 1 A. pomposum (male), 43 A. variegatum (7 females and 36 males), 1 Hyalomma marginatum (female), 48 H. truncatum (14 females and 34 males), and 3 R. appendiculatus (females) ticks were collected from cattle (Table 1).

2.2. Detection and Characterization of Rickettsia

Ticks infesting cattle were used for screening Rickettsia spp. using a polymerase chain reaction (PCR) targeting the gltA gene. As a result, Amblyomma variegatum (n = 7) and Hyalomma truncatum (n = 20) were positive for Rickettsia spp., representing three sequence variants. Sequence variants 1 and 2 identified from A. variegatum showed 100% identities to Rickettsia africae clones AT-11 and C10-F8-303, respectively, while sequence variant 3 identified from H. truncatum showed a 100% identity to Rickettsia aeschlimannii (Figure 2). Prevalence of R. africae in A. variegatum and R. aeschlimannii in H. truncatum were 15.6% and 41.7%, respectively.

2.3. Detection and Characterization of Anaplasmataceae

For the screening of Anaplasmatacea, 59 ticks from dogs and 96 ticks from cattle were used. Hyalomma truncatum (n = 10) and H. marginatum (n = 1) were positive for Anaplasmataceae, representing three sequence variants. Sequence variants 1 and 2 identified from H. truncatum showed 100% identities to Ehrlichia sp. and Ehrlichia minasensis, respectively, while sequence variant 3 identified from H. marginatum showed a 100% identity to Candidatus Midichloria mitochondrii (Figure 3). The prevalence of Ehrlichia sp. and E. minasensis in H. truncatum were 2% and 18.8%, respectively, while the prevalence of Ca. Midichloria mitochondrii in H. marginatum was 100%.

2.4. Detection and Characterization of Apicomplexa

The same ticks collected from dogs and cattle were used to screen Apicomplexa. As a result, Rhipicephalus lunulatus (n = 2), R. sanguineus (n = 1), and Amblyomma variegatum (n = 5) were positive for Apicomplexa, representing three sequence variants. Sequence variant 1 identified from R. lunulatus and R. sanguineus showed a 100% identity to Hepatozoon canis. Sequence variant 2 identified from three A. variegatum showed a 100% identity to Theileria velifera, while sequence variant 3 identified from two A. variegatum showed a 98.1% identity to Babesia caballi (Figure 4). The prevalence of H. canis in R. lunulatus and R. sanguineus was 6.5% and 4.3%, respectively, while the prevalence of T. verifera and B. caballi in A. variegatum was 6.7% and 4.4%, respectively.

2.5. Coinfection

Coinfections of Rickettsia aeschlimannii and Ehrlichia minasensis were observed from two Hyalomma truncatum ticks. None of the tick samples were coinfected with Apicomplexa and Rickettsia or Anaplasmataceae.

