Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles
Abstract
:1. Introduction
2. Results
2.1. Phylogenetic and Virulence Gene Profile
2.2. Serogroups
2.3. Biofilm Formation on Abiotic Surfaces and Cell Adherence
2.4. Antimicrobial Profile—Presence of Int I
3. Discussion
4. Material and Methods
4.1. Uropathogenic Escherichia coli—(UPEC) Strains
4.2. Clinical Picture of the Patients
4.3. Serotyping
4.4. Determination of E. coli Phylogenetic Groups
4.5. PCR Amplification of Virulence Genes
4.6. Antimicrobial Resistance Profile
4.7. Bacterial Adhesion to Epithelial Cells
4.8. Biofilm Formation on Abiotic Surfaces
4.9. Identification of Hemolysin-Producing E. coli Strains
4.10. Statistic Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Reu, C.E.; Volanski, W.; Prediger, K.C.; Picheth, G.; Fade-Picheth, C.M.T. Epidemiology of pathogens causing urinary tract infections in an urban community in southern Brazil. Braz. J. Infect. Dis. 2018, 22, 505–507. [Google Scholar] [CrossRef] [PubMed]
- Foxman, B. Epidemiology Urinary Tract Infections: Incidence, morbidity and economic costs. Am. J. Med. 2002, 113, 5S–13S. [Google Scholar] [CrossRef]
- Heilberg, I.P.; Schor, N. Abordagem Diagnóstica e Terapêutica na Infecção do Trato Urinário–ITU. Rev. Assoc. Med. Bras. 2001, 49, 109–116. [Google Scholar] [CrossRef] [Green Version]
- Behzadi, P. Chapter 5: Uropathogenic Escherichia coli and fimbrial adhesins virulome. In Urinary Tract Infection: The Result of the Strength of the Pathogen, or the Weakness of the Host; IntechOpen: Rijeka, Croatia, 2017; pp. 66–83. [Google Scholar] [CrossRef]
- Mulvey, M.A. Adhesion and entry of uropathogenic Escherichia coli. Cell. Microbiol. 2002, 4, 257–271. [Google Scholar] [CrossRef]
- Wullt, B.; Bergsten, G.; Samuelsson, M.; Gebretsadik, N.; Hull, R. The Role of P Fimbriae for Colonization and Host Response Induction in the Human Urinary Tract. J. Infect. Dis. 2001, 183, S43–S46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Terlizzi, M.E.; Grilaudo, G.; Mafei, M. Uropathogenic Escherichia coli (UPEC) infections: Virulence factors, bladders responses, antibiotic, and non-antibiotic antimicrobial strategies. Front. Microbiol. 2017, 8, 1566. [Google Scholar] [CrossRef]
- Karam, M.R.A.; Habidi, M.; Bouzari, S. Urinary tract infection: Pathogenicity, antibiotic resistance and development of effective vacines against uropathogenic Escherichia coli. Mol. Immunol. 2019, 108, 56–67. [Google Scholar] [CrossRef]
- Johnson, J.R.; Stell, A.L. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis relation to phylogeny and host compromise. Infect. Dis. 2000, 181, 261–271. [Google Scholar] [CrossRef] [Green Version]
- Clermont, O.; Cristenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phy-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef]
- Abdallah, K.S.; Wei, D.J. Epidemiologic Investigation of extra-intestinal pathogenic E. coli (EXpec) based on PCR phylogenetic group an fim H. sigle nucleotide polymorphisms. Int. J. Mol. Epidemiol. Genet. 2011, 2, 339–353. [Google Scholar]
