Multilocus Sequence Analysis of Selected Housekeeping- and Pathogenicity-Related Genes in Venturia inaequalis
Abstract
1. Introduction
2. Results
2.1. Phylogenetic Analyses
2.2. Intragene Polymorphisms
2.3. DNA Divergence and Differentiation between Strains of Rvi6-Virulent and -Avirulent Populations
2.4. Recombination and Linkage Disequilibrium Analysis
3. Discussion
3.1. Phylogenetic Relationships between Rvi6-Virulent and Rvi6-Avirulent Strains
3.2. Factors Influencing the Genetic Diversity and Divergence among Rvi6-Virulent and Rvi6-Avirulent Strains
3.3. Recombination between Rvi6-Virulent and Rvi6-Avirulent Strains
4. Materials and Methods
4.1. Collection of Fungal Samples
4.2. Designing Primers for PCR and Amplification of Pathogenicity-Related Genes
4.3. Amplification of Housekeeping Genes
4.4. Polymorphism and Intragene Differences Analyses
4.5. Structure Analyses
4.6. Model Selection and Phylogenetic Analysis
4.7. Detection of Recombination
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- MacHardy, W.E. Apple Scab: Biology, Epidemiology, and Management; American Phytopathological Society (APS Press): St Paul., MN, USA, 1996. [Google Scholar]
- Bus, V.G.; Rikkerink, E.H.; Caffier, V.; Durel, C.E.; Plummer, K.M. Revision of the nomenclature of the differential host-pathogen interactions of Venturia inaequalis and Malus. Annu. Rev. Phytopathol. 2011, 49, 391–413. [Google Scholar] [CrossRef] [PubMed]
- Tenzer, I.; degli Ivanissevich, S.; Morgante, M.; Gessler, C. Identification of microsatellite markers and their application to population genetics of Venturia inaequalis. Phytopathology 1999, 89, 748–753. [Google Scholar] [CrossRef]
- Guérin, F.; Franck, P.; Loiseau, A.; Devaux, M.; Le Cam, B. Isolation of 21 new polymorphic microsatellite loci in the phytopathogenic fungus Venturia inaequalis. Mol. Ecol. Notes 2004, 4, 268–270. [Google Scholar] [CrossRef]
- Guérin, F.; Gladieux, P.; Le Cam, B. Origin and colonization history of newly virulent strains of the phytopathogenic fungus Venturia inaequalis. Fungal Genet. Biol. 2007, 44, 284–292. [Google Scholar] [CrossRef]
- Guérin, F.; Le Cam, B. Breakdown of the scab resistance gene Vf in apple leads to a founder effect in populations of the fungal pathogen Venturia inaequalis. Phytopathology 2004, 94, 364–369. [Google Scholar] [CrossRef] [PubMed]
- Gladieux, P.; Zhang, X.G.; Róldan-Ruiz, I.; Caffier, V.; Leroy, T.; Devaux, M.; Van Glabeke, S.; Coart, E.; Le Cam, B. Evolution of the population structure of Venturia inaequalis, the apple scab fungus, associated with the domestication of its host. Mol. Ecol. 2010, 19, 658–674. [Google Scholar] [CrossRef]
- Gladieux, P.; Guérin, F.; Giraud, T.; Caffier, V.; Lemaire, C.; Parisi, L.; Didelot, F.; Le Cam, B. Emergence of novel fungal pathogens by ecological speciation: Importance of the reduced viability of immigrants. Mol. Ecol. 2011, 20, 4521–4532. [Google Scholar] [CrossRef] [PubMed]
- Leroy, T.; Lemaire, C.; Dunemann, F.; Le Cam, B. The genetic structure of a Venturia inaequalis population in a heterogeneous host population composed of different Malus species. BMC Evol. Biol. 2013, 13, 64. [Google Scholar] [CrossRef]