3. Discussion

We investigated the presence of Rickettsia, Anaplasmataceae, and Apicomplexa species in ticks collected from cattle and dogs in Shangombo, a town located at the border of Zambia and Angola. We identified R. africae, R. aeschlimannii, E. minasensis, Ehrlichia sp., Ca. M. mitochondrii, H. canis, T. velifera, and B. caballi. To the best of our knowledge, this is the first study to report Ca. M. mitochondrii and E. minasensis, and the second study to report B. caballi, in the country.
Rickettsia africae detected from A. variegatum in this study is widely known as a causative agent of African tick bite fever, which is one of the zoonotic tick-borne fevers from the spotted fever group of rickettsiae of emerging global health concern [33]. In addition, we also detected Rickettsia aeschlimannii from H. truncatum, which is a human pathogenic rickettsia [34]. Previous epidemiological studies on rickettsia in Zambia were conducted in the central, eastern, and southern parts of the country [25,26,35,36,37,38,39]. Thus, this study is the first evidence of pathogenic rickettsiae in the western part of the country.
Ehrlichia minasensis was first isolated from cattle in midwestern Brazil in 2014, and it was experimentally confirmed to be an agent of clinical ehrlichiosis in calves [40]. To date, E. minasensis has been reported worldwide, including in South Africa, Kenya, and Ethiopia [41,42,43]. The primary vectors of E. minasensis are Rhipicephalus microplus and other Rhipicephalus ticks, but it has also been detected in Amblyomma, Hyalomma, and Haemaphysalis ticks [44,45,46,47]. In this study, E. minasensis was detected in nine H. truncatum ticks for the first time in Zambia. Our results expanded the distribution records of E. minasensis, suggesting the likelihood of bovine ehrlichiosis caused by E. minasensis occurring in Zambia. Further investigations of E. minasensis are warranted to evaluate the current situation in the country.
Candidatus Midichloria mitochondrii is an endosymbiont of ixodid ticks, such as Ixodes ricinus, A. americanum, H. marginatum, R. turanicus, and H. wellingtoni, and has been reported worldwide [48,49,50,51,52]. Recently, it was also reported in the argasid tick, Ornithodoros turicata [53]. The role of Ca. M. mitochondrii in the host tick is speculated to enhance the host fitness and/or for ensuring its presence in the host population [54]. In this study, we provided the first evidence of Ca. M. mitochondrii in H. marginatum ticks in Zambia.
We detected Theileri velifera and Babesia caballi in A. variegatum. Theileria velifera has been associated with low pathogenic or asymptomatic animal infections in cattle in Africa. Previous studies have reported the detection of T. velifera in impalas, buffalos, and cattle in Zambia, and it has been found to show a high prevalence in cattle [55,56], while, B. caballi is a pathogenic protozoan found in horses, donkeys, and zebras. Interestingly, B. caballi was detected in A. variegatum ticks infesting cattle in the Republic of Guinea [57] and was detected in 5.3% (16/299) of cattle blood samples by a reverse line blot hybridization assay in Zambia [55], even though B. caballi is known as an equine babesia. Thus, we speculated that a genotype of B. caballi is able to infect cattle and be carried by A. variegatum; however, further studies on the B. caballi in cattle in Zambia are required to evaluate this hypothesis.
Hepatozoon canis, an agent of canine hepatozoonosis [24,58], was detected in two R. lunulatus and one R. sanguineus ticks in the present study. In addition, a previous study in the same area showed a relatively high prevalence of H. canis in dogs [15]. Therefore, Shangombo might be an endemic area of H. canis. For better vigilance, veterinarians and dog owners residing in an around Shangombo should be aware of the symptoms of canine hepatozoonosis.
Amblyomma variegatum is a three-host tick that utilizes different hosts during each life stage. The larva and nymph ticks are generally present in great numbers on small mammals and birds, such as the mongoose and cattle egret. While adult ticks utilize larger mammals, such as camels and cattle. Evidence of cattle egret playing a role in transporting the larvae and nymphs of the tick, and that the dispersal of A. variegatum is associated with the migration patterns of the bird have been reported [59,60]. Given this, as well as the detection of R. africae, T. velifera, and B. caballi in A. variegatum, these pathogens might be crossing the Zambia–Angola border.
In this study, ticks were collected from dogs and cattle. Therefore, we cannot eliminate the possibility for detecting pathogens in blood meal in ticks, which is the limitation of this study. Further study in ticks collected from pasture in the study area is required to determine the vector ticks of the detected pathogens.
In conclusion, we studied tick-borne bacterial and protozoan pathogens in Shangombo, as there is relatively limited information on tick-borne pathogens in this area. This study provided information on the presence of R. africae, R. aeschlimannii, E. minasensis, Ca. M. mitochondrii, H. canis, T. velifera, and B. caballi in the study region. The information may be helpful to researchers and individuals not only from Zambia but also from Angola for preventing TBDs. Further investigation of tick-borne pathogens in the area is necessary to evaluate the prevalence of TBDs in the area.

