Development, Optimisation and Validation of a Novel Multiplex Real-Time PCR Method for the Simultaneous Detection of Cryptosporidium spp., Giardia duodenalis and Dientamoeba fragilis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. DNA Reference Panel
2.3. Primers and Probes
2.4. Optimisation
2.5. Performance Assessment
2.6. Limit of Detection and PCR Efficiency
2.7. Statistical Analyses
3. Results
3.1. Limit of Detection and Efficiency
3.2. Sensitivity and Specificity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- GBD 2016 Diarrhoeal Disease Collaborators. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: A systematic analysis for the Global Burden of Disease Study 2016. Lancet Infect. Dis. 2018, 18, 1211–1228. [Google Scholar] [CrossRef] [Green Version]
- Fischer Walker, C.L.; Sack, D.; Black, R.E. Etiology of diarrhea in older children, adolescents and adults: A systematic review. PLoS Negl. Trop Dis. 2010, 4, e768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collinet-Adler, S.; Ward, H.D. Cryptosporidiosis: Environmental, therapeutic, and preventive challenges. Eur. J. Clin. Microbiol. Infect. Dis. 2010, 29, 927–935. [Google Scholar] [CrossRef] [PubMed]
- Widerström, M.; Schönning, C.; Lilja, M.; Lebbad, M.; Ljung, T.; Allestam, G.; Ferm, M.; Björkholm, B.; Hansen, A.; Hiltula, J.; et al. Large outbreak of Cryptosporidium hominis infection transmitted through the public water supply, Sweden. Emerg. Infect. Dis. 2014, 20, 581–589. [Google Scholar] [CrossRef]
- Ursini, T.; Moro, L.; Requena-Méndez, A.; Bertoli, G.; Buonfrate, D. A review of outbreaks of cryptosporidiosis due to unpasteurized milk. Infection 2020, 48, 659–663. [Google Scholar] [CrossRef]
- van Lieshout, L.; Verweij, J.J. Newer diagnostic approaches to intestinal protozoa. Curr. Opin. Infect. Dis. 2010, 23, 488–493. [Google Scholar] [CrossRef]
- van Gestel, R.S.; Kusters, J.G.; Monkelbaan, J.F. A clinical guideline on Dientamoeba fragilis infections. Parasitology 2019, 146, 1131–1139. [Google Scholar]
- Jokelainen, P.; Hebbelstrup Jensen, B.; Andreassen, B.U.; Petersen, A.M.; Röser, D.; Krogfelt, K.A.; Nielsen, H.V.; Stensvold, C.R. Dientamoeba fragilis, a commensal in children in Danish day care centers. J. Clin. Microbiol. 2017, 55, 1707–1713. [Google Scholar] [CrossRef] [Green Version]
- Gray, T.J.; Kwan, Y.L.; Phan, T.; Robertson, G.; Cheong, E.Y.; Gottlieb, T. Dientamoeba fragilis: A family cluster of disease associated with marked peripheral eosinophilia. Clin. Infect. Dis. 2013, 57, 845–848. [Google Scholar] [CrossRef] [Green Version]
- Friesen, J.; Fuhrmann, J.; Kietzmann, H.; Tannich, E.; Müller, M.; Ignatius, R. Evaluation of the Roche LightMix Gastro parasites multiplex PCR assay detecting Giardia duodenalis, Entamoeba histolytica, cryptosporidia, Dientamoeba fragilis, and Blastocystis hominis. Clin. Microbiol. Infect. 2018, 24, 1333–1337. [Google Scholar] [CrossRef] [Green Version]
- Verweij, J.J. Application of PCR-based methods for diagnosis of intestinal parasitic infections in the clinical laboratory. Parasitology 2014, 141, 1863–1872. [Google Scholar] [CrossRef] [PubMed]