- Chrakraborty, A.; Saralaya, V.; Adhikari, P.; Shenoy, S.; Baliga, S.; Hegde, A. Characterization of Escherichia coli phylogenetic groups associated with extraintestinal infections in South Indian population. Ann. Med. Health Sci. Res. 2015, 5, 241–246. [Google Scholar] [CrossRef]
- Sharma, S.; Kaaur, N.; Malhota, S.; Madan, P.; Ahmad, W.; Hans, C. Serotyping and antimicrobial susceptibility pattern of Escherichia coli isolates from urinary tract infections in pediatric population in a tertiary care hospital. J. Pathog. 2016, 2016, 2548517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abe, C.M.; Salvador, F.A.; Falsetti, I.N.; Vieira, M.A.M.; Blanco, J.; Blanco, J.E.; Blanco, M.; Machado, A.M.O.; Elias, W.P.; Hernandes, R.T.; et al. Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic. FEMS Immunol. Med. Microbiol. 2008, 52, 397–406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sandulescu, S.M.; Vicol, R.M.; Serban, A.; Carp, A.V.; Vaduva, C. Chapter 14: Congenital anomalies of urinary tract and anomalies of fetal genitalia. In Congenital Anomalies: From the Embryo to the Neonate; IntechOpen: Rijeka, Croatia, 2018; pp. 287–307. [Google Scholar] [CrossRef] [Green Version]
- Treter, J.; Macedo, A.J. Catheters: A suitable surface for biofilm formation. In Science against Microbial Pathogens: Communicating Current Research and Technological Advances; Mendez-Vilas, A., Ed.; FORMATEX: Badajoz, Spain, 2011; pp. 835–841. [Google Scholar]
- Clark, C.J.; Kennedy, W.A.; Shortliffe, L.D. Urinary Tract Infection in children: When to worry. Urol. Clin. N. Am. 2010, 37, 229–241. [Google Scholar] [CrossRef]
- Ahumada-Santos, Y.P.; Baez-Flores, M.E.; Diaz-Camacho, S.P.; Uribe-Beltran, M.J.; Eslava-Campos, C.A.; Parra-Unda, J.R.; Delgado-Vargas, F. Association of phylogenetic distribution and presence of integrons with multidrug resistance in Escherichia coli clinical isolates from children with diarrhea. J. Infect. Public Health 2020, 13, 767–772. [Google Scholar] [CrossRef]
- Yamamoto, S.; Tsukamoto, T.; Terai, A.; Kurazono, H.; Takeda, Y.; Yoshida, O. Genetic evidence supporting the fecal-perineal-urethral hypothesis in cystitis caused by Escherichia coli. J. Urol. 1997, 157, 1127–1129. [Google Scholar] [CrossRef]
- Magruder, M.; Sholi, A.N.; Gong, C.; Zhang, L.; Edusei, E.; Huang, J.; Albakry, S.; Satlin, M.J.; Westblade, L.F.; Crawfor, C.; et al. Gut uropathogen abundance is a risk factor for development of bacteriuria and urinary tract infection. Nat. Commun. 2019, 10, 5521. [Google Scholar] [CrossRef]
- Ristow, L.C.; Welch, R.A. Hemolysin of uropathogenic Escherichia coli: A cloak or a dagger? Biochim. Et Biophys. Acta 2016, 1858, 538–545. [Google Scholar] [CrossRef]
- Bielaszewska, M.; Friedrich, A.W.; Aldick, T.; Schurk-Bulgrin, R.; Karch, H. Shiga toxin activatable by intestinal mucus in Escherichia coli isolated from Humans: Predictor for a severe clinical outcome. Clin. Infect. Dis. 2006, 43, 1160–1167. [Google Scholar] [CrossRef] [Green Version]
- Guerra, J.A.; Romero-Herazo, Y.C.; Arzuza, O.; Gomez-Duarte, O.G. Phenotypic and genotypic characterization of enterotoxigenic Escherichia coli clinical isolates from Northern Colombia, South America. BioMed Res. Int. 2014, 2014, 236260. [Google Scholar] [CrossRef] [Green Version]