- Lemaire, C.; De Gracia, M.; Leroy, T.; Michalecka, M.; Lindhard-Pedersen, H.; Guerin, F.; Gladieux, P.; Le Cam, B. Emergence of new virulent populations of apple scab from nonagricultural disease reservoirs. New Phytol. 2016, 209, 1220–1229. [Google Scholar] [CrossRef]
- Michalecka, M.; Masny, S.; Leroy, T.; Puławska, J. Population structure of Venturia inaequalis, a causal agent of apple scab, in response to heterogeneous apple tree cultivation. BMC Evol. Biol. 2018, 18, 5. [Google Scholar] [CrossRef]
- Schnabel, G.; Schnabel, E.L.; Jones, A.L. Characterization of ribosomal DNA from Venturia inaequalis and its phylogenetic relationship to rDNA from other tree-fruit Venturia species. Phytopathology 1999, 89, 100–108. [Google Scholar] [CrossRef]
- Le Cam, B.; Parisi, L.; Arene, L. Evidence of two formae speciales in Venturia inaequalis, responsible for apple and pyracantha scab. Phytopathology 2002, 92, 314–320. [Google Scholar] [CrossRef]
- Michalecka, M.; Malinowski, T.; Puławska, J. Analysis of Venturia inaequalis genes expression profiles: Searching for the genes associated with apple-scab-resistance breakdown. In Proceedings of the 12th European Foundation for Plant Pathology & 10th French Society for Plant Pathology, Dunkerque, France, 29 May–2 June 2017. Book of abstracts: 144. [Google Scholar]
- Hanage, W.P.; Fraser, C.; Spratt, B.G. Sequences, sequence clusters and bacterial species. Philos. Trans. R Soc. Lond. B Biol. Sci. 2006, 361, 1917–1927. [Google Scholar] [CrossRef]
- Covey, P.A.; Kuwitzky, B.; Hanson, M.; Webb, K.M. Multilocus analysis using putative fungal effectors to describe a population of Fusarium oxysporum from sugar beet. Phytopathology 2014, 104, 886–896. [Google Scholar] [CrossRef]
- Matute, D.R.; McEwen, J.G.; Puccia, R.; Montes, B.A.; San-Blas, G.; Bagagli, E.; Rauscher, J.T.; Resterpo, A.; Morais, F.; Nino-Vega, G.; et al. Cryptic speciation and recombination in the fungus Paracoccidioides brasiliensis as revealed by gene genealogies. Mol. Biol. Evol. 2006, 23, 65–73. [Google Scholar] [CrossRef]
- Obanor, F.; Erginbas-Orakci, G.; Tunali, B.; Nicol, J.M.; Chakraborty, S. Fusarium culmorum is a single phylogenetic species based on multilocus sequence analysis. Fungal Biol. 2010, 114, 753–765. [Google Scholar] [CrossRef]
- Inuma, T.; Khodaparast, S.A.; Takamatsu, S. Multilocus phylogenetic analyses within Blumeria graminis, a powdery mildew fungus of cereals. Mol. Phylogenetics Evol. 2007, 44, 741–751. [Google Scholar] [CrossRef] [PubMed]
- Marcelletti, S.; Ferrante, P.; Scortichini, M. Multilocus sequence typing reveals relevant genetic variation and different evolutionary dynamics among strains of Xanthomonas arboricola pv. juglandis. Diversity 2010, 2, 1205–1222. [Google Scholar] [CrossRef]
- O’Donnell, K.; Sutton, D.A.; Rinaldi, M.G.; Magnon, K.C.; Cox, P.A.; Revankar, S.G.; Sanche, S.; Geiser, D.M.; Juba, J.H.; van Burik, J.H.; et al. Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: Evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. J. Clin. Microbiol. 2004, 42, 5109–5120. [Google Scholar]
- Bain, J.M.; Tavanti, A.; Davidson, A.D.; Jacobsen, M.D.; Shaw, D.; Gow, N.A.R.; Odds, F.C. Multilocus sequence typing of the pathogenic fungus Aspergillus fumigatus. J. Clin. Microbiol. 2007, 45, 1469–1477. [Google Scholar] [CrossRef] [PubMed]