- van Lieshout, L.; Roestenberg, M. Clinical consequences of new diagnostic tools for intestinal parasites. Clin. Microbiol. Infect. 2015, 21, 520–528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verweij, J.J.; Stensvold, C.R. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clin. Microbiol. Rev. 2014, 27, 371–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verweij, J.J.; Mulder, B.; Poell, B.; van Middelkoop, D.; Brienen, E.A.; van Lieshout, L. Real-time PCR for the detection of Dientamoeba fragilis in fecal samples. Mol. Cell Probes 2007, 21, 400–404. [Google Scholar] [CrossRef]
- Cacciò, S.M.; Chalmers, R.M. Human cryptosporidiosis in Europe. Clin. Microbiol. Infect. 2016, 22, 471–480. [Google Scholar] [CrossRef] [Green Version]
- Lebbad, M.; Winiecka-Krusnell, J.; Stensvold, C.R.; Beser, J. High diversity of Cryptosporidium species and subtypes identified in cryptosporidiosis acquired in Sweden and abroad. Pathogens 2021, 10, 523. [Google Scholar] [CrossRef]
- Barratt, J.L.; Harkness, J.; Marriott, D.; Ellis, J.T.; Stark, D. The ambiguous life of Dientamoeba fragilis: The need to investigate current hypotheses on transmission. Parasitology 2011, 138, 557–572. [Google Scholar] [CrossRef] [Green Version]
- Svec, D.; Tichopad, A.; Novosadova, V.; Pfaffl, M.W.; Kubista, M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomol. Detect Quantif. 2015, 11, 9–16. [Google Scholar] [CrossRef] [Green Version]
- Zamora, J.; Abraira, V.; Muriel, A.; Khan, K.; Coomarasamy, A. Meta-DiSc: A software for meta-analysis of test accuracy data. BMC Med. Res. Methodol. 2006, 6, 31. [Google Scholar] [CrossRef]
- Stensvold, C.R.; Clark, C.G.; Röser, D. Limited intra-genetic diversity in Dientamoeba fragilis housekeeping genes. Infect. Genet. Evol. 2013, 18, 284–286. [Google Scholar] [CrossRef] [Green Version]
- Cacciò, S.M.; Sannella, A.R.; Bruno, A.; Stensvold, C.R.; David, E.B.; Guimarães, S.; Manuali, E.; Magistrali, C.; Mahdad, K.; Beaman, M.; et al. Multilocus sequence typing of Dientamoeba fragilis identified a major clone with widespread geographical distribution. Int. J. Parasitol. 2016, 46, 793–798. [Google Scholar] [CrossRef] [PubMed]
- Paulos, S.; Saugar, J.M.; de Lucio, A.; Fuentes, I.; Mateo, M.; Carmena, D. Comparative performance evaluation of four commercial multiplex real-time PCR assays for the detection of the diarrhoea-causing protozoa Cryptosporidium hominis/parvum, Giardia duodenalis and Entamoeba histolytica. PLoS ONE 2019, 14, e0215068. [Google Scholar] [CrossRef] [PubMed]
- Dashti, A.; Alonso, H.; Escolar-Miñana, C.; Köster, P.C.; Bailo, B.; Carmena, D.; González-Barrio, D. Evaluation of a novel commercial real-time PCR assay for the simultaneous detection of Cryptosporidium spp., Giardia duodenalis, and Entamoeba histolytica. Microbiol. Spectr. 2022, 10, e0053122. [Google Scholar] [CrossRef] [PubMed]
- Stark, D.; Al-Qassab, S.E.; Barratt, J.L.; Stanley, K.; Roberts, T.; Marriott, D.; Harkness, J.; Ellis, J.T. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples. J. Clin. Microbiol. 2011, 49, 257–262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McAuliffe, G.N.; Anderson, T.P.; Stevens, M.; Adams, J.; Coleman, R.; Mahagamasekera, P.; Young, S.; Henderson, T.; Hofmann, M.; Jennings, L.C.; et al. Systematic application of multiplex PCR enhances the detection of bacteria, parasites, and viruses in stool samples. J. Infect. 2013, 67, 122–129. [Google Scholar] [CrossRef] [PubMed]