- Ori, E.L.; Takagi, E.H.; Andrade, T.S.; Miguel, M.T.; Cergole-Novella, M.C.; Guth, B.E.C.; Hernandes, R.T.; Dias, R.C.B.; Pineiro, S.R.S.; Camargo, C.H.; et al. Diarrhoeagenic Escherichia coli and Escherichia albertii in Brazil: Pathotypes and serotypes over a 6-year period of surveillance. Epidemiol. Infect. 2019, 147, E10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diaz-Jimenez, D.; Garcia-Menino, I.; Herrera, A.; Garcia, V.; López-Beceiro, A.M.; Alonso, M.P.; Blanco, J.; Mora, A. Genomic characterization of Escherichia coli isolates belonging to a new hybrid a EPEC/ExPEC pathotype O153:H10-A-ST10 eae-beta 1 ocurred in meat, poultry, wildlife and human diarrheagenic samples. Antibiotics 2020, 9, 192. [Google Scholar] [CrossRef] [PubMed]
- Cointe, A.; Birgy, A.; Mariani-Kurkdjan, P.M.; Liguori, S.; Courroux, C.; Blanco, J.; Delanney, S.; Fach, P.; Loukiadis, E.; Bidet, P.; et al. Emerging Multidrug-Resistant hybrid pathotype shiga toxin-producing Escherichia coli O80 and related cloncal complex. Emerg. Infect. Dis. 2018, 12, 2262–2269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gati, N.S.; Middendorf-Bauchart, B.; Bletz, S.; Dobrindt, U.; Melllman, A. Origin and evolution of hybrid shiga toxin-producing and uropathogenic Escherichia coli strains of sequence type 141. J. Clin. Microbiol. 2020, 58, e01309-19. [Google Scholar] [CrossRef] [PubMed]
- Lara, F.B.M.; Nery, D.R.; Oliveira, P.M.; Araujo, M.L.; Carvalho, F.R.Q.; Messias-Silva, L.C.F.; Ferreira, L.B.; Faria-Junior, C.; Pereira, A.L. Virulence markers and phylogenetic analysis of Escherichia coli strains with hybrid EAEC/UPEC genotypes recovered from sporadic cases of estraintestinal infections. Fraontiers Microbiol. 2017, 8, 146. [Google Scholar] [CrossRef] [Green Version]
- Santos, A.C.M.; Santos, F.F.; Silva, R.M.; Gomes, T.A.T. Diversity of Hybrid- and Hetero-Pathogenic Escherichia coli and Their Potential Implication in More Severe Diseases. Front. Cell. Infect. Microbiol. 2020, 10, 339. [Google Scholar] [CrossRef] [PubMed]
- Valiatt, T.N.; Santos, F.F.; Santos, A.C.M.; Nascimento, J.A.S.; Silva, R.M.; Carvalho, E.; Sinigaglia, R.; Gomes, T.A.T. Genetic and Virulence characteristics of hybrid atypical enteropathogenic and uropathogenic Escherichia coli (aEPEC/UPEC) strain. Front. Cell. Infect. Microbiol. 2020, 10, 492. [Google Scholar] [CrossRef]
- Mestrovic, T.; Matijasic, M.; Peric, M.; Paljetak, H.C.; Baresic, A. 2021. The role of gut, vaginal and urinary microbiome in urinary tract infections: From bench to bedside. Diagnostics 2021, 11, 7. [Google Scholar] [CrossRef]
- Soto, S.M.; Smithson, A.; Horcajada, J.P.; Martinez, J.A.; Mensa, J.P.; Vila, J. Implication of biofilm formation in the persistance of urinary tract infection caused by uropathogenic Escherichia coli. Clin. Microbiol. Infect. 2006, 12, 1021–1045. [Google Scholar] [CrossRef] [Green Version]
- Wu, T.H.; Huang, F.L.; Fu, L.; Chou, C.M.; Chien, Y.L.; Huang, C.M.; Lin, C.F.; Chen, P.Y. Treatment of recurrent complicated urinary tract infections in children with vesicoureteral reflux. J. Microbiol. Immunol. Infect. 2016, 5, 717–722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duicu, C.; Armean, I.; Aldea, C. New insights in treatment options in pediatric urinary tract infection. Acta Med. Marisiensis 2019, 65, 7–11. [Google Scholar] [CrossRef] [Green Version]
