Evaluation of a Trio Toscana Virus Real-Time RT-PCR Assay Targeting Three Genomic Regions within Nucleoprotein Gene
Abstract
1. Introduction
2. Materials and Methods
2.1. Inventory of Published TOSV RT-qPCR Assays and Design of the Trio TOSV RT-qPCR Test
2.2. RT-qPCR Assays
2.3. Generation of RNA Synthetic Transcript (standard RNA)
2.4. Sensitivity
2.5. Specificity
2.6. Clinical Validation
2.7. Ethics Statement
3. Results
3.1. TOSV RT-qPCR Assays and in Silico Analysis
3.2. Specificity of Trio TOSV RT-qPCR Assay
3.3. Sensitivity
3.4. Clinical Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Valassina, M.; Cusi, M.G.; Valensin, P.E. A Mediterranean Arbovirus: The Toscana Virus. J. Neurovirol. 2003, 9, 577–583. [Google Scholar] [CrossRef]
- Ayhan, N.; Charrel, R.N. An update on Toscana virus distribution, genetics, medical and diagnostic aspects. Clin. Microbiol Infect. 2020, 26, 1017–1023. [Google Scholar] [CrossRef]
- Charrel, R.N.; Bichaud, L.; de Lamballerie, X. Emergence of Toscana virus in the mediterranean area. World J. Virol. 2012, 1, 135–141. [Google Scholar] [CrossRef]
- Punda-Polić, V.; Mohar, B.; Duh, D.; Bradarić, N.; Korva, M.; Fajs, L.; Saksida, A.; Avšič-Županc, T. Evidence of an autochthonous Toscana virus strain in Croatia. J. Clin. Virol. 2012, 55, 4–7. [Google Scholar] [CrossRef]
- Ayhan, N.; Alten, B.; Ivovic, V.; Martinkovic, F.; Kasap, O.E.; Ozbel, Y.; De Lamballerie, X.; Charrel, R.N. Cocirculation of Two Lineages of Toscana Virus in Croatia. Front. Public Health 2017, 5, 336. [Google Scholar] [CrossRef]
- Papa, A.; Paraforou, T.; Papakonstantinou, I.; Pagdatoglou, K.; Kontana, A.; Koukoubani, T. Severe encephalitis caused by Toscana virus, Greece. Emerg. Infect. Dis. 2014, 20, 1417–1419. [Google Scholar] [CrossRef]
- Tyler, K.L. Emerging Viral Infections of the Central Nervous System: Part 1. Arch. Neurol. 2009, 66, 939–948. [Google Scholar] [CrossRef]
- Charrel, R.N. Chapter 8-Toscana Virus Infection. In Emerging Infectious Diseases; Ergönül, Ö., Can, F., Madoff, L., Akova, M., Eds.; Academic Press: Amsterdam, The Netherlands, 2014; pp. 111–119. [Google Scholar]
- Rota, E.; Morelli, N.; Immovilli, P.; De Mitri, P.; Guidetti, D. Guillain-Barré-like axonal polyneuropathy associated with Toscana virus infection: A case report. Medicine 2017, 96, e8081. [Google Scholar] [CrossRef]
- Baldelli, F.; Ciufolini, M.G.; Francisci, D.; Marchi, A.; Venturi, G.; Fiorentini, C.; Luchetta, M.L.; Bruto, L.; Pauluzzi, S. Unusual Presentation of Life-Threatening Toscana Virus Meningoencephalitis. Clin. Infect. Dis. 2004, 38, 515–520. [Google Scholar] [CrossRef]
- Bartels, S.; de Boni, L.; Kretzschmar, H.A.; Heckmann, J.G. Lethal encephalitis caused by the Toscana virus in an elderly patient. J. Neurol. 2012, 259, 175–177. [Google Scholar] [CrossRef]
- Lu, X.; Wang, L.; Sakthivel, S.K.; Whitaker, B.; Murray, J.; Kamili, S.; Lynch, B.; Malapati, L.; Burke, S.A.; Harcourt, J.; et al. US CDC Real-Time Reverse Transcription PCR Panel for Detection of Severe Acute Respiratory Syndrome Coronavirus 2. Emerg. Infect. Dis. 2020, 26, 1654–1665. [Google Scholar] [CrossRef]
