Comparison of Three Real-Time PCR Assays for the Detection of Cyclospora cayetanensis in Stool Samples Targeting the 18S rRNA Gene and the hsp70 Gene
Abstract
:1. Introduction
2. Materials and Methods
2.1. Residual Sample Collection and Nucleic Acid Extraction
2.2. Applied In-House Real-Time PCRs
2.3. Statistical Assessment
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Positive Control Insert Based on C. cayetanensis Sequences according to the NCBI GenBank Accession Numbers CSU40261, AF111183, HQ110607. |
---|
5′-GAATTCGATTCATAGTAACCGAACGGATCGCATTTGGCTTTAGCCGGCGATAGATCATTCAAGTTTCTGACCT ATCAGCTTTCGACGGTAGGGTATTGGCCTACCGTGGCATTGACGGGGAATTCGAGGGTCCTGTGAACTCATTG GACTGACCAGCTGTGCTTCGCGGAGCTGGTCGGAAAGTTGCGTAAATAGAGCCCTCTAAAGGATGCAAAAGT CGTAACACGGGAATTCCTTTCTTCCGGTAGCCTTCCGCGCTTCGCTGCGTGCGTTGGTGTTCCGGAACTTTTAC TTTGAGAAAAATAGAGTGTTTCAAGCAGGCTTGTCGCCCTGAATACTGCAGCATGGAATAATAAGATAGGAC CTTGGTTCTATTTTGTTGGTTTCTAGGACCGAGGTAATGATTAATAGGGACAGTTGGGGGCATTCGTATTTAAC TGTCAGAGGTGAAATTCTTAGATTTGTTAAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTA ATCAAGAACGACAGTAGGGGGTTTGAAGACGATTAGATACCGAATTCTGAGTGTGCATCGTGATGGGGATAG ATTATTGCAATTATTAATCTTCAACGAGGAATGCCTAGTAGGCGCAAGTCAACAGCTTGCGCCGATTACGTCC CTGCCCCTTGTACACACCGCCCGTCGCTGCAACCGATCGGAGGGTCCTGTGAACTCATTGGACTGACCAGCTG TGCTTCGCGGAGCTGGTCGGAAAGTTGCGTAAATAGAGCCCTCTAAAGGGAATTCCTGGAAGCGGGGGTAAG CCACTTATTGAAGTGAACTACCAAGGTGCTACGAAGACTTTTCATCCGGAGGAAATTTCCGCCATGGTGCTGG TGAAGATGAAGGAAATTGCCGAGTCGTTCGTTGGCAAAGAAGTTAAGGAGGCCGTTATTACAGAATTCAATT TTGGGCGAATCACAGATTGAATCTGATGATACAGCAACATTTTTTATGTGTCCGCCACCATCTGGATCAACGT TGGTACGTTTGGAACCGCCTCGGGCGAATTC-3′ |
References
- Almeria, S.; Cinar, H.N.; Dubey, J.P. Cyclospora cayetanensis and Cyclosporiasis: An Update. Microorganisms 2019, 7, 317. [Google Scholar] [CrossRef] [Green Version]
- Connor, B.A. Cyclospora infection: A review. Ann. Acad. Med. Singap. 1997, 26, 632–636. [Google Scholar]
- Helmy, M.M. Cyclospora cayetanensis: A review, focusing on some of the remaining questions about cyclosporiasis. Infect. Disord. Drug Targets 2010, 10, 368–375. [Google Scholar] [CrossRef] [PubMed]
- Chacín-Bonilla, L. Transmission of Cyclospora cayetanensis infection: A review focusing on soil-borne cyclosporiasis. Trans. R. Soc. Trop. Med. Hyg. 2008, 102, 215–216. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Wang, R.; Chen, Y.; Xiao, L.; Zhang, L. Cyclospora cayetanensis infection in humans: Biological characteristics, clinical features, epidemiology, detection method and treatment. Parasitology 2020, 147, 160–170. [Google Scholar] [CrossRef] [PubMed]
- Frickmann, H.; Alker, J.; Hansen, J.; Dib, J.C.; Aristizabal, A.; Concha, G.; Schotte, U.; Kann, S. Seasonal Differences in Cyclospora cayetanensis Prevalence in Colombian Indigenous People. Microorganisms 2021, 9, 627. [Google Scholar] [CrossRef] [PubMed]
- Shields, J.M.; Olson, B.H. Cyclospora cayetanensis: A review of an emerging parasitic coccidian. Int. J. Parasitol. 2003, 33, 371–391. [Google Scholar] [CrossRef]
- Li, J.; Cui, Z.; Qi, M.; Zhang, L. Advances in Cyclosporiasis Diagnosis and Therapeutic Intervention. Front. Cell. Infect. Microbiol. 2020, 10, 43. [Google Scholar] [CrossRef] [Green Version]
- Brown, G.H.; Rotschafer, J.C. Cyclospora: Review of an emerging parasite. Pharmacotherapy 1999, 19, 70–75. [Google Scholar] [CrossRef]
- Mansfield, L.S.; Gajadhar, A.A. Cyclospora cayetanensis, a food- and waterborne coccidian parasite. Vet. Parasitol. 2004, 126, 73–90. [Google Scholar] [CrossRef]