- Brusch, J.L.; Bronze, M.S. Urinary tarct infection (UTI) and cystitis (bladder infection) in females. Child. Urin. Tract Infect. 2020, 32, 1–5. [Google Scholar] [CrossRef]
- Najafi, M.; Omidvar-Panah, M.; Nikkhahi, F.; Paymani, A. Epidemiology of integrons among multigrug-resistant pathogens: An Asian update. Rev. Res. Med. Microbiol. 2021, 33, e33–e39. [Google Scholar] [CrossRef]
- Silva, P.; Carneiro, A.M.M.; Carloni, M.C.; Cazentini, M.I.; Medeiros, M.I.C.; Silva, J.O.; Reche, S.H.C.; Errera, M.C.; Neme, S.N. Isolation, characterization and antimicrobial resistance of Gram-negative aerobic and facultative anaerobic bacteria from soil samples. Rev. Inst. Adolfo Lutz 2005, 64, 245–251. [Google Scholar]
- Ewing, W.H. Edwards and Ewing’s Identification of Enterobacteriaceae; Elsevier: New York, NY, USA, 1986. [Google Scholar]
- Andrade, F.B.; Gomes, T.A.T.; Elias, W.P. A sensitive and specific molecular tool for detection of both typical and atypical enteroaggregative Escherichia coli. J. Microbiolocal Methods 2014, 106, 16–18. [Google Scholar] [CrossRef]
- Nowrouzian, F.L.; Monstein, H.J.; Wold, A.E.; Adlerberth, I. Effect of human milk on type 1 and P-fimbrial mRNA expression in intestinal Escherichia coli strains. Lett. Appl. Microbiol. 2005, 40, 74–80. [Google Scholar] [CrossRef]
- Yun, K.W.; Kim, H.Y.; Park, H.K.; Kim, W.; Lim, I.S. Virulence factors of uropathogenic Escherichia coli of urinary tract infections and asymptomatic bacteriuria in children. J. Mecrobiol Immunol Infect. 2014, 47, 455–461. [Google Scholar] [CrossRef] [Green Version]
- Le Bouguénec, C.; Archambaud, M.; Labigne, A. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J. Clin. Microbiol. 1992, 30, 1189–1193. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, S.; Terai, A.; Yuri, K.; Kurazono, H.; Takeda, Y.; Yoshida, O. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immun. Med. Microbiol. 1995, 12, 85–90. [Google Scholar] [CrossRef]
- Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic resistance in the ECOR collection: Integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 2000, 44, 1568–1574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henderson, I.R.; Czeczulin, J.; Eslava, C.; Noriega, F.; Nataro, J.P. Characterization of pic, a secreted protease of Shigella flexneri and enteroaggregative Escherichia coli. Infect. Immun. 1999, 67, 5587–5596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic Susceptibility Testing by a Standardized Single Disk Method. Am. J. Clin. Pathol. 1965, 45, 493–496. [Google Scholar] [CrossRef]
- Clsi-Clinical And Laboratory Standards Institute. M100-S27: Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; Anvisa: Wayne, MI, USA, 2017. [Google Scholar]
- Sheikh, J.; Hicks, S.; Agnol, M.D.; Phillips, A.D.; Nataro, J.P. Roles for Fis and YafK in biofilm formation by enteroaggregative Escherichia coli. Mol. Microbiol. 2001, 5, 983–997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beutin, L. The different hemolysins of Escherichia coli. Med. Microbiol. Immunol. 1991, 180, 167–182. [Google Scholar] [CrossRef] [PubMed]