4. Materials and Methods

Ticks were removed using a tick twister (H3D, Lavancia, France) or forceps from dogs and cattle in Shangombo (16.32 S, 22.10 E) (Figure 1), Western province, Zambia, in January 2016. The tick species were identified based on morphological taxonomic keys using a stereomicroscope [61]. The total DNA was extracted from individual ticks using a TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions.
For screening the rickettsial infections, DNA samples from tick-infested cattle were initially tested using gltA-PCR, as previously described [62]. The gltA-PCR was performed with the primers gltA_Fc and gltA_Rc, and the 20-μL reaction mixture contained 0.1 μL Ex Taq Hot Start version (Takara Bio Inc., Shiga, Japan), 2 μL 10 × Ex Taq buffer, 1.6 μL 2.5 mM dNTP mixture, 200 nM of each primer, and 2 μL template DNA. UltraPure™ distilled water (Invitrogen) was added as a negative control instead of template DNA. The PCR products were electrophoresed in a 1.2% agarose gel stained with Gel-Red™ (Biotium, Hayward, CA, USA), and visualized with a UV trans-illuminator. When the gltA-PCR yielded a positive result, the selected samples were used for further characterization based on the sequences of four additional genes: ompA, ompB, sca4, and htrA. The primers used in this study are listed in Table 2.
For the detection and characterization of Anaplasmataceae, PCR targeting the 16S rDNA of family Anaplasmataceae was performed using the primers EHR16SD and EHR16SR [63]. The universal primer set BTH-1F and BTH-1R, targeting the 18S rRNA gene of BabesiaTheileriaHepatozoon, was used for the detection and characterization of tick-borne apicomplexans [64].
Table 2. Primers used in this study.
Table 2. Primers used in this study.
OrganismsGenePrimer NameExpected Size (bp)Sequence (5′-3′)Reference
RickettsiagltAgltA_Fc
gltA_Rc
580CGAACTTACCGCTATTAGAATG
CTTTAAGAGCGATAGCTTCAAG
[62]
ompARr.190.70p
Rr.190.602n
530ATGGCGAATATTTCTCCAAAA
AGTGCAGCATTCGCTCCCCCT
[65]
ompB120_3599
120_2788
816TACTTCCGGTTACAGCAAAGT
AAACAATAATCAAGGTACTGT
[66]
sca4D1f
D928r
928ATGAGTAAAGACGGTAACCT
AAGCTATTGCGTCATCTCCG
[67]
htrA17K_3
17K_5
552TGTCTATCAATTCACAACTTGCC
GCTTTACAAAATTCTAAAAACCATATA
[68]
Anaplasmataceae16S rDNAEHR16SD
EHR16SR
345GGTACCYACAGAAGAAGTCC
TAGCACTCATCGTTTACAGC
[63]
Babesia-Theileria-Hepatozoon18S rDNABTH-1F
BTH-1R
690CCTGMGARACGGCTACCACATCT
TTGCGACCATACTCCCCCCA
[64]
The PCR products were purified using ethanol precipitation or were cloned using the pGEM-T Easy Vector system (Promega, Southampton, Hampshire, UK) and DH5 alpha competent cells (TOYOBO, Osaka, Japan). Cycle sequencing for all amplicons was conducted using the BigDye Terminator version 3.1 chemistry (Applied Biosystems, Foster City, CA, USA). Sequencing products were run on a 3130xl Genetic Analyzer (Applied Biosystems). The DDBJ/EMBL/GenBank accession numbers obtained were LC683090 to LC683109 (See Supplementary Table S1).
Sanger sequencing data from amplified PCR products were analyzed using GENETYX version 9.1 (GENETYX Corporation, Tokyo, Japan). Phylogenetic analysis was conducted using MEGA version X [69]. The sequences were aligned with closely related sequences deposited in the databases (DDBJ/EMBL/GenBank) using ClustalW, and a maximum likelihood phylogram was applied to generate the phylogenetic trees.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/pathogens11050566/s1, Table S1: Accession numbers obtained in this study.

Author Contributions

Conceptualization, Y.Q. and R.N.; methodology, Y.Q. and R.N.; formal analysis, Y.Q. and A.C.C.L.; investigation, Y.Q.; resources, Y.Q., M.S., M.K., J.N., N.S., P.K., H.F. and R.N.; writing—original draft preparation, Y.Q.; writing—review and editing, all authors; funding acquisition, Y.Q., R.N., A.T. and H.S. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Ministry of Education, Culture, Sports, Science and Technology, Japan (MEXT)/Japan Society for the Promotion of Science (JSPS), KAKENHI grant numbers 19K15992 and 20KK0151, and the Japan Agency for Medical Research and Development (AMED), the Japan Program for Infectious Diseases Research and Infrastructure grant numbers JP21wm0125008 and JP21wm0225016. In addition, this research was also supported by the Science and Technology Research Partnership for Sustainable Development (SATREPS) (JP21jm0110019) through the Japan International Cooperation Agency (JICA) and AMED. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data are provided in the manuscript.