- Brown, E.M.; McTaggart, L.R.; Zhang, S.X.; Low, D.E.; Stevens, D.A.; Richardson, S.E. Phylogenetic Analysis Reveals a Cryptic Species Blastomyces gilchristii, sp. nov. within the Human Pathogenic Fungus Blastomyces dermatitidis. PLoS ONE 2013, 8, e059237. [Google Scholar] [CrossRef]
- Hogenhout, S.A.; van der Hoorn, R.A.L.; Terauchi, R.; Kamoun, S. Emerging concepts in effector biology of plant-associated organisms. Mol. Plant-Microbe Interact. 2009, 22, 115–122. [Google Scholar] [CrossRef]
- Idnurm, A.; Howlett, B.J. Pathogenicity genes of phytopathogenic fungi. Mol. Plant Pathol. 2001, 2, 241–255. [Google Scholar] [CrossRef]
- Jones, J.D.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef]
- Stukenbrock, E.H.; McDonald, B.A. Population genetics for fungal and oomycete effectors involved in gene-for-gene interactions. Mol. Plant-Microbe Interact. 2009, 22, 371–380. [Google Scholar] [CrossRef]
- Lievens, B.; van Baarlen, P.; Verreth, C.; van Kerckhove, S.; Rep, M.; Thomma, B.P. Evolutionary relationships between Fusarium oxysporum f. sp. lycopersici and F. oxysporum f. sp. radicis-lycopersici isolates inferred from mating type, elongation factor1-alpha and exopolygalacturonase sequences. Mycol. Res. 2009, 113, 1181–1191. [Google Scholar] [CrossRef] [PubMed]
- Cunningham, C.W. Can three incongruence tests predict when data should be combined? Mol. Biol. Evol. 1997, 14, 733–740. [Google Scholar] [CrossRef]
- Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef]
- Hudson, R.R.; Kaplan, N.L. Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 1985, 111, 147–164. [Google Scholar] [CrossRef]
- Barnes, I.; Crous, P.W.; Wingfield, B.D.; Wingfield, M.J. Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Stud. Mycol. 2004, 50, 551–565. [Google Scholar]
- Zhao, P.; Kakishima, M.; Uzuhashi, S.; Ishii, H. Multigene phylogenetic analysis of inter-and intraspecific relationships in Venturia nashicola and V. pirina. Eur. J. Plant Pathol. 2012, 132, 245–258. [Google Scholar] [CrossRef]
- Henderson, S.T.; Petes, T.D. Instability of simple sequence DNA in Saccharomyces cerevisiae. Mol. Cell Biol. 1992, 12, 2749–2757. [Google Scholar] [CrossRef]
- Tenaillon, M.I.; Sawkins, M.C.; Long, A.D.; Gaut, R.L.; Doebley, J.F.; Gaut, B.S. Patterns of DNA sequence polymorphism along chromosome 1 of maize (Zea mays ssp. mays L.). Proc. Natl. Acad. Sci. USA 2001, 98, 9161–9166. [Google Scholar] [CrossRef]
- Maruyama, T.; Fuerst, P.A. Population Bottlenecks and Non-Equilibrium Models in Population Genetics. II. Number of Alleles in a Small Population that was Formed by a Recent Bottleneck. Genetics 1985, 111, 675–689. [Google Scholar] [CrossRef]
- Taylor, J.W.; Fisher, M.C. Fungal multilocus sequence typing—It’s not just for bacteria. Curr. Opin. Microbiol. 2003, 6, 351–356. [Google Scholar] [CrossRef]
- Nordborg, M.; Tavare, S. Linkage disequilibrium: What history has to tell us. Trends Genet. 2002, 18, 83–90. [Google Scholar] [CrossRef]
- Koenraadt, H.; Somerville, S.C.; Jones, A.L. Characterization of mutations in the beta-tubulin gene of benomyl-resistant field strains of Venturia inaequalis and other plant pathogenic fungi. Phytopathology 1992, 82, 1348–1354. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
- Swofford, D.L. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods); Version 4; Sinauer Associates: Sunderland, MA, USA, 1998. [Google Scholar]