Female Patients with NUT | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
N° | Serotype | Phylo-Group | EAEC Genes | Virulence Factors | ||||||||||
fimA | fimH | pap | sfa | cnf1 | pic | hly | Hem | Biofilm | Adhesion | |||||
PLT | PVC | |||||||||||||
1 | O33H:28 | B1 | + | + | - | - | - | + | + | + | - | - | - | |
2 | O2:H4 | D | + | + | + | - | - | - | + | + | + | + | - | |
3 | O177:H21 | B1 | + | + | - | - | - | - | - | - | + | - | + | |
4 | O6:H1 | B2 | + | + | + | + | + | - | - | + | + | + | - | |
5 | O2:H6 | B2 | + | + | - | + | + | - | + | + | + | - | + | |
6 | O16:H5 | B2 | + | + | - | - | nd | - | - | + | - | - | + | |
7 | O2:H- | B2 | + | + | + | - | + | + | + | + | - | - | - | |
8 | ONT:HNT | B2 | + | + | + | + | nd | - | - | + | - | - | - | |
9 | O6:H- | B2 | + | + | - | - | - | - | - | + | + | + | - | |
10 | O16:H6 | B2 | + | + | + | - | - | - | - | - | - | - | - | |
11 | O16:H5 | B2 | aaiG, aaiA | + | + | + | - | - | - | - | - | + | + | + |
12 | O153:H2 | D | + | + | - | - | - | - | - | - | + | + | - | |
13 | O15:H1 | D | + | + | - | - | - | + | - | - | - | - | + | |
14 | OR:H2 | D | + | + | - | - | nd | - | - | - | - | - | + |
Female Patients with AUT | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
N° | Serotype | Phylo-Group | EAEC Genes | Virulence Factors | ||||||||||
fimA | fimH | pap | sfa | cnf1 | pic | hly | Hem | Biofilm | Adhesion | |||||
PLT | PVC | |||||||||||||
1 | ONT:HNT | C | + | + | + | + | nd | - | - | - | + | + | + | |
2 | ONT:H18 | E | aggR | + | + | - | + | - | - | - | - | + | + | + |
3 | O20:H9 | CLADE I | aggR | + | + | - | + | - | - | - | - | + | + | + |
4 | O80:H26 | C | + | + | + | - | - | - | - | - | + | + | + | |
5 | O177:H21 | B1 | + | + | + | - | - | - | + | + | + | + | ||
6 | O2:H6 | B2 | + | + | + | + | nd | - | + | + | + | + | + | |
7 | O2:H1 | B2 | + | + | + | + | nd | + | + | - | + | - | + | |
8 | O6:H- | E | + | + | + | + | + | - | - | + | - | - | - | |
9 | O16:H6 | E | aggR | + | + | + | + | + | - | - | - | + | + | + |
10 | O6:H31 | B2 | + | + | + | + | nd | - | + | + | - | - | - | |
11 | O16:H5 | E | + | + | + | + | - | - | - | - | + | + | + | |
12 | ONH:H- | C | + | + | + | - | nd | + | - | - | + | + | + | |
13 | O2:H1 | C | + | + | + | - | + | - | - | - | + | + | - | |
14 | ONT:HNT | E | + | + | - | + | - | - | - | - | + | + | + | |
15 | O11:H18 | E | + | + | - | - | - | - | - | - | + | + | + | |
16 | OR:H18 | E | aaiG, aaiA | + | + | + | + | - | - | - | - | + | + | + |
17 | O86:H18 | D | + | + | + | + | nd | - | - | - | + | + | - | |
18 | OR:H18 | D | + | + | + | + | nd | - | - | + | + | + | ||
19 | O153:H10 | F | + | + | + | - | - | - | - | - | + | + | + | |
20 | O153:H18 | E | + | + | + | - | - | - | - | - | + | + | + | |
21 | ONT:H18 | B1 | + | + | + | - | - | - | - | - | + | + | + | |
22 | ONT:H18 | B1 | + | + | - | - | nd | - | - | - | + | + | + |
Female Patients with Pyelonephritis | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
N° | Serotype | Phylo-Group | EAEC Genes | Virulence Factors | ||||||||||
fimA | fimH | pap | sfa | cnf1 | pic | hly | Hem | Biofilm | Adhesion | |||||
PLT | PVC | |||||||||||||