Acknowledgments

We thank Sakae Kashihara for the logistical arrangements of the sampling trip. We would like to express our gratitude to the staff at the School of Veterinary Medicine at the University of Zambia, the International Institute for Zoonosis Control, and the regional veterinary officer in Shangombo, for the assistance in sampling and laboratory experiments.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. de la Fuente, J.; Estrada-Pena, A.; Venzal, J.M.; Kocan, K.M.; Sonenshine, D.E. Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Front. Biosci. 2008, 13, 6938–6946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Otranto, D.; Dantas-Torres, F.; Giannelli, A.; Latrofa, M.; Cascio, A.; Cazzin, S.; Ravagnan, S.; Montarsi, F.; Zanzani, S.; Manfredi, M.; et al. Ticks infesting humans in Italy and associated pathogens. Parasites Vectors 2014, 7, 328. [Google Scholar] [CrossRef] [Scilit]
  3. Kernif, T.; Leulmi, H.; Raoult, D.; Parola, P. Emerging Tick-Borne Bacterial Pathogens. Microbiol. Spectr. 2016, 4, 295–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Qiu, Y.; Nakao, R.; Hang’ombe, B.M.; Sato, K.; Kajihara, M.; Kanchela, S.; Changula, K.; Eto, Y.; Ndebe, J.; Sasaki, M.; et al. Human Borreliosis Caused by a New World Relapsing Fever Borrelia-like Organism in the Old World. Clin. Infect. Dis. 2019, 69, 107–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Raoult, D.; Roux, V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin. Microbiol. Rev. 1997, 10, 694–719. [Google Scholar] [CrossRef]
  6. Parola, P.; Raoult, D. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [Scilit]
  7. Renvoisé, A.; Mediannikov, O.; Raoult, D. Old and new tick-borne rickettsioses. Int. Health 2009, 1, 17–25. [Google Scholar] [CrossRef] [Scilit]
  8. Uchida, T.; Uchiyama, T.; Kumano, K.; Walker, D.H. Rickettsia japonica sp. nov., the etiological agent of spotted fever group rickettsiosis in Japan. Int. J. Syst. Bacteriol. 1992, 42, 303–305. [Google Scholar] [CrossRef] [Scilit]
  9. Lu, Q.; Yu, J.; Yu, L.; Zhang, Y.; Chen, Y.; Lin, M.; Fang, X. Rickettsia japonica Infections in Humans, Zhejiang Province, China, 2015. Emerg. Infect. Dis. 2018, 24, 2077–2079. [Google Scholar] [CrossRef] [Scilit]
  10. Paddock, C.D.; Sumner, J.W.; Comer, J.A.; Zaki, S.R.; Goldsmith, C.S.; Goddard, J.; McLellan, S.L.F.; Tamminga, C.L.; Ohl, C.A. Rickettsia parkeri: A newly recognized cause of spotted fever rickettsiosis in the United States. Clin. Infect. Dis. 2004, 38, 805–811. [Google Scholar] [CrossRef] [Scilit]
  11. Kelly, P.J.; Beati, L.; Mason, P.R.; Matthewman, L.A.; Roux, V.; Raoult, D. Rickettsia africae sp. nov., the etiological agent of African tick bite fever. Int. J. Syst. Bacteriol. 1996, 46, 611–614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Chen, S.M.; Dumler, J.S.; Bakken, J.S.; Walker, D.H. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 1994, 32, 589–595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Mtshali, K.; Khumalo, Z.; Nakao, R.; Grab, D.J.; Sugimoto, C.; Thekisoe, O. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces. J. Vet. Med. Sci. 2016, 77, 1573–1579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Woldehiwet, Z. Anaplasma phagocytophilum in ruminants in Europe. Ann. N. Y. Acad. Sci. 2006, 1078, 446–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Qiu, Y.; Kaneko, C.; Kajihara, M.; Ngonda, S.; Simulundu, E.; Muleya, W.; Thu, M.J.; Hang’Ombe, M.B.; Katakura, K.; Takada, A.; et al. Tick-borne haemoparasites and Anaplasmataceae in domestic dogs in Zambia. Ticks Tick Borne Dis. 2018, 9, 988–995. [Google Scholar] [CrossRef] [Scilit]
  16. Arraga-Alvarado, C.M.; Qurollo, B.A.; Parra, O.C.; Berrueta, M.A.; Hegarty, B.C.; Breitschwerdt, E.B. Molecular Evidence of Anaplasma platys Infection in Two Women from Venezuela. Am. J. Trop. Med. Hyg. 2014, 91, 1161–1165. [Google Scholar] [CrossRef] [Scilit]
  17. Maggi, R.G.; Mascarelli, P.E.; Havenga, L.N.; Naidoo, V.; Breitschwerdt, E.B. Co-infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasites Vectors 2013, 6, 103. [Google Scholar] [CrossRef] [Scilit]
  18. Vannier, E.G.; Diuk-Wasser, M.A.; Ben Mamoun, C.; Krause, P.J. Babesiosis. Infect. Dis. Clin. N. Am. 2015, 29, 357–370. [Google Scholar] [CrossRef] [Scilit]