- Hadjilouka, A.; Tsaltas, D. Cyclospora Cayetanensis-Major Outbreaks from Ready to Eat Fresh Fruits and Vegetables. Foods 2020, 9, 1703. [Google Scholar] [CrossRef]
- Ortega, Y.R.; Sanchez, R. Update on Cyclospora cayetanensis, a food-borne and waterborne parasite. Clin. Microbiol. Rev. 2010, 23, 218–234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gascon, J.; Corachan, M.; Bombi, J.A.; Valls, M.E.; Bordes, J.M. Cyclospora in patients with traveller’s diarrhea. Scand. J. Infect. Dis. 1995, 27, 511–514. [Google Scholar] [CrossRef]
- Chacín-Bonilla, L. Epidemiology of Cyclospora cayetanensis: A review focusing in endemic areas. Acta Trop. 2010, 115, 181–193. [Google Scholar] [CrossRef]
- Giangaspero, A.; Gasser, R.B. Human cyclosporiasis. Lancet Infect. Dis. 2019, 19, e226–e236. [Google Scholar] [CrossRef]
- Dhanabal, J.; Selvadoss, P.P.; Muthuswamy, K. Comparative study of the prevalence of intestinal parasites in low socioeconomic areas from South chennai, India. J. Parasitol. Res. 2014, 2014, 630968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nichols, G.L.; Freedman, J.; Pollock, K.G.; Rumble, C.; Chalmers, R.M.; Chiodini, P.; Hawkins, G.; Alexander, C.L.; Godbole, G.; Williams, C.; et al. Cyclospora infection linked to travel to Mexico, June to September 2015. Eur. Surveill. 2015, 20, 43. [Google Scholar] [CrossRef]
- Cama, V.A.; Mathison, B.A. Infections by Intestinal Coccidia and Giardia duodenalis. Clin. Lab. Med. 2015, 35, 423–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shlim, D.R. Cyclospora cayetanesis. Clin. Lab. Med. 2002, 22, 927–936. [Google Scholar] [CrossRef]
- Eberhard, M.L.; Pieniazek, N.J.; Arrowood, M.J. Laboratory diagnosis of Cyclospora infections. Arch. Pathol. Lab. Med. 1997, 121, 792–797. [Google Scholar]
- Wurtz, R. Cyclospora: A newly identified intestinal pathogen of humans. Clin. Infect. Dis. 1994, 18, 620–623. [Google Scholar] [CrossRef]
- Legua, P.; Seas, C. Cystoisospora and cyclospora. Curr. Opin. Infect. Dis. 2013, 26, 479–483. [Google Scholar] [CrossRef] [PubMed]
- Quintero-Betancourt, W.; Peele, E.R.; Rose, J.B. Cryptosporidium parvum and Cyclospora cayetanensis: A review of laboratory methods for detection of these waterborne parasites. J. Microbiol. Methods 2002, 49, 209–224. [Google Scholar] [CrossRef]
- Meyer, J.; Roos, E.; Combescure, C.; Buchs, N.C.; Frossard, J.L.; Ris, F.; Toso, C.; Schrenzel, J. Mapping of aetiologies of gastroenteritis: A systematic review and meta-analysis of pathogens identified using a multiplex screening array. Scand. J. Gastroenterol. 2020, 55, 1405–1410. [Google Scholar] [CrossRef] [PubMed]
- Frickmann, H.; Hoffmann, T.; Köller, T.; Hahn, A.; Podbielski, A.; Landt, O.; Loderstädt, U.; Tannich, E. Comparison of five commercial real-time PCRs for in-vitro diagnosis of Entamoeba histolytica, Giardia duodenalis, Cryptosporidium spp., Cyclospora cayetanensis, and Dientamoeba fragilis in human stool samples. Travel Med. Infect. Dis. 2021, 41, 102042. [Google Scholar] [CrossRef]
- Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in human stool samples without a gold standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef]
- Soave, R.; Herwaldt, B.L.; Relman, D.A. Cyclospora. Infect. Dis. Clin. N. Am. 1998, 12, 1–12. [Google Scholar] [CrossRef]
- Hahn, A.; Podbielski, A.; Meyer, T.; Zautner, A.E.; Loderstädt, U.; Schwarz, N.G.; Krüger, A.; Cadar, D.; Frickmann, H. On detection thresholds—A review on diagnostic approaches in the infectious disease laboratory and the interpretation of their results. Acta Trop. 2020, 205, 105377. [Google Scholar] [CrossRef]