1 | ONT:H31 | B2 | aaiG, aaiA | + | + | + | + | - | - | + | + | + | + | - |
2 | OR:H18 | D | + | + | + | - | nd | - | + | + | + | + | + | |
3 | O6:H- | B2 | + | + | + | + | - | - | + | + | + | + | - | |
4 | O80:H26 | B2 | + | + | + | - | - | - | - | - | + | + | + |
Antibiotic Resistance-Female Patients with NUT | |||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
N° | Serotype | int1 | SUT | ATM | CAZ | CIP | IPM | AMC | CTX | CPM | MER | FOS | GEN | AMI | NAL | ERT | Total Antibiotic Resistance |
1 | O33H:28 | - | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
2 | O2:H4 | + | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
3 | O177:H21 | + | S | S | S | R | S | S | S | S | S | S | S | S | R | S | CIP, NAL |
4 | O6:H1 | - | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
5 | O2:H6 | - | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S |
6 | O16:H5 | - | R | S | S | S | S | R | S | S | S | S | S | S | S | S | SUT, AMC |
7 | O2:H- | - | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
8 | ONT:HNT | nd | R | S | S | R | S | nd | S | S | S | nd | R | S | nd | nd | SUT, CIP, GEN |
9 | O6:H- | - | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S |
10 | O16:H6 | - | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
11 | O16:H5 | - | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S |
12 | O153:H2 | - | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S |
13 | O15:H1 | - | S | S | S | S | S | nd | S | S | S | nd | S | S | nd | nd | S |
14 | OR:H2 | nd | S | R | R | R | S | nd | S | R | S | nd | R | R | nd | nd | ATM, CAZ, CIP, CPM, GEN, AMIC |
Antibiotic Resistance–Female Patients with AUT | |||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
N° | Serotype | int1 | SUT | ATM | CAZ | CIP | IPM | AMC | CTX | CPM | MER | FOS | GEN | AMI | NAL | ERT | Total Antibiotic Resistance |
1 | ONT:HNT | - | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S |
2 | ONT:H18 | + | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
3 | O20:H9 | + | R | S | S | R | S | S | S | S | S | S | S | S | R | S | SUT, CIP, NAL |
4 | O80:H26 | - | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
5 | O177:H21 | - | S | S | S | S | S | S | S | S | S | S | S | S | R | S | NAL |
6 | O2:H6 | nd | S | R | R | R | R | nd | S | R | S | nd | R | R | nd | nd | ATM, CAZ, CIP, IPM, CPM, GEN, AMI |
7 | O2:H1 | nd | R | S | S | S | S | nd | S | S | S | nd | S | S | nd | nd | SUT |
8 | O6:H- | - | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S |
9 | O16:H6 | + | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
10 | O6:H31 | nd | S | R | R | R | S | nd | S | S | S | nd | S | S | nd | nd | ATM, CAZ, CIP |
11 | O16:H5 | + | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
12 | ONH:H- | nd | S | S | S | S | S | nd | S | S | S | nd | S | R | nd | nd | S |
13 | O2:H1 | - | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
14 | ONT:HNT | - | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S |
15 | O11:H18 | + | R | S | S | S | S | R | S | S | S | S | S | S | S | S | SUT, AMC |
16 | OR:H18 | + | R | S | S | S | S | R | S | S | S | S | S | S | S | S | SUT, AMC |