  19. Solano-Gallego, L.; Baneth, G. Babesiosis in dogs and cats—Expanding parasitological and clinical spectra. Vet. Parasitol. 2011, 181, 48–60. [Google Scholar] [CrossRef] [Scilit]
  20. Alonso, M.; Arellano-Sota, C.; Cereser, V.H.; Cordoves, C.O.; Guglielmone, A.A.; Kessler, R.; Mangold, A.J.; Nari, A.; Patarroyo, J.H.; Solari, M.A.; et al. Epidemiology of bovine anaplasmosis and babesiosis in Latin America and the Caribbean. Rev. Sci. Tech. 1992, 11, 713–733. [Google Scholar] [CrossRef] [Scilit]
  21. Chauvin, A.; Moreau, E.; Bonnet, S.; Plantard, O.; Malandrin, L. Babesia and its hosts: Adaptation to long-lasting interactions as a way to achieve efficient transmission. Vet. Res. 2009, 40, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Bishop, R.; Musoke, A.; Morzaria, S.; Gardner, M.; Nene, V. Theileria: Intracellular protozoan parasites of wild and domestic ruminants transmitted by ixodid ticks. Parasitology 2004, 129, S271–S283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Bishop, R.P.; Odongo, D.; Ahmed, J.; Mwamuye, M.; Fry, L.M.; Knowles, D.P.; Nanteza, A.; Lubega, G.; Gwakisa, P.; Clausen, P.H.; et al. A review of recent research on Theileria parva: Implications for the infection and treatment vaccination method for control of East Coast fever. Transbound. Emerg. Dis. 2020, 67, 56–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Baneth, G.; Barta, J.R.; Shkap, V.; Martin, D.S.; Macintire, D.K.; Vincent-Johnson, N. Genetic and Antigenic Evidence Supports the Separation of Hepatozoon canis and Hepatozoon americanum at the Species Level. J. Clin. Microbiol. 2000, 38, 1298–1301. [Google Scholar] [CrossRef] [Scilit]
  25. Moonga, L.C.; Hayashida, K.; Nakao, R.; Lisulo, M.; Kaneko, C.; Nakamura, I.; Eshita, Y.; Mweene, A.S.; Namangala, B.; Sugimoto, C.; et al. Molecular detection of Rickettsia felis in dogs, rodents and cat fleas in Zambia. Parasites Vectors 2019, 12, 168. [Google Scholar] [CrossRef] [Scilit]
  26. Qiu, Y.; Simuunza, M.; Kajihara, M.; Chambaro, H.; Harima, H.; Eto, Y.; Simulundu, E.; Squarre, D.; Torii, S.; Takada, A.; et al. Screening of tick-borne pathogens in argasid ticks in Zambia: Expansion of the geographic distribution of Rickettsia lusitaniae and Rickettsia hoogstraalii and detection of putative novel Anaplasma species. Ticks Tick Borne Dis. 2021, 12, 101720. [Google Scholar] [CrossRef] [Scilit]
  27. Qiu, Y.; Nakao, R.; Namangala, B.; Sugimoto, C. First Genetic Detection of Coxiella burnetii in Zambian Livestock. Am. J. Trop. Med. Hyg. 2013, 89, 518–519. [Google Scholar] [CrossRef] [Scilit]
  28. Qiu, Y.; Squarre, D.; Nakamura, Y.; Lau, A.C.C.; Moonga, L.C.; Kawai, N.; Ohnuma, A.; Hayashida, K.; Nakao, R.; Yamagishi, J.; et al. Evidence of Borrelia theileri in Wild and Domestic Animals in the Kafue Ecosystem of Zambia. Microorganisms 2021, 9, 2405. [Google Scholar] [CrossRef] [Scilit]
  29. Vlahakis, P.A.; Chitanga, S.; Simuunza, M.C.; Simulundu, E.; Qiu, Y.; Changula, K.; Chambaro, H.M.; Kajihara, M.; Nakao, R.; Takada, A.; et al. Molecular detection and characterization of zoonotic Anaplasma species in domestic dogs in Lusaka, Zambia. Ticks Tick Borne Dis. 2018, 9, 39–43. [Google Scholar] [CrossRef] [Scilit]
  30. Muleya, W.; Namangala, B.; Simuunza, M.; Nakao, R.; Inoue, N.; Kimura, T.; Ito, K.; Sugimoto, C.; Sawa, H. Population genetic analysis and sub-structuring of Theileria parva in the northern and eastern parts of Zambia. Parasites Vectors 2012, 5, 255. [Google Scholar] [CrossRef] [Scilit]
  31. Barradas, P.F.; Mesquita, J.R.; Ferreira, P.; Gärtner, F.; Carvalho, M.; Inácio, E.; Chivinda, E.; Katimba, A.; Amorim, I. Molecular identification and characterization of Rickettsia spp. and other tick-borne pathogens in cattle and their ticks from Huambo, Angola. Ticks Tick Borne Dis. 2021, 12, 101583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Kubelová, M.; Mazancová, J.; Široký, P. Theileria, Babesia, and Anaplasma detected by PCR in ruminant herds at Bié Province, Angola. Parasite 2012, 19, 417–422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Jensenius, M.; Fournier, P.-E.; Kelly, P.; Myrvang, B.; Raoult, D. African tick bite fever. Lancet Infect. Dis. 2003, 3, 557–564. [Google Scholar] [CrossRef] [Scilit]
  34. Demoncheaux, J.-P.; Socolovschi, C.; Davoust, B.; Haddad, S.; Raoult, D.; Parola, P. First detection of Rickettsia aeschlimannii in Hyalomma dromedarii ticks from Tunisia. Ticks Tick Borne Dis. 2012, 3, 398–402. [Google Scholar] [CrossRef] [Scilit]