- Loderstädt, U.; Hagen, R.M.; Hahn, A.; Frickmann, H. New Developments in PCR-Based Diagnostics for Bacterial Pathogens Causing Gastrointestinal Infections-A Narrative Mini-Review on Challenges in the Tropics. Trop. Med. Infect. Dis. 2021, 6, 96. [Google Scholar] [CrossRef]
- Verweij, J.J.; Laeijendecker, D.; Brienen, E.A.; van Lieshout, L.; Polderman, A.M. Detection of Cyclospora cayetanensis in travellers returning from the tropics and subtropics using microscopy and real-time PCR. Int. J. Med. Microbiol. 2003, 293, 199–202. [Google Scholar] [CrossRef]
- Varma, M.; Hester, J.D.; Schaefer, F.W., III; Ware, M.W.; Lindquist, H.D. Detection of Cyclospora cayetanensis using a quantitative real-time PCR assay. J. Microbiol. Methods. 2003, 53, 27–36. [Google Scholar] [CrossRef]
- Shields, J.M.; Joo, J.; Kim, R.; Murphy, H.R. Assessment of three commercial DNA extraction kits and a laboratory-developed method for detecting Cryptosporidium and Cyclospora in raspberry wash, basil wash and pesto. J. Microbiol. Methods. 2013, 92, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Taniuchi, M.; Verweij, J.J.; Sethabutr, O.; Bodhidatta, L.; Garcia, L.; Maro, A.; Kumburu, H.; Gratz, J.; Kibiki, G.; Houpt, E.R. Multiplex polymerase chain reaction method to detect Cyclospora, Cystoisospora, and Microsporidia in stool samples. Diagn. Microbiol. Infect. Dis. 2011, 71, 386–390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qu, Y.; Tan, M.; Kutner, M.H. Random effects models in latent class analysis for evaluating accuracy of diagnostic tests. Biometrics 1996, 52, 797–810. [Google Scholar] [CrossRef]
- Eberhardt, K.A.; Sarfo, F.S.; Dompreh, A.; Kuffour, E.O.; Geldmacher, C.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; et al. Helicobacter pylori Coinfection Is Associated with Decreased Markers of Immune Activation in ART-Naive HIV-Positive and in HIV-Negative Individuals in Ghana. Clin. Infect. Dis. 2015, 61, 1615–1623. [Google Scholar] [CrossRef] [Green Version]
- Sarfo, F.S.; Eberhardt, K.A.; Dompreh, A.; Kuffour, E.O.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; Oteng-Seifah, E.E.; et al. Helicobacter pylori Infection Is Associated with Higher CD4 T Cell Counts and Lower HIV-1 Viral Loads in ART-Naïve HIV-Positive Patients in Ghana. PLoS ONE 2015, 10, e0143388. [Google Scholar] [CrossRef] [Green Version]
- Tanida, K.; Hahn, A.; Eberhardt, K.A.; Tannich, E.; Landt, O.; Kann, S.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens 2021, 10, 656. [Google Scholar] [CrossRef]
- Blohm, M.; Hahn, A.; Hagen, R.M.; Eberhardt, K.A.; Rohde, H.; Leboulle, G.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparison of Two Real-Time PCR Assays Targeting Ribosomal Sequences for the Identification of Cystoisospora belli in Human Stool Samples. Pathogens 2021, 10, 1053. [Google Scholar] [CrossRef]
- Weinreich, F.; Hahn, A.; Hagen, R.M.; Eberhardt, K.A.; Rohde, H.; Leboulle, G.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparison of Three Real-Time PCR Assays Targeting the SSU rRNA Gene, the COWP Gene and the DnaJ-Like Protein Gene for the Diagnosis of Cryptosporidium spp. in Stool Samples. Pathogens 2021, 10, 1113. [Google Scholar] [CrossRef]
- Niesters, H.G.M. Quantitation of viral load using real-time amplification techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef]
- Landis, J.R.; Koch, G.G. The Measurement of Observer Agreement for Categorical Data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murphy, H.R.; Cinar, H.N.; Gopinath, G.; Noe, K.E.; Chatman, L.D.; Miranda, N.E.; Wetherington, J.H.; Neal-McKinney, J.; Pires, G.S.; Sachs, E.; et al. Interlaboratory validation of an improved method for detection of Cyclospora cayetanensis in produce using a real-time PCR assay. Food Microbiol. 2018, 69, 170–178. [Google Scholar] [CrossRef] [PubMed]
