Evidences of Colletotrichum fructicola Causing Anthracnose on Passiflora edulis Sims in China
Abstract
:1. Introduction
2. Results
2.1. Field Symptoms
2.2. Pathogenicity Test
2.3. Morphological Identification
2.4. Phylogenetic Analyses
2.5. Fungicides Screening
3. Discussion
4. Materials and Methods
4.1. Pathogen Isolation and Purification
4.2. Pathogenicity Assay
4.3. Pathogen Identification and Phylogenetic Analyses
4.4. Synthetic Fungicides Screening
4.5. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sandupatla, R.; Dongamanti, A.; Koyyati, R. Antimicrobial and antioxidant activities of phytosynthesized Ag, Fe and bimetallic Fe-Ag nanoparticles using Passiflora edulis: A comparative study. Mater. Today Proc. 2021, 44, 2665–2673. [Google Scholar] [CrossRef]
- dos Reis, L.C.R.; Facco, E.M.P.; Salvador, M.; Flôres, S.H.; de Oliveira Rios, A. Antioxidant potential and physicochemical characterization of yellow, purple and orange passion fruit. J. Food Sci. Technol. 2018, 55, 2679–2691. [Google Scholar] [CrossRef]
- Lin, Y.; He, H.; Huang, Q.; An, F.; Song, H. Flash extraction optimization of low-temperature soluble pectin from passion fruit peel (Passiflora edulis f. flavicarpa) and its soft gelation properties. Food Bioprod. Processing 2020, 123, 409–418. [Google Scholar] [CrossRef]
- Xia, Z.; Huang, D.; Zhang, S.; Wang, W.; Ma, F.; Wu, B.; Xu, Y.; Xu, B.; Chen, D.; Zou, M.; et al. Chromosome-scale genome assembly provides insights into the evolution and flavor synthesis of passion fruit (Passiflora edulis Sims). Hortic. Res. 2021, 8, 14. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Koike, R.; Yamamoto, A.; Ukiya, M.; Fukatsu, M.; Banno, N.; Miura, M.; Motohashi, S.; Tokuda, H.; Akihisa, T. Glycosidic Inhibitors of Melanogenesis from Leaves of Passiflora edulis. Chem. Biodivers. 2013, 10, 1851–1865. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Xin, M.; Li, L.; He, X.; Yi, P.; Tang, Y.; Li, J.; Zheng, F.; Liu, G.; Sheng, J.; et al. Characterization of the aromatic profile of purple passion fruit (Passiflora edulis Sims) during ripening by HS-SPME-GC/MS and RNA sequencing. Food Chem. 2021, 355, 129685. [Google Scholar] [CrossRef] [PubMed]
- Xin, M.; Li, C.; He, X.; Li, L.; Yi, P.; Tang, Y.; Li, J.; Liu, G.; Sheng, J.; Sun, J. Integrated metabolomic and transcriptomic analyses of quality components and associated molecular regulation mechanisms during passion fruit ripening. Postharvest Biol. Technol. 2021, 180, 111601. [Google Scholar] [CrossRef]
- Lan, H.; Lai, B.; Zhao, P.; Dong, X.; Wei, W.; Ye, Y.; Wu, Z. Cucumber mosaic virus infection modulated the phytochemical contents of Passiflora edulis. Microb. Pathog. 2020, 138, 103828. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira, C.F.; Gurak, P.D.; Cladera-Olivera, F.; Marczak, L.D.F.; Karwe, M. Combined Effect of High-Pressure and Conventional Heating on Pectin Extraction from Passion Fruit Peel. Food Bioprocess Technol. 2016, 9, 1021–1030. [Google Scholar] [CrossRef]
- He, X.; Luan, F.; Yang, Y.; Wang, Z.; Zhao, Z.; Fang, J.; Wang, M.; Zuo, M.; Li, Y. Passiflora edulis: An Insight Into Current Researches on Phytochemistry and Pharmacology. Front. Pharmacol. 2020, 11, 617. [Google Scholar] [CrossRef] [PubMed]