- Nei, M. Molecular Evolutionary Genetics; Columbia University Press: New York, NY, USA, 1987. [Google Scholar]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef]
- Tajima, F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 1989, 123, 585–595. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.X.; Li, W.H. Statistical tests of neutrality of mutations. Genetics 1993, 133, 693–709. [Google Scholar] [CrossRef]
- Korneliussen, T.S.; Moltke, I.; Albrechtsen, A.; Nielsen, R. Calculation of Tajima’s D and other neutrality test statistics from low depth next-generation sequencing data. BMC Bioinform. 2013, 14, 289. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, R. Statistical tests of selective neutrality in the age of genomics. Heredity 2001, 86, 641–647. [Google Scholar] [CrossRef]
- Kimura, M. Retrospective of the last quarter century of the neutral theory. Jpn. J. Genet. 1993, 68, 521–528. [Google Scholar]
- Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
- LoBuglio, K.F.; Taylor, J.W. Recombination and genetic differentiation in the mycorrhizal fungus Cenococcum geophilum Fr. Mycologia 2002, 94, 772–780. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef]
- Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [PubMed]
- Bandelt, H.J.; Dress, A.W. A canonical decomposition theory for metrics on a finite set. Adv. Math. 1992, 92, 47–105. [Google Scholar] [CrossRef]
- Huson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 2005, 23, 254–267. [Google Scholar] [CrossRef]
- Martin, D.P.; Lemey, P.; Lott, M.; Moulton, V.; Posada, D.; Lefeuvre, P. RDP3: A flexible and fast computer program for analyzing recombination. Bioinformatics 2010, 26, 2462–2463. [Google Scholar] [CrossRef] [PubMed]
- Brown, A.H.D.; Feldman, M.W.; Nevo, E. Multilocus structure of natural populations of Hordeum spontaneum. Genetics 1980, 96, 523–536. [Google Scholar] [PubMed]
- Agapow, P.M.; Burt, A. Indices of multilocus linkage disequilibrium. Mol. Ecol. Notes 2001, 1, 101–102. [Google Scholar] [CrossRef]



| R Gene of Host | Orchard Location, Cultivar | Control Type | Population Names | No. of Strains Used |
|---|---|---|---|---|
| 0 | Dabrowice, F1 seedling of Malus x zumi var. “Colocarpa” | organic | OZD | 5 |
| 0 | Lublin, Gala | organic | MGL | 5 |
| 0 | Lublin, Paulared | organic | PAL | 5 |
| 0 | Nowy Dwor, Ligolina | organic | LND | 5 |
| 0 | Nowy Dwor, Delbard Jubile | organic | DND | 5 |
| Rvi1 | Brzezna, Golden Delicious | chemical | GDB | 5 |
| Rvi1 | Jajkowice, Golden Delicious | chemical | GDJ | 5 |
| Rvi1 | Milobadz, Golden Delicious | chemical | GDM | 5 |
| Rvi6 | Nowy Dwor, Enterprise | organic | END | 5 |
| Rvi6 | Nowy Dwor, Rajka | organic | RND | 5 |
| Rvi6 | Brzeziny, Rubinola | organic | RUB | 5 |
| Rvi6 | Brzeziny, Topaz | organic | TOB | 5 |
| Rvi6 | Jeziorsko, Topaz | organic | TOJ | 5 |
| Rvi6 | Jeziorsko, Biogolden | organic | BGJ | 5 |
| Rvi6 | Lublin, Ariwa | organic | ARL | 5 |
| Rvi6 | Lublin, Gold Milenium | organic | GML | 5 |
| Rvi17 | Brzezna, Antonovka | organic | ABR | 5 |
| Rvi17 | Siedlce, Antonovka | organic | ASI | 5 |
| (a) | ||||||||||||