- Perry, M.D.; Corden, S.A.; Howe, R.A. Evaluation of the Luminex xTAG Gastrointestinal Pathogen Panel and the Savyon Diagnostics Gastrointestinal Infection Panel for the detection of enteric pathogens in clinical samples. J. Med. Microbiol. 2014, 63, 1419–1426. [Google Scholar] [CrossRef] [Green Version]
- Stark, D.; Roberts, T.; Ellis, J.T.; Marriott, D.; Harkness, J. Evaluation of the EasyScreen™ enteric parasite detection kit for the detection of Blastocystis spp., Cryptosporidium spp., Dientamoeba fragilis, Entamoeba complex, and Giardia intestinalis from clinical stool samples. Diagn. Microbiol. Infect. Dis. 2014, 78, 149–152. [Google Scholar] [CrossRef]
- Buss, S.N.; Leber, A.; Chapin, K.; Fey, P.D.; Bankowski, M.J.; Jones, M.K.; Rogatcheva, M.; Kanack, K.J.; Bourzac, K.M. Multicenter evaluation of the BioFire FilmArray gastrointestinal panel for etiologic diagnosis of infectious gastroenteritis. J. Clin. Microbiol. 2015, 53, 915–925. [Google Scholar] [CrossRef] [Green Version]
- Batra, R.; Judd, E.; Eling, J.; Newsholme, W.; Goldenberg, S.D. Molecular detection of common intestinal parasites: A performance evaluation of the BD Max™ Enteric Parasite Panel. Eur. J. Clin. Microbiol. Infect. Dis. 2016, 35, 1753–1757. [Google Scholar] [CrossRef]
- Ken Dror, S.; Pavlotzky, E.; Barak, M. Evaluation of the NanoCHIP® Gastrointestinal Panel (GIP) test for simultaneous detection of parasitic and bacterial enteric pathogens in fecal specimens. PLoS ONE 2016, 11, e0159440. [Google Scholar] [CrossRef] [Green Version]
- Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; Le Govic, Y.; Dalle, F.; Botterel, F.; et al. Is real-time PCR-based diagnosis similar in performance to routine parasitological examination for the identification of Giardia intestinalis, Cryptosporidium parvum/Cryptosporidium hominis and Entamoeba histolytica from stool samples? Evaluation of a new commercial multiplex PCR assay and literature review. Clin. Microbiol. Infect. 2016, 22, 190.e1–190.e8. [Google Scholar] [PubMed]
- Madison-Antenucci, S.; Relich, R.F.; Doyle, L.; Espina, N.; Fuller, D.; Karchmer, T.; Lainesse, A.; Mortensen, J.E.; Pancholi, P.; Veros, W.; et al. Multicenter evaluation of BD Max Enteric Parasite Real-Time PCR assay for detection of Giardia duodenalis, Cryptosporidium hominis, Cryptosporidium parvum, and Entamoeba histolytica. J. Clin. Microbiol. 2016, 54, 2681–2688. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frickmann, H.; Hoffmann, T.; Köller, T.; Hahn, A.; Podbielski, A.; Landt, O.; Loderstädt, U.; Tannich, E. Comparison of five commercial real-time PCRs for in-vitro diagnosis of Entamoeba histolytica, Giardia duodenalis, Cryptosporidium spp., Cyclospora cayetanensis, and Dientamoeba fragilis in human stool samples. Travel Med. Infect. Dis. 2021, 41, 102042. [Google Scholar] [CrossRef] [PubMed]
- Argy, N.; Nourrisson, C.; Aboubacar, A.; Poirier, P.; Valot, S.; Laude, A.; Desoubeaux, G.; Pomares, C.; Machouart, M.; Le Govic, Y.; et al. Selecting a multiplex PCR panel for accurate molecular diagnosis of intestinal protists: A comparative study of Allplex® (Seegene®), G-DiaParaTrio (Diagenode®), and RIDA®GENE (R-Biopharm®) assays and microscopic examination. Parasite 2022, 29, 5. [Google Scholar] [CrossRef] [PubMed]
- Basmaciyan, L.; François, A.; Vincent, A.; Valot, S.; Bonnin, A.; Costa, D.; Razakandrainibe, R.; Morio, F.; Favennec, L.; Dalle, F. Commercial simplex and multiplex PCR assays for the detection of intestinal parasites Giardia intestinalis, Entamoeba spp., and Cryptosporidium spp.: Comparative evaluation of seven commercial PCR kits with routine in-house simplex PCR assays. Microorganisms 2021, 9, 2325. [Google Scholar] [CrossRef] [PubMed]