  35. Chitanga, S.; Chambaro, H.M.; Moonga, L.C.; Hayashida, K.; Yamagishi, J.; Muleya, W.; Changula, K.; Mubemba, B.; Simbotwe, M.; Squarre, D.; et al. Rickettsia lusitaniae in Ornithodoros porcinus Ticks, Zambia. Pathogens 2021, 10, 1306. [Google Scholar] [CrossRef] [Scilit]
  36. Nakayima, J.; Hayashida, K.; Nakao, R.; Ishii, A.; Ogawa, H.; Nakamura, I.; Moonga, L.; Hang’Ombe, B.M.; Mweene, A.S.; Thomas, Y.; et al. Detection and characterization of zoonotic pathogens of free-ranging non-human primates from Zambia. Parasites Vectors 2014, 7, 490. [Google Scholar] [CrossRef]
  37. Chitimia-Dobler, L.; Dobler, G.; Schaper, S.; Küpper, T.; Kattner, S.; Wölfel, S. First detection of Rickettsia conorii sp. caspia in Rhipicephalus sanguineus in Zambia. Parasitol. Res. 2017, 116, 3249–3251. [Google Scholar] [CrossRef] [Scilit]
  38. Moonga, L.C.; Hayashida, K.; Mulunda, N.R.; Nakamura, Y.; Chipeta, J.; Moonga, H.B.; Namangala, B.; Sugimoto, C.; Mtonga, Z.; Mutengo, M.; et al. Molecular Detection and Characterization of Rickettsia asembonensis in Human Blood, Zambia. Emerg. Infect. Dis. 2021, 27, 2237–2239. [Google Scholar] [CrossRef] [Scilit]
  39. Chitanga, S.; Chibesa, K.; Sichibalo, K.; Mubemba, B.; Nalubamba, K.S.; Muleya, W.; Changula, K.; Simulundu, E. Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks Collected from Cattle in Southern Zambia. Front. Vet. Sci. 2021, 8, 684487. [Google Scholar] [CrossRef] [Scilit]
  40. Aguiar, D.M.; Ziliani, T.F.; Zhang, X.; Melo, A.L.T.; Braga, Í.A.; Witter, R.; Freitas, L.C.; Rondelli, A.L.H.; Luis, M.A.; Sorte, E.C.B.; et al. A novel Ehrlichia genotype strain distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical manifestations associated with ehrlichiosis. Ticks Tick Borne Dis. 2014, 5, 537–544. [Google Scholar] [CrossRef] [Scilit]
  41. Iweriebor, B.C.; Mmbaga, E.J.; Adegborioye, A.; Igwaran, A.; Obi, L.C.; Okoh, A.I. Genetic profiling for Anaplasma and Ehrlichia species in ticks collected in the Eastern Cape Province of South Africa. BMC Microbiol. 2017, 17, 45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Peter, S.G.; Aboge, G.O.; Kariuki, H.W.; Kanduma, E.G.; Gakuya, D.W.; Maingi, N.; Mulei, C.M.; Mainga, A.O. Molecular prevalence of emerging Anaplasma and Ehrlichia pathogens in apparently healthy dairy cattle in peri-urban Nairobi, Kenya. BMC Vet. Res. 2020, 16, 364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Hailemariam, Z.; Krücken, J.; Baumann, M.; Ahmed, J.S.; Clausen, P.-H.; Nijhof, A.M. Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia. PLoS ONE 2017, 12, e0188248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Cabezas-Cruz, A.; Zweygarth, E.; Vancová, M.; Broniszewska, M.; Grubhoffer, L.; Passos, L.M.F.; Ribeiro, M.F.B.; Alberdi, P.; de la Fuente, J. Ehrlichia minasensis sp. nov., isolated from the tick Rhipicephalus microplus. Int. J. Syst. Evol. Microbiol. 2016, 66, 1426–1430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Carvalho, I.T.S.; Melo, A.L.T.; Freitas, L.C.; Verçoza, R.V.; Alves, A.S.; Costa, J.S.; Chitarra, C.S.; Nakazato, L.; Dutra, V.; Pacheco, R.C.; et al. Minimum infection rate of Ehrlichia minasensis in Rhipicephalus microplus and Amblyomma sculptum ticks in Brazil. Ticks Tick Borne Dis. 2016, 7, 849–852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Cicculli, V.; Masse, S.; Capai, L.; de Lamballerie, X.; Charrel, R.; Falchi, A. First detection of Ehrlichia minasensis in Hyalomma marginatum ticks collected from cattle in Corsica, France. Vet. Med. Sci. 2019, 5, 243–248. [Google Scholar] [CrossRef] [Scilit]
  47. Li, J.; Liu, X.; Mu, J.; Yu, X.; Fei, Y.; Chang, J.; Bi, Y.; Zhou, Y.; Ding, Z.; Yin, R. Emergence of a Novel Ehrlichia minasensis Strain, Harboring the Major Immunogenic Glycoprotein trp36 with Unique Tandem Repeat and C-Terminal Region Sequences, in Haemaphysalis hystricis Ticks Removed from Free-Ranging Sheep in Hainan Province, China. Microorganisms 2019, 7, 369. [Google Scholar] [CrossRef] [Scilit]
  48. Sassera, D.; Beninati, T.; Bandi, C.; Bouman, E.A.P.; Sacchi, L.; Fabbi, M.; Lo, N. ‘Candidatus Midichloria mitochondrii’, an endosymbiont of the tick Ixodes ricinus with a unique intramitochondrial lifestyle. Int. J. Syst. Evol. Microbiol. 2006, 56, 2535–2540. [Google Scholar] [CrossRef] [Scilit]