| Gene Fragment | Length in Basepairs | G/C Content | No. of Polymorphic/Segregating Sites [S] | Polymorphic Sites in % | % of Haplotypes Per locus | No. of Parsimony Informative Sites | Haplotype [Gene] Diversity [Hd] | Nucleotide Diversity [π] | Theta per Site from S [θ-W] | Tajima’s Test D | Fu and Li’s D Test for Neutrality of Mutations | Average Percentage of Sequence Similarity between Strains |
| EF-1α | 336 | 0.505 | 103 | 30.7 | 49 | 64 | 0.869 | 0.02109 | 0.05921 | −2.29955 * | −2.58706 * | 93.3 |
| β-tubulin | 384 | 0.529 | 23 | 6 | 22 | 12 | 0.800 | 0.00813 | 0.01160 | −1.13774 | −2.92669 * | 98.45 |
| mannosidase | 784 | 0.481 | 27 | 3.4 | 25 | 21 | 0.741 | 0.00994 | 0.00665 | 1.33244 | −0.18782 | 98.9 |
| glucosidase | 533 | 0.569 | 66 | 12.38 | 41 | 49 | 0.862 | 0.02321 | 0.02514 | −0.42071 | −0.90093 | 95.8 |
| (b) | ||||||||||||
| Gene fragment | Length in basepairs | G/C content | No. of polymorphic/segregating sites [S] | Polymorphic sites in % | % of haplotypes per population | No. of parsimony informative sites | Haplotype [gene] diversity [Hd] | Nucleotide diversity [π] | Theta per site from S [θ-W] | Tajima’s test D | Fu and Li’s D test for neutrality of mutations | |
| all strains, concatened EF-1α and β-tubulin | 720 | 0.518 | 126 | 17.5 | 67 | 76 | 0.974 | 0.1416 | 0.03385 | −2.12766 * | −2.95196 * | |
| all strains, concatened mannosidase and glucosidase | 1317 | 0.556 | 93 | 7.06 | 61 | 70 | 0.955 | 0.01515 | 0.01466 | 0.1097 | −0.74098 | |
| (c) | ||||||||||||
| Gene fragment | Length in basepairs | G/C content | No. of polymorphic/segregating sites [S] | Polymorphic sites in % | % of haplotypes per population | No. of parsimony informative sites | Haplotype [gene] diversity [Hd] | Nucleotide diversity [π] | Theta per site from S [θ-W] | Tajima’s test D | Fu and Li’s D test for neutrality of mutations | |
| EF-1α Rvi6-virulent | 336 | 0.504 | 75 | 22.3 | 60 | 46 | 0.89359 | 0.02859 | 0.05248 | −1.87014 * | −1.25818 | |
| EF-1α Rvi6-avirulent | 336 | 0.505 | 64 | 19 | 47 | 27 | 0.85367 | 0.01530 | 0.04049 | −2.24047 * | −3.11016 * | |
| β-tubulin Rvi6-virulent | 384 | 0.528 | 18 | 4.7 | 22.5 | 7 | 0.67949 | 0.00957 | 0.01105 | −0.43613 | −2.49531 | |
| β-tubulin Rvi6-avirulent | 384 | 0.529 | 17 | 4.43 | 25 | 11 | 0.70226 | 0.00467 | 0.00952 | −1.72921 | −1.15951 | |
| mannosidase Rvi6-virulent | 784 | 0.48 | 24 | 3.06 | 35 | 20 | 0.72740 | 0.00849 | 0.00720 | 0.39781 | 0.29570 | |
| mannosidase Rvi6-avirulent | 784 | 0.481 | 23 | 2.93 | 22 | 19 | 0.72655 | 0.01067 | 0.00629 | 1.98139 | 0.07949 | |
| glucosidase Rvi6-virulent | 533 | 0.571 | 24 | 4.5 | 35 | 18 | 0.767 | 0.0181 | 0.01152 | 1.93341 | −0.27958 | |
| glucosidase Rvi6-avirulent | 533 | 0.568 | 64 | 12 | 55 | 48 | 0.9240 | 0.02697 | 0.02876 | −0.21363 | −0.45163 | |
| Gene Region. | Neutral | Non-Neutral | Total |
|---|---|---|---|
| EF-1α | 12 | 22 | 34 |
| β-tubulin | 17 | 17 | 34 |
| mannosidase | 26 | 3 | 29 |
| glucosidase | 23 | 48 | 71 |
| DNA Divergence between Rvi6-Virulent vs. Rvi6-Avirulent Populations | ||||
|---|---|---|---|---|
| Gene Flow Estimates of Nei 1973 | Average No. of Nucleotide Differentiations between Pops | Average Number of Nucleotide Substitutions per Site, between Pops Dxy | Minimum Number of Recombination Events [Rm] | |
| EF-1α | Gst = 0.00025 Nm = 990.68 | 7.699 | 0.02291 | 20 |
| β-tubulin | Gst = 0.13228 Nm = 1.64 | 3.912 | 0.01021 | 3 |
| 1,2-alpha-D-mannosidase | Gst = 0.01172 Nm = 21.08 | 7.792 | 0.00994 | 11 |