- Kiefer, J.; Lampe, A.I.; Nicoli, S.F.; Lucarini, M.; Durazzo, A. Identification of Passion Fruit Oil Adulteration by Chemometric Analysis of FTIR Spectra. Molecules 2019, 24, 3219. [Google Scholar] [CrossRef] [Green Version]
- Silva, G.C.; Rodrigues, R.A.F.; Bottoli, C.B.G. Passion fruit seed extract enriched in piceatannol obtained by microwave-assisted extraction. Sustain. Chem. Pharm. 2021, 22, 100472. [Google Scholar] [CrossRef]
- Bordoh, P.K.; Ali, A.; Dickinson, M.; Siddiqui, Y.; Romanazzi, G. A review on the management of postharvest anthracnose in dragon fruits caused by Colletotrichum spp. Crop Prot. 2020, 130, 105067. [Google Scholar] [CrossRef]
- Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum—current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [Green Version]
- Dean, R.; Kan, J.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Pietro, A.D.; Spanu, P.D.; Foster, G.D. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [Green Version]
- Sun, H.; Sun, L.; Hong, Y.; Liang, Y. First report of anthracnose on Hosta ventricosa caused by Colletotrichum spaethianum in China. Crop Prot. 2020, 131, 105104. [Google Scholar] [CrossRef]
- Benatar, G.V.; Wibowo, A. First report of Colletotrichum asianum associated with mango fruit anthracnose in Indonesia. Crop Prot. 2021, 141, 105432. [Google Scholar] [CrossRef]
- Uysal, A.; Kurt, S. First report of fruit and leaf anthracnose caused by Colletotrichum karstii on avocado in Turkey. Crop Prot. 2020, 133, 105145. [Google Scholar] [CrossRef]
- Li, X.; Jing, T.; Zhou, D.; Zhang, M.; Qi, D.; Zang, X.; Zhao, Y.; Li, K.; Tang, W.; Chen, Y.; et al. Biocontrol efficacy and possible mechanism of Streptomyces sp. H4 against postharvest anthracnose caused by Colletotrichum fragariae on strawberry fruit. Postharvest Biol. Technol. 2021, 175, 111401. [Google Scholar] [CrossRef]
- Santos, J.T.d.C.; Petry, F.C.; Tobaruela, E.d.C.; Mercadante, A.Z.; Gloria, M.B.A.; Costa, A.M.; Lajolo, F.M.; Hassimotto, N.M.A. Brazilian native passion fruit (Passiflora tenuifila Killip) is a rich source of proanthocyanidins, carotenoids, and dietary fiber. Food Res. Int. 2021, 147, 110521. [Google Scholar] [CrossRef]
- Mattoo, A.J.; Nonzom, S. Endophytic fungi: Understanding complex cross-talks. Symbiosis 2021, 83, 237–264. [Google Scholar] [CrossRef]
- Yang, Z.; Mo, J.; Guo, T.; Li, Q.; Tang, L.; Huang, S.; Wei, J.; Hsiang, T. First report of Colletotrichum fructicola causing anthracnose on Pouteria campechiana in China. Plant Dis. 2020. online ahead of print. [Google Scholar] [CrossRef]
- Nantawanit, N.; Chanchaichaovivat, A.; Panijpan, B.; Ruenwongsa, P. Induction of defense response against Colletotrichum capsici in chili fruit by the yeast Pichia guilliermondii strain R13. Biol. Control. 2010, 52, 145–152. [Google Scholar] [CrossRef]
- Li, C.; Tang, B.; Cao, S.; Bao, Y.; Sun, W.; Zhao, Y.; Liu, F. Biocontrol ability and action mechanism of dihydromaltophilin against Colletotrichum fructicola causing anthracnose of pear fruit. Pest Manag. Sci. 2021, 77, 1061–1069. [Google Scholar] [CrossRef]