  49. Williams-Newkirk, A.J.; Rowe, L.A.; Mixson-Hayden, T.R.; Dasch, G.A. Presence, genetic variability, and potential significance of “Candidatus Midichloria mitochondrii” in the lone star tick Amblyomma americanum. Exp. Appl. Acarol. 2012, 58, 291–300. [Google Scholar] [CrossRef] [Scilit]
  50. Di Lecce, I.; Bazzocchi, C.; Cecere, J.G.; Epis, S.; Sassera, D.; Villani, B.M.; Bazzi, G.; Negri, A.; Saino, N.; Spina, F.; et al. Patterns of Midichloria infection in avian-borne African ticks and their trans-Saharan migratory hosts. Parasites Vectors 2018, 11, 106. [Google Scholar] [CrossRef] [Scilit]
  51. Harrus, S.; Perlman-Avrahami, A.; Mumcuoglu, K.Y.; Morick, D.; Eyal, O.; Baneth, G. Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel. Clin. Microbiol. Infect. 2011, 17, 459–463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Khoo, J.J.; Husin, N.A.; Lim, F.S.; Oslan, S.N.H.; Mohd Azami, S.N.I.; To, S.W.; Abd Majid, M.A.; Lee, H.Y.; Loong, S.K.; Khor, C.S.; et al. Molecular detection of pathogens from ectoparasites recovered from peri-domestic animals, and the first description of a Candidatus Midichloria sp. from Haemaphysalis wellingtoni from rural communities in Malaysia. Parasitol. Int. 2021, 80, 102202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Barraza-Guerrero, S.I.; Meza-Herrera, C.A.; García-De La Peña, C.; González-Álvarez, V.H.; Vaca-Paniagua, F.; Díaz-Velásquez, C.E.; Sánchez-Tortosa, F.; Ávila-Rodríguez, V.; Valenzuela-Núñez, L.M.; Herrera-Salazar, J.C. General Microbiota of the Soft Tick Ornithodoros turicata Parasitizing the Bolson Tortoise (Gopherus flavomarginatus) in the Mapimi Biosphere Reserve, Mexico. Biology 2020, 9, 275. [Google Scholar] [CrossRef] [Scilit]
  54. Olivieri, E.; Epis, S.; Castelli, M.; Varotto Boccazzi, I.; Romeo, C.; Desiro, A.; Bazzocchi, C.; Bandi, C.; Sassera, D. Tissue tropism and metabolic pathways of Midichloria mitochondrii suggest tissue-specific functions in the symbiosis with Ixodes ricinus. Ticks Tick Borne Dis. 2019, 10, 1070–1077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Tembo, S.; Collins, N.E.; Sibeko-Matjila, K.P.; Troskie, M.; Vorster, I.; Byaruhanga, C.; Oosthuizen, M.C. Occurrence of tick-borne haemoparasites in cattle in the Mungwi District, Northern Province, Zambia. Ticks Tick Borne Dis. 2018, 9, 707–717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Squarre, D.; Nakamura, Y.; Hayashida, K.; Kawai, N.; Chambaro, H.; Namangala, B.; Sugimoto, C.; Yamagishi, J. Investigation of the piroplasm diversity circulating in wildlife and cattle of the greater Kafue ecosystem, Zambia. Parasites Vectors 2020, 13, 599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Tomassone, L.; Pagani, P.; De Meneghi, D. Detection of Babesia caballi in Amblyomma variegatum ticks (Acari: Ixodidae) collected from cattle in the Republic of Guinea. Parassitologia 2005, 47, 247–251. [Google Scholar]
  58. Deem, S.L. A review of heartwater and the threat of introduction of Cowdria ruminantium and Amblyomma spp. ticks to the American mainland. J. Zoo Wildl. Med. 1998, 29, 109–113. [Google Scholar]
  59. Barre, N.; Garris, G.; Camus, E. Propagation of the tick Amblyomma variegatum in the Caribbean. Rev. Sci. Tech. 1995, 14, 841–855. [Google Scholar] [CrossRef] [Scilit]
  60. Baneth, G.; Mathew, J.S.; Shkap, V.; Macintire, D.K.; Barta, J.R.; Ewing, S.A. Canine hepatozoonosis: Two disease syndromes caused by separate Hepatozoon spp. Trends Parasitol. 2003, 19, 27–31. [Google Scholar] [CrossRef] [Scilit]
  61. Walker, A.R.; Bouattour, A.; Camicas, J.L.; Estrada-Peña, A.; Horak, I.G.; Latif, A.A.; Pegram, R.G.; Preston, P.M. Ticks of Domestic Animals in Africa: A Guide to Identification of Species, 2nd ed.; Bioscience Reports: Edinburgh, UK, 2014. [Google Scholar]
  62. Gaowa, N.O.; Minami Aochi, W.; Dongxing Wu, Y.Y.; Fumihiko Kawamori, T.H.; Hiromi Fujita, N.T.; Yosaburo Oikawa, H.K.; Shuji Ando, T.K. Rickettsiae in Ticks, Japan, 2007–2011. Emerg. Infect. Dis. 2013, 19, 338–340. [Google Scholar] [CrossRef] [Scilit]
  63. Parola, P.; Roux, V.; Camicas, J.-L.; Baradji, I.; Brouqui, P.; Raoult, D. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 707–708. [Google Scholar] [CrossRef] [Scilit]
  64. Criado-Fornelio, A.; Martinez-Marcos, A.; Buling-Saraña, A.; Barba-Carretero, J.C. Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe: Part I. Epizootiological aspects. Vet. Parasitol. 2003, 113, 189–201. [Google Scholar] [CrossRef] [Scilit]