- Garcia, L.S. Dientamoeba fragilis, one of the neglected intestinal protozoa. J. Clin. Microbiol. 2016, 54, 2243–2250. [Google Scholar] [CrossRef] [Green Version]
- Windsor, J.J.; Rafay, A.M. Laboratory detection of Dientamoeba fragilis. Br. J. Biomed. Sci. 1997, 54, 223–224. [Google Scholar]
- Gough, R.; Ellis, J.; Stark, D. Comparison and recommendations for use of Dientamoeba fragilis real-time PCR assays. J. Clin. Microbiol. 2019, 57, e01466–e01518. [Google Scholar] [CrossRef] [Green Version]
- Binnicker, M.J. Multiplex molecular panels for diagnosis of gastrointestinal infection: Performance, result interpretation, and cost-effectiveness. J. Clin. Microbiol. 2015, 53, 3723–3728. [Google Scholar] [CrossRef] [Green Version]
- Ryan, U.; Paparini, A.; Oskam, C. New technologies for detection of enteric parasites. Trends Parasitol. 2017, 33, 532–546. [Google Scholar] [CrossRef]
Phylum | Genus | Species | DNA Samples (n) |
---|---|---|---|
Apicomplexa | Cryptosporidium | C. cuniculus | 1 |
C. hominis | 72 | ||
C. meleagridis | 4 | ||
C. parvum | 30 | ||
Cryptosporidium spp. 1 | 19 | ||
Metamonada | Giardia | G. duodenalis | 132 |
Dientamoeba | D. fragilis | 49 | |
Amoebozoa | Entamoeba | E. histolytica | 27 |
E. dispar | 11 | ||
Apicomplexa | Babesia | B. divergens | 1 |
Besnoitia | B. besnoiti | 4 | |
B. tarandi | 1 | ||
Neospora | N. caninum | 5 | |
Plasmodium | P. falciparum | 13 | |
P. malariae | 1 | ||
P. ovale | 4 | ||
P. vivax | 2 | ||
Sarcocystis | S. tenella | 5 | |
Toxoplasma | T. gondii | 5 | |
Euglenozoa | Leishmania | L. aethiopica | 1 |
L. amazonensis | 1 | ||
L. braziliensis | 1 | ||
L. donovani | 1 | ||
L. infantum | 1 | ||
L. major | 1 | ||
L. mexicana | 1 | ||
L. tropica | 1 | ||
Trypanosoma | T. cruzi | 5 | |
Microsporidia | Enterocytozoon | E. bieneusi | 3 |
Nematoda | Ancylostoma | A. duodenale | 2 |
Ascaris | A. lumbricoides | 2 | |
Necator | N. americanus | 1 | |
Trichuris | T. muris | 1 | |
Strongyloides | S. venezuelensis | 2 | |
Platyhelminthes | Taenia | T. saginata | 1 |
T. solium | 1 | ||
Sub-total | 412 | ||
Healthy patients | Uninfected | Uninfected | 12 |
Total | 424 |
Target Organism | Target Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Probe (5′-3′) |
---|---|---|---|---|
Cryptosporidium spp. | cowp1 | CAAATTGATACCGTTTGTCCTTCTG | GGCATGTCGATTCTAATTCAGCT | ROX–TGCCATACATTGTTGTCCTGACAAATTGAAT–BHQ |
Giardia duodenalis | ssu rRNA | GACGGCTCAGGACAACGGTT | TTGCCAGCGGTGTCCG | FAM–CCCGCGGCGGTCCCTGCTAG–BHQ1 |
Dientamoeba fragilis | ITS | CAACGGATGTCTTGGCTCTTTA | TGCATTCAAAGATCGAACTTATCAC | HEX–CAATTCTAGCCGCTTAT–MGB |
Internal control | Synthetic 1 | ACATTCGCAACATACGCCATACT | TAAGACAGCTGCTACAGGCACACT | Cyanine5–ATCCGCGCACCTGCCGTCTCTA–BHQ2 |
Target Organism | qPCR Format | Variable | Real-Time PCR Cycle Threshold (CT) Values by (oo)cyst Number or DNA Concentration | R2 | Slope | Efficiency (%) | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Cryptosporidium spp. | Oocysts (n) | 1 × 104 | 1 × 103 | 1 × 102 | 1 × 101 | 1 | 1 × 10−1 | 1 × 10−2 | 1 × 10−3 | ||||
Singleplex | 24.07 | 27.22 | 30.25 | 33.47 | 37.52 | Neg. | Neg. | Neg. | 0.990 | –3.31 | 100.3 | ||