- Liu, W.; Liang, X.; Gleason, M.L.; Cao, M.; Zhang, R.; Sun, G. Transcription Factor CfSte12 of Colletotrichum fructicola Is a Key Regulator of Early Apple Glomerella Leaf Spot Pathogenesis. Appl. Environ. Microbiol. 2020, 87, e02212-20. [Google Scholar] [CrossRef] [PubMed]
- He, C.; Duan, K.; Zhang, L.; Zhang, L.; Song, L.; Yang, J.; Zou, X.; Wang, Y.; Gao, Q. Fast Quenching the Burst of Host Salicylic Acid Is Common in Early Strawberry/Colletotrichum fructicola Interaction. Phytopathology 2019, 109, 531–541. [Google Scholar] [CrossRef] [Green Version]
- Pei, S.; Liu, R.; Gao, H.; Chen, H.; Wu, W.; Fang, X.; Han, Y. Inhibitory effect and possible mechanism of carvacrol against Colletotrichum fructicola. Postharvest Biol. Technol. 2020, 163, 111126. [Google Scholar] [CrossRef]
- Lin, S.R.; Yu, S.Y.; Chang, T.D.; Lin, Y.J.; Wen, C.J.; Lin, Y.H. First Report of Anthracnose Caused by Colletotrichum fructicola on Tea in Taiwan. Plant Dis. 2021, 105, 710. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, D.d.C.; Ribeiro, W.R.; Gonçalves, D.C.; Menini, L.; Costa, H. Recent Advances and Future Perspective of Essential Oils in Control Colletotrichum Spp.: A Sustainable Alternative in Postharvest Treatment of Fruits. Food Res. Int. 2021, 150, 110758. [Google Scholar] [CrossRef]
- Shi, X.-C.; Wang, S.-Y.; Duan, X.-C.; Wang, Y.-Z.; Liu, F.-Q.; Laborda, P. Biocontrol Strategies for the Management of Colletotrichum Species in Postharvest Fruits. Crop Prot. 2021, 141, 105454. [Google Scholar] [CrossRef]
- Shi, Y.; Meng, S.; Xie, X.; Chai, A.; Li, B. Dry Heat Treatment Reduces the Occurrence of Cladosporium Cucumerinum, Ascochyta Citrullina, and Colletotrichum Orbiculare on the Surface and Interior of Cucumber Seeds. Hortic. Plant J. 2016, 2, 35–40. [Google Scholar] [CrossRef] [Green Version]
- Heick, T.M.; Justesen, A.F.; Jørgensen, L.N. Anti-resistance strategies for fungicides against wheat pathogen Zymoseptoria tritici with focus on DMI fungicides. Crop Prot. 2017, 99, 108–117. [Google Scholar] [CrossRef]
- Rossi, V.; Caffi, T.; Legler, S.E.; Fedele, G. A method for scoring the risk of fungicide resistance in vineyards. Crop Prot. 2021, 143, 105477. [Google Scholar] [CrossRef]
- Lima, N.B.; Lima, W.G.; Tovar-Pedraza, J.M.; Michereff, S.J.; Câmara, M.P.S. Comparative epidemiology of Colletotrichum species from mango in northeastern Brazil. Eur. J. Plant Pathol. 2015, 141, 679–688. [Google Scholar] [CrossRef]
- Shi, N.-N.; Ruan, H.-C.; Jie, Y.-L.; Chen, F.-R.; Du, Y.-X. Characterization, fungicide sensitivity and efficacy of Colletotrichum spp. from chili in Fujian, China. Crop Prot. 2021, 143, 105572. [Google Scholar] [CrossRef]
- Damm, U.; O’Connell, R.J.; Groenewald, J.Z.; Crous, P.W. The Colletotrichum destructivum species complex—Hemibiotrophic pathogens of forage and field crops. Stud. Mycol. 2014, 79, 49–84. [Google Scholar] [CrossRef]
- Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [PubMed] [Green Version]





| Fungicides | Regression Equation of Toxicity | EC50 (mg·L−1) | Correlation Coefficient (r) |
|---|---|---|---|
| Difenoconazole 10% WG | y = 0.9798x + 5.2483 | 0.5579 | 0.9924 |
| Trifloxystrobin·Tebuconazole 75% WG | y = 0.7884x + 5.7747 | 1.0354 | 0.9890 |
| Procyclidine·Azoxystrobin 18.7% SE | y = 1.2606x + 4.4417 | 2.7726 | 0.9938 |
| Fluopyram·Tebuconazole 35% SC | y = 0.8860x + 4.5982 | 2.8415 | 0.9994 |