- Verweij, J.J.; Stensvold, C.R. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clin. Microbiol. Rev. 2014, 27, 371–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; De Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar]
Forward Primer Name | Forward Primer Sequence | Reverse Primer Name | Reverse Primer Sequence | Probe Name | Probe Sequence |
---|---|---|---|---|---|
SSU rRNA gene PCR according to Verweij et al. [30] | |||||
Cyclo250F | 5′-TAGTAACCGAACGGATCGCATT-3′ | Cyclo350R | 5′-AATGCCACGGTAGGCCAATA-3′ | Cyclo281T | 5′-CCGGCGATAGATCATTCAAGTTTCTGACC-3′ |
18S rRNA gene PCR according to Varma et al. [31] | |||||
VarmaF | 5′-TGAACTCATTGGACTGACCAGC-3′ | VarmaR | 5′-ACTTTTGCATCCTTTAGAGGGCT-3′ | VarmaP | 5′-TTCGCGGAGCTGGTCGGAAAGTTG-3′ |
hsp70 gene PCR according to Shields et al. [32] | |||||
HMPr36 | 5′-GGGTAAGCCACTTATTGA-3′ | HMPr40 | 5′-GCCTCCTTAACTTCTTTG-3′ | HMPro53 | 5′-CCTTCATCTTCACCAGCACCA-3′ |
Assay | n | Positives (%) | Sensitivity (0.95 CI) | Specificity (0.95 CI) | Kappa (0.95 CI) |
---|---|---|---|---|---|
SSU rRNA gene PCR according to Verweij et al. [30] | 872 | 62 (7.11) | 0.322 (0.200, 0.473) | 0.997 (n.e.) | 0.095 (0.045, 0.164) |
18S rRNA gene PCR according to Varma et al. [31] | 872 | 44 (5.05) | 0.233 (0.142, 0.357) | 0.999 (n.e.) | |
hsp70 PCR according to Shields et al. [32] | 872 | 0 | 0 | 1 (n.e.) | |
Prevalence (0.95 CI) | 0.214 (0.140, 0.314) |
SSU rRNA Gene PCR according to Verweij et al. [30] | |||
---|---|---|---|
Negative | Positive | ||
18S rRNA gene PCR according to Varma et al. [31] | negative | 780 | 48 |
positive | 30 | 14 |
Assay | n | Mean (SD) | Median (Min, Max) |
---|---|---|---|
SSU rRNA gene PCR according to Verweij et al. [30] | 63 | 34.4 (±4.39) | 35.04 (23.78, 43.77) |
SSU rRNA gene PCR according to Verweij et al. [30] for samples also positive in the 18S rRNA gene PCR | 14 | 35.43 (±4.55) | 34.92 (23.78, 42.67) |
18S rRNA gene PCR according to Varma et al. [31] | 45 | 36.92 (±3.26) | 36.53 (30.89, 46.90) |
18S rRNA gene PCR according to Varma et al. [31] for samples also positive in the SSU rRNA gene PCR | 14 | 36.40 (±3.19) | 35.87 (33.60, 46.90) |
hsp70 PCR according to Shields et al. [32] | 0 | n.a. | n.a. |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Weinreich, F.; Hahn, A.; Eberhardt, K.A.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; Loderstädt, U. Comparison of Three Real-Time PCR Assays for the Detection of Cyclospora cayetanensis in Stool Samples Targeting the 18S rRNA Gene and the hsp70 Gene. Pathogens 2022, 11, 165. https://doi.org/10.3390/pathogens11020165
Weinreich F, Hahn A, Eberhardt KA, Feldt T, Sarfo FS, Di Cristanziano V, Frickmann H, Loderstädt U. Comparison of Three Real-Time PCR Assays for the Detection of Cyclospora cayetanensis in Stool Samples Targeting the 18S rRNA Gene and the hsp70 Gene. Pathogens. 2022; 11(2):165. https://doi.org/10.3390/pathogens11020165
Chicago/Turabian StyleWeinreich, Felix, Andreas Hahn, Kirsten Alexandra Eberhardt, Torsten Feldt, Fred Stephen Sarfo, Veronica Di Cristanziano, Hagen Frickmann, and Ulrike Loderstädt. 2022. "Comparison of Three Real-Time PCR Assays for the Detection of Cyclospora cayetanensis in Stool Samples Targeting the 18S rRNA Gene and the hsp70 Gene" Pathogens 11, no. 2: 165. https://doi.org/10.3390/pathogens11020165