17 | O86:H18 | nd | S | S | S | S | S | nd | S | S | S | nd | S | S | nd | nd | S |
18 | OR:H18 | nd | R | S | S | S | R | nd | R | S | R | nd | S | R | nd | nd | SUT, IPM, CTX, MER, AMI |
19 | O153:H10 | - | R | S | S | S | S | R | S | S | S | S | S | S | S | S | SUT |
20 | O153:H18 | - | R | S | S | S | S | S | S | S | S | S | S | S | S | S | SUT |
21 | ONT:H18 | + | R | S | S | S | S | S | S | S | S | S | S | S | R | S | SUT, NAL |
22 | ONT:H18 | nd | S | S | S | S | S | nd | S | S | S | nd | S | S | nd | nd | S |
Antibiotic Resistance–Female Patients with Pyelonephritis | |||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Nº | Serotype | int1 | SUT | ATM | CAZ | CIP | IPM | AMC | CTX | CPM | MER | FOS | GEN | AMI | NAL | ERT | Total Antibiotic Resistance |
1 | ONT:H31 | + | R | S | S | S | S | R | S | S | S | S | S | S | S | S | SUT, AMC |
2 | OR:H18 | nd | R | S | S | S | R | nd | R | S | R | nd | S | R | nd | nd | SUT, IPM, CTX, MER, AMI |
3 | O6:H- | - | S | S | S | S | S | S | S | S | S | S | R | S | S | S | S |
4 | O80:H26 | nd | S | S | S | S | S | nd | S | S | S | nd | S | S | nd | nd | S |
Genes | Primer Sequence (5′- 3′) | Annealing Temperatures (°C) | Amplicon Size (bp) | References |
---|---|---|---|---|
fimA | CTGTCGGCTCTGTCCCTCAGT GATGCGGTACGAACCTGTCCTAA | 65 | 161 | [40] |
fimH | TGCAGAACGGATAAGCCGTGG GCAGTCACCTGCCCTCCGGTA | 63 | 508 | [41] |
pap | GACGGCTGTACTGCAGGGTGTGGCG ATATCCTTTCTGCAGGGATGCAATA | 50 | 328 | [42] |
sfa | CTCCGGAGAACTGGGTGCATCTTAC CGGAGGAGTAATTACAAACCTGGCA | 50 | 410 | [42] |
cnf1 | AAGATGGAGTTTCCTATGCAGGAG CATTCAGAGTCCTGCCCTCATTATT | 61 | 498 | [43] |
int1 | ACATGCGTGTAAATCATCGTCG GGGTCAAGGATCTGGATTTCG | 62 | 483 | [44] |
pic | GGGTATTGTCCGTTCCGAT ACAACGATACCGTCTCCCG | 55 | 1175 | [45] |
hly | GGTGCAGCAGAAAAAGTTGTAG TCTCGCCTGATAGTGTTTGGTA | 57 | 596 | M10133(hlyA) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Domingos, M.d.O.; da Silva Junior, S.M.; Milanello, W.; Nakano, S.S.N.; Franzolin, M.R.; dos Santos, L.F.; Nunes, K.O.; Marques, V.D.; Elias, W.P.; Silva, H.G.d.S.; et al. Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles. Pathogens 2022, 11, 231. https://doi.org/10.3390/pathogens11020231
Domingos MdO, da Silva Junior SM, Milanello W, Nakano SSN, Franzolin MR, dos Santos LF, Nunes KO, Marques VD, Elias WP, Silva HGdS, et al. Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles. Pathogens. 2022; 11(2):231. https://doi.org/10.3390/pathogens11020231
Chicago/Turabian StyleDomingos, Marta de Oliveira, Silvio Marciano da Silva Junior, Wagner Milanello, Shirley Sizue Nakamura Nakano, Marcia Regina Franzolin, Luis Fernando dos Santos, Kamila Oliveira Nunes, Vaniky Duarte Marques, Waldir P. Elias, Herbert Guimarães de Sousa Silva, and et al. 2022. "Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles" Pathogens 11, no. 2: 231. https://doi.org/10.3390/pathogens11020231
APA StyleDomingos, M. d. O., da Silva Junior, S. M., Milanello, W., Nakano, S. S. N., Franzolin, M. R., dos Santos, L. F., Nunes, K. O., Marques, V. D., Elias, W. P., Silva, H. G. d. S., Caetano, B. D. L., & Piazza, R. M. F. (2022). Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles. Pathogens, 11(2), 231. https://doi.org/10.3390/pathogens11020231