| Benzaldehyde·Pyraclostrobin 17% SC | y = 0.6844x + 4.5176 | 5.0687 | 0.9703 |
| Fluxapyroxad·Pyraclostrobin 42.4% SC | y = 1.0221x + 4.2460 | 5.4645 | 0.9985 |
| Gene | Primer | Primer Sequences (5′–3′) |
|---|---|---|
| ITS | ITS1 ITS4 | TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC |
| GAPDH | GDF GDR | GCCGTCAACGACCCCTTCATTGA GGGTGGAGTCGTACTTGAGCATGT |
| ACT | ACT-512F ACT-783R | ATGTGCAAGGCCGGTTTCGC TACGAGTCCTTCTGGCCCAT |
| CHS-1 | CHS-79F CHS-354R | TGGGGCAAGGATGCTTGGAAGAAG TGGAAGAACCATCTGTGAGAGTTG |
| Species | Strain No. | GeneBank Accession Number | |||
|---|---|---|---|---|---|
| ITS | GAPDH | ACT | CHS-1 | ||
| C. aenigma | ICMP18608 * | JX010244 | JX010044 | JX009443 | JX009774 |
| ICMP18686 | JX010243 | JX009913 | JX009519 | JX009789 | |
| C. alatae | CBS304.67 * | JX010190 | JX009990 | JX009471 | JX009837 |
| ICMP18122 | JX010191 | JX010011 | JX009470 | JX009846 | |
| C. alienum | IMI313842 | JX010217 | JX010018 | JX009580 | JX009754 |
| ICMP12071 * | JX010251 | JX010028 | JX009572 | JX009882 | |
| C. aotearoa | ICMP18532 | JX010220 | JX009906 | JX009544 | JX009764 |
| ICMP18537 * | JX010205 | JX010005 | JX009564 | JX009853 | |
| C. asianum | IMI313839 | JX010192 | JX009015 | JX009576 | JX009753 |
| ICMP18580 * | FJ972612 | JX010053 | FJ917506 | JX009584 | |
| C. clidemiae | ICMP18706 | JX010274 | JX009909 | JX009476 | JX009777 |
| ICMP18658 * | JX010265 | JX009989 | JX009537 | JX009877 | |
| C. cordylinicola | MFLUCC090551 * | JX010226 | JX009975 | HM470235 | JX009864 |
| C. fructicola | ICMP18613 | JX010167 | JX009998 | JX009491 | JX009772 |
| ICMP18581 * | JX010165 | JX010033 | FJ907426 | JX009866 | |
| C. gloeosporioides | IMI356878 * | JX010152 | JX010056 | JX009531 | JX009818 |
| BXG-2 ★ | - | - | - | - | |
| C. horii | ICMP12942 | GQ329687 | GQ329685 | JX009533 | JX009748 |
| NBRC7478 * | GQ329690 | GQ329681 | JX009438 | JX009752 | |
| C. musae | IMI52264 | JX010142 | JX010015 | JX009432 | JX009815 |
| CBS116870 * | JX010146 | JX010050 | JX009433 | JX009896 | |
| C. nupharicola | CBS469.96 | JX010189 | JX009936 | JX009486 | JX009834 |
| CBS470.96 * | JX010187 | JX009972 | JX009437 | JX009835 | |
| M. infuscans | CBS869.96 | JQ005780 | JX546612 | JQ005843 | JQ005801 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, W.; Ran, F.; Long, Y.; Mo, F.; Shu, R.; Yin, X. Evidences of Colletotrichum fructicola Causing Anthracnose on Passiflora edulis Sims in China. Pathogens 2022, 11, 6. https://doi.org/10.3390/pathogens11010006
Li W, Ran F, Long Y, Mo F, Shu R, Yin X. Evidences of Colletotrichum fructicola Causing Anthracnose on Passiflora edulis Sims in China. Pathogens. 2022; 11(1):6. https://doi.org/10.3390/pathogens11010006
Chicago/Turabian StyleLi, Wenzhi, Fei Ran, Youhua Long, Feixu Mo, Ran Shu, and Xianhui Yin. 2022. "Evidences of Colletotrichum fructicola Causing Anthracnose on Passiflora edulis Sims in China" Pathogens 11, no. 1: 6. https://doi.org/10.3390/pathogens11010006
APA StyleLi, W., Ran, F., Long, Y., Mo, F., Shu, R., & Yin, X. (2022). Evidences of Colletotrichum fructicola Causing Anthracnose on Passiflora edulis Sims in China. Pathogens, 11(1), 6. https://doi.org/10.3390/pathogens11010006