Multiplex | 24.17 | 27.56 | 30.54 | 33.73 | 36.55 | Neg. | Neg. | Neg. | 0.999 | –3.10 | 110 | ||
Giardia duodenalis | Cysts (n) | 5 × 102 | 5 × 101 | 5 | 5 × 10−1 | 5 × 10−2 | 5 × 10−3 | 5 × 10−4 | 5×10−5 | ||||
Singleplex | 22.31 | 25.93 | 28.99 | 33.56 | Neg. | Neg. | Neg. | Neg. | 0.994 | –3.68 | 86.9 | ||
Multiplex | 22.81 | 26.37 | 29.57 | 32.72 | 36.39 | 36.80 | 37.72 | Neg. | 0.999 | –3.35 | 98.8 | ||
Dientamoeba fragilis | [DNA] | Neat | 1 × 10−1 | 1 × 10−2 | 1 × 10−3 | 1 × 10−4 | 1 × 10−5 | 1 × 10−6 | 1 × 10−7 | ||||
Singleplex | 21.74 | 25.29 | 28.47 | 31.81 | 35.26 | 35.72 | 37.25 | 36.70 | 1 | –3.35 | 98.6 | ||
Multiplex | 22.14 | 25.34 | 28.58 | 31.85 | 35.18 | 38.64 | 37.63 | Neg. | 1 | –3.29 | 101.1 |
Target organism | Accuracy 1 (95% CI) | TP | TN | FP | FN | Sensitivity (95% CI) | Specificity (95% CI) | Positive Predictive Value | Negative Predictive Value (95% CI) |
---|---|---|---|---|---|---|---|---|---|
Cryptosporidium spp. | 0.97 (0.94–0.99) | 126 | 119 | 0 | 7 | 0.94 (0.89–0.98) | 1.00 (0.96–1.00) | 1.00 | 0.94 (0.89–0.97) |
Giardia duodenalis | 0.99 (0.96–0.99) | 132 | 129 | 0 | 3 | 0.97 (0.94–0.99) | 1.00 (0.97–1.00) | 1.00 | 0.97 (0.93–0.99) |
Dientamoeba fragilis | 0.97 (0.93–0.99) | 49 | 44 | 0 | 5 | 0.90 (0.80–0.97) | 1.00 (0.97–1.00) | 1.00 | 0.96 (0.91–0.98) |
All three | 0.97 (0.94–0.98) | 307 | 292 | 0 | 15 | 0.95 (0.92–0.97) | 1.00 (0.97–1.00) | 1.00 | 0.89 (0.83–0.93) |
Protozoan Species | (mqPCR+/sqPCR+) | (mqPCR–/sqPCR+) | (mqPCR+/sqPCR–) | (mqPCR–/sqPCR–) | Kappa Test | % Agreement |
---|---|---|---|---|---|---|
Cryptosporidium spp. | 119 | 7 | 0 | 117 | 0.942 | 97.1 |
Giardia duodenalis | 129 | 3 | 0 | 117 | 0.976 | 98.8 |
Dientamoeba fragilis | 44 | 5 | 0 | 117 | 0.925 | 96.9 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sánchez, I.; Dashti, A.; Köster, P.C.; Bailo, B.; González, N.; Allende, J.; Stensvold, C.R.; Carmena, D.; González-Barrio, D. Development, Optimisation and Validation of a Novel Multiplex Real-Time PCR Method for the Simultaneous Detection of Cryptosporidium spp., Giardia duodenalis and Dientamoeba fragilis. Pathogens 2022, 11, 1277. https://doi.org/10.3390/pathogens11111277
Sánchez I, Dashti A, Köster PC, Bailo B, González N, Allende J, Stensvold CR, Carmena D, González-Barrio D. Development, Optimisation and Validation of a Novel Multiplex Real-Time PCR Method for the Simultaneous Detection of Cryptosporidium spp., Giardia duodenalis and Dientamoeba fragilis. Pathogens. 2022; 11(11):1277. https://doi.org/10.3390/pathogens11111277
Chicago/Turabian StyleSánchez, Isbene, Alejandro Dashti, Pamela C. Köster, Begoña Bailo, Nuria González, Janire Allende, Christen Rune Stensvold, David Carmena, and David González-Barrio. 2022. "Development, Optimisation and Validation of a Novel Multiplex Real-Time PCR Method for the Simultaneous Detection of Cryptosporidium spp., Giardia duodenalis and Dientamoeba fragilis" Pathogens 11, no. 11: 1277. https://doi.org/10.3390/pathogens11111277
APA StyleSánchez, I., Dashti, A., Köster, P. C., Bailo, B., González, N., Allende, J., Stensvold, C. R., Carmena, D., & González-Barrio, D. (2022). Development, Optimisation and Validation of a Novel Multiplex Real-Time PCR Method for the Simultaneous Detection of Cryptosporidium spp., Giardia duodenalis and Dientamoeba fragilis. Pathogens, 11(11), 1277. https://doi.org/10.3390/pathogens11111277