| glucan-1,3-beta-glucosidase | Gst = 0.01324 Nm = 18.64 | 11.354 | 0.02239 | 12 |
| concatened EF-1α and β-tubulin | Gst = 0.01068 Nm = 23.15 | 11.601 | 0.01614 | 23 |
| concatenated mannosidase and glucosidase | Gst = 0.00344 Nm = 72.33 | 19.128 | 0.01482 | 23 |
| DNA Region and Groups of Populations | Among Groups | Among Populations within Groups | Among Individuals within Populations | FST |
|---|---|---|---|---|
| EF-1α/Rvi6-virulent vs. Rvi6-avirulent | 3.2 | 20.2 | 76.7 | 0.23 |
| β-tubulin/Rvi6-virulent vs. Rvi6-avirulent | 31.9 | 2.5 | 65.6 | 0.34 |
| 1,2-alpha-D-mannosidase/Rvi6-virulent vs. Rvi6-avirulent | 2.6 | 13.5 | 83.9 | 0.16 |
| glucan-1,3-beta-glucosidase/Rvi6-virulent vs. Rvi6-avirulent | 0.6 | 7.7 | 91.7 | 0.08 |
| EF-1α/Rvi6-virulent | 23.0 | 77.0 | 0.23 | |
| EF-1α/Rvi6-avirulent | 18.0 | 82.0 | 0.18 | |
| β-tubulin/Rvi6-virulent | 10.2 | 89.8 | 0.10 | |
| β-tubulin/Rvi6-avirulent | 22.0 | 78.1 | 0.22 | |
| 1,2-alpha-D-mannosidase/Rvi6-virulent | 19.6 | 80.4 | 0.20 | |
| 1,2-alpha-D-mannosidase/Rvi6-avirulent | 10.8 | 89.2 | 0.11 | |
| glucan-1,3-beta-glucosidase/Rvi6-virulent | 17.8 | 82.2 | 0.18 | |
| glucan-1,3-beta-glucosidase/Rvi6-avirulent | 3.4 | 96.6 | 0.03 |
| DNA Region and Compared Groups of Strains | Index of Association [rBARd] |
|---|---|
| EF-1α all strains/two groups | 0.15 * |
| β-tubulin all strains/two groups | 0.3 * |
| 1,2-alpha-D-mannosidase all strains/two groups | 0.5 * |
| glucan-1,3-beta-glucosidase all strains/two groups | 0.17 * |
| concatened EF-1α and β-tubulin, all strains/two groups | 0.11 |
| concatened mannosidase and glucosidase, all strains/two groups | 0.13 * |
| Name of the Primer Set (Target Region) | Sequence of the Primer in 5′->3′ Orientation | Sequence of the Primer in 5′->3′ Orientation | Product Length in Basepairs | Reference |
|---|---|---|---|---|
| VNEFI-f/VNEFI-r (EF-1α) | ACTTGATCTACAAGTGCGGTG | AGGAGTCTCGAACTTCCAGAG | 385 | [14] |
| C/D (β-tubulin) | GAGGAATTCCCAGACCGTATGATG | GCTGGATCCTATTCTTTGGGTCGAACAT | 436 | [39] |
| cont189/675 (β-tubulin) | CACGGAAGATAGCGGAGCAAGTAA | GAGGAATTCCCAGACCGTATGATG | 487 | this study |
| VinManno1/ VinManno2 | TTGCTCGCGTAACGGCTCCAGA | TTCGCTCATCGCAAATCCCCATAC | 858 | this study |
| VinGluco1/VinGluco2 | TAAGCACGGCCATCACAACCTACG | CGCAGGCCCTCTAAATTCCAAACT | 1006 | this study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Michalecka, M.; Puławska, J. Multilocus Sequence Analysis of Selected Housekeeping- and Pathogenicity-Related Genes in Venturia inaequalis. Pathogens 2021, 10, 447. https://doi.org/10.3390/pathogens10040447
Michalecka M, Puławska J. Multilocus Sequence Analysis of Selected Housekeeping- and Pathogenicity-Related Genes in Venturia inaequalis. Pathogens. 2021; 10(4):447. https://doi.org/10.3390/pathogens10040447
Chicago/Turabian StyleMichalecka, Monika, and Joanna Puławska. 2021. "Multilocus Sequence Analysis of Selected Housekeeping- and Pathogenicity-Related Genes in Venturia inaequalis" Pathogens 10, no. 4: 447. https://doi.org/10.3390/pathogens10040447
APA StyleMichalecka, M., & Puławska, J. (2021). Multilocus Sequence Analysis of Selected Housekeeping- and Pathogenicity-Related Genes in Venturia inaequalis. Pathogens, 10(4), 447. https://doi.org/10.3390/pathogens10040447