- Templer, S.P.; Seiverth, B.; Baum, P.; Stevens, W.; Seguin-Devaux, C.; Carmona, S. Improved Sensitivity of a Dual-Target HIV-1 Qualitative Test for Plasma and Dried Blood Spots. J. Clin. Microbiol. 2016, 54, 1877–1882. [Google Scholar] [CrossRef]
- Sizmann, D.; Glaubitz, J.; Simon, C.O.; Goedel, S.; Buergisser, P.; Drogan, D.; Hesse, M.; Kröh, M.; Simmler, P.; Dewald, M.; et al. Improved HIV-1 RNA quantitation by COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, v2.0 using a novel dual-target approach. J. Clin. Virol. 2010, 49, 41–46. [Google Scholar] [CrossRef]
- Damond, F.; Avettand-Fenoel, V.; Collin, G.; Roquebert, B.; Plantier, J.-C.; Ganon, A.; Sizmann, D.; Babiel, R.; Glaubitz, J.; Chaix, M.L.; et al. Evaluation of an Upgraded Version of the Roche Cobas AmpliPrep/Cobas TaqMan HIV-1 Test for HIV-1 Load Quantification. J. Clin. Microbiol. 2010, 48, 1413–1416. [Google Scholar] [CrossRef]
- Chudy, M.; Kress, J.; Halbauer, J.; Heiden, M.; Funk, M.B.; Nübling, C.M. Risk Minimization Measures for Blood Screening HIV-1 Nucleic Acid Amplification Technique Assays in Germany. Transfus. Med. Hemotherapy 2014, 41, 45–51. [Google Scholar] [CrossRef]
- Anonymous. Aptima HBV Quant assay. Available online: http://www.usaptimavirology.com/hbv-quant-assay#content-a (accessed on 19 February 2021).
- Anonymous. GeneProof Hepatitis C Virus (HCV) PCR testing. Available online: https://www.geneproof.com/geneproof-hepatitis-c-virus-hcv-diagnostic-pcr-kit/p1095 (accessed on 19 February 2021).
- Thirion, L.; Pezzi, L.; Corcostegui, I.; Dubot-Pérès, A.; Falchi, A.; De Lamballerie, X.; Charrel, R.N. Development and Evaluation of a Duo Chikungunya Virus Real-Time RT-PCR Assay Targeting Two Regions within the Genome. Viruses 2019, 11, 755. [Google Scholar] [CrossRef]
- Thirion, L.; Charrel, R.N.; Boehmann, Y.; Corcostegui, I.; Raoul, H.; De Lamballerie, X. Development and Evaluation of a Duo Zaire ebolavirus Real-Time RT-PCR Assay Targeting Two Regions within the Genome. Microorganisms 2019, 7, 652. [Google Scholar] [CrossRef]
- Brisbarre, N.; Plumet, S.; Cotteaux-Lautard, C.; Emonet, S.F.; Pagès, F.; Leparc-Goffart, I. A rapid and specific real time RT-PCR assay for diagnosis of Toscana virus infection. J. Clin. Virol. 2015, 66, 107–111. [Google Scholar] [CrossRef]
- Weidmann, M.; Sanchez-Seco, M.P.; Sall, A.A.; Ly, P.O.; Thiongane, Y.; Lo, M.M.; Schley, H.; Hufert, F.T. Rapid detection of important human pathogenic Phleboviruses. J. Clin. Virol. 2008, 41, 138–142. [Google Scholar] [CrossRef]
- Pérez-Ruiz, M.; Collao, X.; Navarro-Marí, J.-M.; Tenorio, A. Reverse transcription, real-time PCR assay for detection of Toscana virus. J. Clin. Virol. 2007, 39, 276–281. [Google Scholar] [CrossRef]
- Pezzi, L.; Charrel, R.N.; Ninove, L.; Nougairede, A.; Molle, G.; Coutard, B.; Durand, G.; Leparc-Goffart, I.; De Lamballerie, X.; Thirion, L. Development and Evaluation of a duo SARS-CoV-2 RT-qPCR Assay Combining Two Assays Approved by the World Health Organization Targeting the Envelope and the RNA-Dependant RNA Polymerase (RdRp) Coding Regions. Viruses 2020, 12, 686. [Google Scholar] [CrossRef]
- Thirion, L.; Dubot-Peres, A.; Pezzi, L.; Corcostegui, I.; Touinssi, M.; De Lamballerie, X.; Charrel, R.N. Lyophilized Matrix Containing Ready-to-Use Primers and Probe Solution for Standardization of Real-Time PCR and RT-qPCR Diagnostics in Virology. Viruses 2020, 12, 159. [Google Scholar] [CrossRef]
- Chudy, M.; Weber-Schehl, M.; Pichl, L.; Jork, C.; Kress, J.; Heiden, M.; Funk, M.B.; Nübling, C.M. Blood screening nucleic acid amplification tests for human immunodeficiency virus Type 1 may require two different amplification targets. Transfusion 2012, 52, 431–439. [Google Scholar] [CrossRef]
- Müller, B.; Nübling, C.M.; Kress, J.; Roth, W.K.; De Zolt, S.; Pichl, L. How safe is safe: New human immunodeficiency virus Type 1 variants missed by nucleic acid testing. Transfusion 2013, 53, 2422–2430. [Google Scholar] [CrossRef]
- Nübling, C.M.; Heiden, M.; Chudy, M.; Kress, J.; Seitz, R.; Keller-Stanislawski, B.; Funk, M.B. Experience of mandatory nucleic acid test (NAT) screening across all blood organizations in Germany: NAT yield versus breakthrough transmissions. Transfusion 2009, 49, 1850–1858. [Google Scholar] [CrossRef]
- Pyne, M.T.; Brown, K.L.; Hillyard, D.R. Evaluation of the Roche Cobas AmpliPrep/Cobas TaqMan HIV-1 test and identification of rare polymorphisms potentially affecting assay performance. J. Clin. Microbiol. 2010, 48, 2852–2858. [Google Scholar] [CrossRef][Green Version]
- Foglieni, B.; Candotti, D.; Guarnori, I.; Raffaele, L.; Berzuini, A.; Spreafico, M.; Orani, A.; Rossotti, R.; Rossi, D.; Allain, J.-P.; et al. A cluster of human immunodeficiency virus Type 1 recombinant form escaping detection by commercial genomic amplification assays. Transfusion 2011, 51, 719–730. [Google Scholar] [CrossRef]
- Holland, J.; Spindler, K.; Horodyski, F.; Grabau, E.; Nichol, S.; Vandepol, S. Rapid evolution of RNA genomes. Science 1982, 215, 1577–1585. [Google Scholar] [CrossRef]
- Kay, M.K.; Gibney, K.B.; Riedo, F.X.; Kosoy, O.L.; Lanciotti, R.S.; Lambert, A.J. Toscana virus infection in American traveler returning from Sicily, 2009. Emerg. Infect. Dis. 2010, 16, 1498–1500. [Google Scholar] [CrossRef]



| Reference | Primer/Probe | 5’→3’ Sequence | Target | Position a | Amplicon Size (nts) | Concentration [nM] |
|---|---|---|---|---|---|---|
| Pérez-Ruiz et al. [23] | STOS-F | TGCTTTTCTTGATGAGTCTGCAG | S RNA, N gene | 1718–1736 | 90 | 1000 |
| STOS-R | CAATGCGCTTYGGRTCAAA | 1785–1807 | 1000 | |||
| STOS-P | FAM-ATCAATGCATGGGTRAATGAGTTTGCTTACC-TAMRA | 1742–1772 | 200 | |||
| Weidmann et al. [22] | TOS F | GGGTGCATCATGGCTCTT | S RNA, N gene | 1381–1398 | 151 | 500 |
| TOS R | GCAGRGACACCATCACTCTGTC | 1510–1531 | 500 | |||
| TOS P | FAM-CAATGGCATCCATAGTGGTCCCAGA-TAMRA | 1415–1439 | 200 | |||
| Brisbarre et al. [21] | TOS-IMT-F | TCTCCCAGGAAATGACATCC | S RNA, N gene | 621–640 | 85 | 400 |
| TOS-IMT-R | AGATGGGWGTCTCTGGTCAT | 706–725 | 400 | |||
| TOS-IMT-P | FAM-TGTGGTYCAAGCAGCACGGGTG-TAMRA | 654–675 | 200 |
| PCR master mix: qScript™ XLT One-Step RT-qPCR (Quanta Bio, VWR International Eurolab S.L., Llinars del Vallès, Spain) | |||||
| Primers and probe: P&P Trio TOSV assay | Primers and probe: P&P Perez-Ruiz monoplex assay | ||||
| Reagents and conditions (as recommended by QuantaBio) | Reagents and conditions (as recommended by QuantaBio) | ||||
| Quanta mix (2×) | 15 µL | Quanta mix (2×) | 15 µL | ||
| P&P Trio TOSV | 7 µL | P&P TOSV | 6 µL | ||
| RNA | 8 µL | RNA | 8 µL | ||
| Water PCR grade | 1 µL | ||||
| Total | 30 µL | Total | 30 µL | ||
| Amplification protocol | Amplification protocol | ||||
| 50 °C | 10 min | 50 °C | 10 min | ||
| 95 °C | 1 min | 95 °C | 1 min | ||
| 95 °C | 10 s | 45× | 95 °C | 10 s | 45× |
| 60 °C | 30 s | 60 °C | 30 s | ||
| PCR master mix: Real-time ready RNA virus master (Roche Diagnostics, Barcelona, Spain) | |||||
| Primers and probe: P&P Trio TOSV assay | Primers and probe: P&P Perez-Ruiz monoplex assay | ||||
| Reagents and conditions (as recommended by Roche) | Reagents and conditions (as recommended by Roche) | ||||
| RT-qPCR mix (5×) | 4 µL | RT-qPCR mix (5×) | 4 µL | ||
| Enzyme | 0.1 µL | Enzyme | 0.1 µL | ||
| P&P Trio TOSV | 4.6 µL | P&P TOSV | 4.6 µL | ||
| RNA | 5 µL | RNA | 5 µL | ||
| Water PCR grade | 6.3 µL | Water PCR grade | 6.3 µL | ||
| Total | 20 µL | Total | 20 µL | ||
| Amplification protocol | Amplification protocol | ||||
| 50 °C | 10 min | 50 °C | 10 min | ||
| 95 °C | 30 s | 95 °C | 30 s | ||
| 95 °C | 5 s | 45× | 95 °C | 5 s | 45× |
| 60 °C | 30 s | 60 °C | 30 s | ||
| LOD95: 23.8 copies/µL | LOD95: 11.3 copies/µL | LOD95: 20.6 copies/µL | LOD95: 84 copies/µL | |||||||||||||
| Standard RNA | Trio | STOS Pérez-Ruiz | TOS2 Weidmann | IMT Brisbarre | ||||||||||||
| RNA copies/µL | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) |
| 718 | 12 | 12 | 100 | 32.9 (0.4) | 12 | 12 | 100 | 34.3 (0.3) | 12 | 12 | 100 | 34.4 (0.2) | 12 | 12 | 100 | 34.9 (0.5) |
| 144 | 12 | 12 | 100 | 34.5 (0.7) | 12 | 12 | 100 | 36.4 (1.1) | 12 | 12 | 100 | 37.3 (0.7) | 12 | 12 | 100 | 36.9 (0.5) |
| 29 | 12 | 12 | 100 | 36.2 (0.3) | 12 | 12 | 100 | 38.1 (0.7) | 12 | 12 | 100 | 38.8 (0.4) | 12 | 4 | 33 | 38.2 (0.8) |
| 6 | 12 | 6 | 50 | 37.3 (1.4) | 12 | 10 | 83 | 39.1 (0.5) | 12 | 8 | 67 | 39.3 (0.8) | 12 | 0 | 0 | - |
| 1 | 12 | 1 | 8 | 38.2 | 12 | 3 | 25 | 39.1 (0.8) | 12 | 3 | 25 | 39.4 (0.5) | 12 | 0 | 0 | - |
| 0 | 12 | 0 | 0 | - | 12 | 0 | 0 | - | 12 | 0 | 0 | - | 12 | 0 | 0 | - |
| LOD95: 21.9 copies/µL | LOD95: 19.1 copies/µL | LOD95: 19.2 copies/µL | LOD95: 101.1 copies/µL | |||||||||||||
| TOSV A | Trio | STOS Pérez-Ruiz | TOS2 Weidmann | IMT Brisbarre | ||||||||||||
| Viral RNA copies/µL | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) |
| 850 | 12 | 12 | 100 | 32.8 (0.3) | 12 | 12 | 100 | 33.5 (0.5) | 12 | 12 | 100 | 34.7 (0.6) | 12 | 12 | 100 | 33.8 (0.2) |
| 170 | 12 | 12 | 100 | 34.9 (0.4) | 12 | 12 | 100 | 36.0 (1) | 12 | 12 | 100 | 37.2 (0.7) | 12 | 12 | 100 | 35.9 (0.5) |
| 34 | 12 | 12 | 100 | 36.6 (0.8) | 12 | 12 | 100 | 37.7 (0.9) | 12 | 12 | 100 | 39.0 (0.4) | 12 | 2 | 17 | 38.7 (0.6) |
| 7 | 12 | 2 | 17 | 38.3 (0.6) | 12 | 9 | 75 | 38.1 (0.7) | 12 | 3 | 25 | 39.4 (0.2) | 12 | 0 | 0 | - |
| 1 | 12 | 0 | 0 | - | 12 | 3 | 25 | 38.5 (0.8) | 12 | 0 | 0 | - | 12 | 0 | 0 | - |
| 0 | 12 | 0 | 0 | - | 12 | 0 | 0 | - | 12 | 0 | 0 | - | 12 | 0 | 0 | - |
| LOD95: 22.3 copies/µL | LOD95: 14.9 copies/µL | LOD95: 18.3 copies/µL | LOD95: 93.3 copies/µL | |||||||||||||
| TOSV B | Trio | STOS Pérez-Ruiz | TOS2 Weidmann | IMT Brisbarre | ||||||||||||
| Viral RNA copies/µL | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) | tested | positive | % | Ct value (SD) |
| 1075 | 12 | 12 | 100 | 31.9 (0.4) | 12 | 12 | 100 | 32.5 (0.4) | 12 | 12 | 100 | 33.3 (0.4) | 12 | 12 | 100 | 33.2 (0.2) |
| 215 | 12 | 12 | 100 | 34.1 (0.3) | 12 | 12 | 100 | 35.1 (0.3) | 12 | 12 | 100 | 35.7 (0.7) | 12 | 12 | 100 | 36.1 (0.4) |
| 43 | 12 | 12 | 100 | 37.1 (0.9) | 12 | 12 | 100 | 37.6 (1.0) | 12 | 12 | 100 | 37.9 (0.5) | 12 | 5 | 42 | 38.8 (1) |
| 9 | 12 | 4 | 33 | 38.6 (0.4) | 12 | 10 | 83 | 39.0 (0.7) | 12 | 6 | 50 | 38.4 (0.4) | 12 | 0 | 0 | - |
| 2 | 12 | 0 | 0 | - | 12 | 2 | 17 | 39.3 (0.9) | 12 | 0 | 0 | - | 12 | 0 | 0 | - |
| 0 | 12 | 0 | 0 | - | 12 | 0 | 0 | - | 12 | 0 | 0 | - | 12 | 0 | 0 | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thirion, L.; Pezzi, L.; Pedrosa-Corral, I.; Sanbonmatsu-Gamez, S.; Lamballerie, X.D.; Falchi, A.; Perez-Ruiz, M.; Charrel, R.N. Evaluation of a Trio Toscana Virus Real-Time RT-PCR Assay Targeting Three Genomic Regions within Nucleoprotein Gene. Pathogens 2021, 10, 254. https://doi.org/10.3390/pathogens10030254
Thirion L, Pezzi L, Pedrosa-Corral I, Sanbonmatsu-Gamez S, Lamballerie XD, Falchi A, Perez-Ruiz M, Charrel RN. Evaluation of a Trio Toscana Virus Real-Time RT-PCR Assay Targeting Three Genomic Regions within Nucleoprotein Gene. Pathogens. 2021; 10(3):254. https://doi.org/10.3390/pathogens10030254
Chicago/Turabian StyleThirion, Laurence, Laura Pezzi, Irene Pedrosa-Corral, Sara Sanbonmatsu-Gamez, Xavier De Lamballerie, Alessandra Falchi, Mercedes Perez-Ruiz, and Remi N. Charrel. 2021. "Evaluation of a Trio Toscana Virus Real-Time RT-PCR Assay Targeting Three Genomic Regions within Nucleoprotein Gene" Pathogens 10, no. 3: 254. https://doi.org/10.3390/pathogens10030254
APA StyleThirion, L., Pezzi, L., Pedrosa-Corral, I., Sanbonmatsu-Gamez, S., Lamballerie, X. D., Falchi, A., Perez-Ruiz, M., & Charrel, R. N. (2021). Evaluation of a Trio Toscana Virus Real-Time RT-PCR Assay Targeting Three Genomic Regions within Nucleoprotein Gene. Pathogens, 10(3), 254. https://doi.org/10.3390/pathogens10030254