  65. Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [Scilit]
  66. Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Sekeyova, Z.; Roux, V.; Raoult, D. Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int. J. Syst. Evol. Microbiol. 2001, 51, 1353–1360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Labruna, M.B.; Whitworth, T.; Bouyer, D.H.; McBride, J.; Camargo, L.M.A.; Camargo, E.P.; Popov, V.; Walker, D.H. Rickettsia bellii and Rickettsia amblyommii in Amblyomma Ticks from the State of Rondônia, Western Amazon, Brazil. J. Med. Entemol. 2004, 41, 1073–1081. [Google Scholar] [CrossRef] [Scilit]
  69. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Map of the sampling site. The red and black dots are sampling place and capital city, respectively.
Figure 1. Map of the sampling site. The red and black dots are sampling place and capital city, respectively.
Pathogens 11 00566 g001
Figure 2. Phylogenetic trees of detected Rickettsia spp. based on the sequences of five genes: (a) gltA; (b) ompA; (c) ompB; (d) sca4; and (e) htrA. The accession numbers for the nucleotide sequences are provided after the species names. The analyses were performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are indicated on the interior branch nodes.
Figure 2. Phylogenetic trees of detected Rickettsia spp. based on the sequences of five genes: (a) gltA; (b) ompA; (c) ompB; (d) sca4; and (e) htrA. The accession numbers for the nucleotide sequences are provided after the species names. The analyses were performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are indicated on the interior branch nodes.
Pathogens 11 00566 g002
Figure 3. Phylogenetic trees of Anaplasmataceae based on partial 16S ribosomal DNA sequences (305 bp). The analysis was performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are shown on the interior branch nodes.
Figure 3. Phylogenetic trees of Anaplasmataceae based on partial 16S ribosomal DNA sequences (305 bp). The analysis was performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are shown on the interior branch nodes.
Pathogens 11 00566 g003
Figure 4. Phylogenetic tree of the detected protozoa based on the partial 18S ribosomal DNA sequences. The accession numbers for the nucleotide sequences are mentioned after the species names. The analyses were performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are presented on the interior branch nodes.
Figure 4. Phylogenetic tree of the detected protozoa based on the partial 18S ribosomal DNA sequences. The accession numbers for the nucleotide sequences are mentioned after the species names. The analyses were performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are presented on the interior branch nodes.
Pathogens 11 00566 g004
Table 1. Number of samples used in the study.
Table 1. Number of samples used in the study.
Host SpeciesTick SpeciesFemaleMale
DogsAmblyomma variegatum02
Rhipicephalus lunulatus1219
R. sanguineus1013
Rhipicephalus spp.03
CattleA. pomposum01
A. variegatum736
Hyalomma marginatum10
H. truncatum1434
R. appendiculatus30
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Qiu, Y.; Simuunza, M.; Kajihara, M.; Ndebe, J.; Saasa, N.; Kapila, P.; Furumoto, H.; Lau, A.C.C.; Nakao, R.; Takada, A.; et al. Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border. Pathogens 2022, 11, 566. https://doi.org/10.3390/pathogens11050566

AMA Style

Qiu Y, Simuunza M, Kajihara M, Ndebe J, Saasa N, Kapila P, Furumoto H, Lau ACC, Nakao R, Takada A, et al. Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border. Pathogens. 2022; 11(5):566. https://doi.org/10.3390/pathogens11050566

Chicago/Turabian Style

Qiu, Yongjin, Martin Simuunza, Masahiro Kajihara, Joseph Ndebe, Ngonda Saasa, Penjani Kapila, Hayato Furumoto, Alice C. C. Lau, Ryo Nakao, Ayato Takada, and et al. 2022. "Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border" Pathogens 11, no. 5: 566. https://doi.org/10.3390/pathogens11050566

APA Style

Qiu, Y., Simuunza, M., Kajihara, M., Ndebe, J., Saasa, N., Kapila, P., Furumoto, H., Lau, A. C. C., Nakao, R., Takada, A., & Sawa, H. (2022). Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia–Angola Border. Pathogens, 11(5), 566. https://doi.org/10.3390/pathogens11050566

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop