Tissue-Specific Immune Gene Expression in the Migratory Locust, Locusta Migratoria
Abstract
:1. Introduction
2. Experimental Section
2.1. Insect Cultures, Treatments and Tissue Collection
2.2. RNA Isolation and Reverse Transcription Quantitative PCR
| Accession Number | Gene Name | Primer (F/R) | Primer Sequence | Amplicon Length (bp) | Tm (°C) |
|---|---|---|---|---|---|
| JF915527 | PGRP-SA | F | AGGAGTTCATGGAGGTGCAG | 87 | 64.3 |
| R | GCCAAGACGGTGGAGTACAT | 63.9 | |||
| JF915523 | GNBP1 | F | GGGAAGAGTTCAACCACCAA | 83 | 63.9 |
| R | GCAAGCGTAGATTTCCAAGG | 63.5 | |||
| FJ771024.1 | ProPO | F | TGTGCCTCATTGTCGTTGTT | 137 | 64.3 |
| R | TACCTGGACGTGTGCTGAAG | 64.0 | |||
| KC118986 | Actin | F | CTTTTCCCTGTTTGCCTTTG | 104 | 63.4 |
| R | AAATCTGGCACCACACCTTC | 63.9 | |||
| AB583233 | EF1a | F | CAGCCTGTGACGTTCCTGTA | 112 | 64.0 |
| R | ATTGACATTGCGTTGTGGAA | 64.0 |
2.3. Statistical Analyses
3. Results and Discussion



4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References and Notes
- Medzhitov, R.; Janeway, C.A. Decoding the patterns of self and nonself by the innate immune system. Science 2002, 5566, 298–300. [Google Scholar] [CrossRef]
- Janeway, C.A., Jr.; Medzhitov, R. Innate immune recognition. Ann. Rev. Immunol. 2002, 1, 197–216. [Google Scholar] [CrossRef]
- Royet, J.; Dziarski, R. Peptidoglycan recognition proteins: Pleiotropic sensors and effectors of antimicrobial defences. Nat. Rev. Microbiol. 2007, 4, 264–277. [Google Scholar] [CrossRef]
- Wang, L.; Weber, A.N.; Atilano, M.L.; Filipe, S.R.; Gay, N.J.; Ligoxygakis, P. Sensing of Gram-positive bacteria in Drosophila: GNBP1 is needed to process and present peptidoglycan to PGRP-SA. EMBO J. 2006, 20, 5005–5014. [Google Scholar] [CrossRef]
- Lemaitre, B.; Hoffmann, J. The host defense of Drosophila melanogaster. Ann. Rev. Immunol. 2007, 697–743. [Google Scholar] [CrossRef]
- Michel, T.; Reichhart, J.-M.; Hoffmann, J.A.; Royet, J. Drosophila toll is activated by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature 2001, 6865, 756–759. [Google Scholar] [CrossRef]
- Gobert, V.; Gottar, M.; Matskevich, A.A.; Rutschmann, S.; Royet, J.; Belvin, M.; Hoffmann, J.A.; Ferrandon, D. Dual activation of the Drosophila toll pathway by two pattern recognition receptors. Science 2003, 5653, 2126–2130. [Google Scholar] [CrossRef]
- Yu, Y.; Park, J.-W.; Kwon, H.-M.; Hwang, H.-O.; Jang, I.-H.; Masuda, A.; Kurokawa, K.; Nakayama, H.; Lee, W.-J.; Dohmae, N. Diversity of innate immune recognition mechanism for bacterial polymeric meso-diaminopimelic acid-type peptidoglycan in insects. J. Biol. Chem. 2010, 43, 32937–32945. [Google Scholar] [CrossRef]
- Tzou, P.; Ohresser, S.; Ferrandon, D.; Capovilla, M.; Reichhart, J.-M.; Lemaitre, B.; Hoffmann, J.A.; Imler, J.-L. Tissue-specific inducible expression of antimicrobial peptide genes in Drosophila surface epithelia. Immunity 2000, 5, 737–748. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations: Desert Locust Information Service. Available online: http://www.fao.org/ag/locusts/oldsite/LOCFAQ.htm (accessed on 1 February 2014).
- Food and Agriculture Organization of the United Nations: FAO in Emergencies. Available online: http://www.fao.org/emergencies/resources/documents/resources-detail/en/c/178731 (accessed on 1 October 2013).
- Lomer, C.; Bateman, R.; Johnson, D.; Langewald, J.; Thomas, M. Biological control of locusts and grasshoppers. Ann. Rev. Entomol. 2001, 1, 667–702. [Google Scholar] [CrossRef]
- Jiravanichpaisal, P.; Lee, B.L.; Söderhäll, K. Cell-mediated immunity in arthropods: Hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006, 4, 213–236. [Google Scholar] [CrossRef]
- Medzhitov, R.; Janeway, C.A., Jr. Innate immunity: Impact on the adaptive immune response. Curr. Opin. Immunol. 1997, 1, 4–9. [Google Scholar] [CrossRef]
- Clissold, F.J.; Tedder, B.J.; Conigrave, A.D.; Simpson, S.J. The gastrointestinal tract as a nutrient-balancing organ. Proc. R. Soc. B 2010, 277, 1751–1759. [Google Scholar] [CrossRef] [PubMed]
- Goldsworthy, G.; Mullen, L.; Opoku-Ware, K.; Chandrakant, S. Interactions between the endocrine and immune systems in locusts. Physiol. Entomol. 2003, 1, 54–61. [Google Scholar] [CrossRef]
- Pulpitel, T.; Ponton, F. The University of Sydney: Sydney, New South Wales, Australia, Unpublished data. 2011.
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 4, 611–622. [Google Scholar] [CrossRef]
- Chapuis, M.-P.; Tohidi-Esfahani, D.; Dodgson, T.; Blondin, L.; Ponton, F.; Cullen, D.; Simpson, S.J.; Sword, G.A. Assessment and validation of a suite of reverse transcription-quantitative PCR reference genes for analyses of density-dependent behavioural plasticity in the Australian plague locust. BMC Mol. Biol. 2011, 1, 7. [Google Scholar] [CrossRef]
- Ponton, F.; Chapuis, M.-P.; Pernice, M.; Sword, G.A.; Simpson, S.J. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster. J. Insect Physiol. 2011, 6, 840–850. [Google Scholar] [CrossRef]
- Ma, Z.; Yu, J.; Kang, L. Locustdb: A relational database for the transcriptome and biology of the migratory locust (Locusta migratoria). BMC Genomics 2006, 1, 11. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 15, e115. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 9, e45. [Google Scholar] [CrossRef]
- Radonić, A.; Thulke, S.; Mackay, I.M.; Landt, O.; Siegert, W.; Nitsche, A. Guideline to reference gene selection for quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2004, 4, 856–862. [Google Scholar] [CrossRef]
- Walker, N.J. A technique whose time has come. Science 2002, 5567, 557–559. [Google Scholar] [CrossRef]
- Lefever, S.; Hellemans, J.; Pattyn, F.; Przybylski, D.R.; Taylor, C.; Geurts, R.; Untergasser, A.; Vandesompele, J. RDML: Structured language and reporting guidelines for real-time quantitative PCR data. Nucleic Acids Res. 2009, 7, 2065–2069. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; de Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3. [Google Scholar] [CrossRef]
- Yokoi, K.; Koyama, H.; Minakuchi, C.; Tanaka, T.; Miura, K. Antimicrobial peptide gene induction, involvement of toll and imd pathways and defense against bacteria in the red flour beetle, Tribolium castaneum. Results Immunol. 2012, 2, 72–82. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yang, P.; Cui, F.; Kang, L. Altered immunity in crowded locust reduced fungal (Metarhizium anisopliae) pathogenesis. PLOS Pathog. 2013, 1, e1003102. [Google Scholar] [CrossRef]
- Buchon, N.; Osman, D.; David, F.; Boquete, J.-P.; Deplancke, B.; Lemaitre, B. Morphological and molecular characterization of adult midgut compartmentalization in Drosophila. Cell Rep. 2013, 3, 1725–1738. [Google Scholar] [CrossRef] [PubMed]
- Lee, W.-J.; Lee, J.-D.; Kravchenko, V.V.; Ulevitch, R.J.; Brey, P.T. Purification and molecular cloning of an inducible gram-negative bacteria-binding protein from the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 1996, 15, 7888–7893. [Google Scholar] [CrossRef]
- Pili-Floury, S.; Leulier, F.; Takahashi, K.; Saigo, K.; Samain, E.; Ueda, R.; Lemaitre, B. In vivo RNA interference analysis reveals an unexpected role for GNBP1 in the defense against Gram-positive bacterial infection in Drosophila adults. J. Biol. Chem. 2004, 13, 12848–12853. [Google Scholar] [CrossRef]
- Goldsworthy, G.; Opoku-Ware, K.; Mullen, L. Adipokinetic hormone enhances laminarin and bacterial lipopolysaccharide-induced activation of the prophenoloxidase cascade in the african migratory locust, Locusta migratoria. J. Insect Physiol. 2002, 6, 601–608. [Google Scholar] [CrossRef]
- Jang, I.-K.; Pang, Z.; Yu, J.; Kim, S.-K.; Seo, H.-C.; Cho, Y.-R. Selectively enhanced expression of prophenoloxidase activating enzyme 1 (PPAE1) at a bacteria clearance site in the white shrimp, Litopenaeus vannamei. BMC Immunol. 2011, 1. [Google Scholar] [CrossRef]
- Ashida, M.; Brey, P.T. Role of the integument in insect defense: Pro-phenol oxidase cascade in the cuticular matrix. Proc. Natl. Acad. Sci. USA 1995, 23, 10698–10702. [Google Scholar] [CrossRef]
- Cerenius, L.; Söderhäll, K. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 2004, 1, 116–126. [Google Scholar] [CrossRef]
- Eleftherianos, I.; Revenis, C. Role and importance of phenoloxidase in insect hemostasis. J. Innate Immun. 2010, 1, 28–33. [Google Scholar]
- Franssens, V.; Simonet, G.; Breugelmans, B.; van Soest, S.; van Hoef, V.; Vanden Broeck, J. The role of hemocytes, serine protease inhibitors and pathogen-associated patterns in prophenoloxidase activation in the desert locust, Schistocerca gregaria. Peptides 2008, 2, 235–241. [Google Scholar] [CrossRef]
- Lu, A.; Zhang, Q.; Zhang, J.; Yang, B.; Wu, K.; Xie, W.; Luan, Y.-X.; Ling, E. Insect prophenoloxidase: The view beyond immunity. Front. Physiol. 2014, 5, 1–15. [Google Scholar] [PubMed]
- Lourenço, A.P.; Zufelato, M.S.; Bitondi, M.M.G.; Simões, Z.L.P. Molecular characterization of a cDNA encoding prophenoloxidase and its expression in Apis mellifera. Insect Biochem. Mol. Biol. 2005, 6, 541–552. [Google Scholar] [CrossRef]
- Müller, H.-M.; Dimopoulos, G.; Blass, C.; Kafatos, F.C. A hemocyte-like cell line established from the malaria vector Anopheles gambiae expresses six prophenoloxidase genes. J. Biol. Chem. 1999, 17, 11727–11735. [Google Scholar] [CrossRef]
- Cui, L.; Luckhart, S.; Rosenberg, R. Molecular characterization of a prophenoloxidase cDNA from the malaria mosquito Anopheles stephensi. Insect Mol. Biol. 2000, 2, 127–137. [Google Scholar] [CrossRef]
- Ahmed, A.; Martin, D.; Manetti, A.; Han, S.-J.; Lee, W.-J.; Mathiopoulos, K.; Müller, H.-M.; Kafatos, F.; Raikhel, A.; Brey, P. Genomic structure and ecdysone regulation of the prophenoloxidase 1 gene in the malaria vector Anopheles gambiae. Proc. Natl. Acad. Sci. USA 1999, 26, 14795–14800. [Google Scholar] [CrossRef]
- Cho, W.; Liu, H.; Lee, C.; Kuo, C.; Chang, T.; Liu, C.; Chen, C. Molecular cloning, characterization and tissue expression of prophenoloxidase cdna from the mosquito armigeres subalbatus inoculated with dirofilaria immitis microfilariae. Insect Mol. Biol. 1998, 1, 31–40. [Google Scholar] [CrossRef]
- Park, D.-S.; Shin, S.W.; Kim, M.G.; Park, S.S.; Lee, W.-J.; Brey, P.T.; Park, H.-Y. Isolation and characterization of the cDNA encoding the prophenoloxidase of fall webworm, Hyphantria cunea. Insect Biochem. Mol. Biol. 1997, 11, 983–992. [Google Scholar] [CrossRef]
- Hagen, H.-E.; Kläger, S.L.; McKerrow, J.H.; Ham, P.J. Simulium damnosums. 1.: Isolation and identification of prophenoloxidase following an infection with Onchocerca spp. using targeted differential display. Exp. Parasitol. 1997, 3, 213–218. [Google Scholar] [CrossRef]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pulpitel, T.; Pernice, M.; Simpson, S.J.; Ponton, F. Tissue-Specific Immune Gene Expression in the Migratory Locust, Locusta Migratoria. Insects 2015, 6, 368-380. https://doi.org/10.3390/insects6020368
Pulpitel T, Pernice M, Simpson SJ, Ponton F. Tissue-Specific Immune Gene Expression in the Migratory Locust, Locusta Migratoria. Insects. 2015; 6(2):368-380. https://doi.org/10.3390/insects6020368
Chicago/Turabian StylePulpitel, Tamara, Mathieu Pernice, Stephen J. Simpson, and Fleur Ponton. 2015. "Tissue-Specific Immune Gene Expression in the Migratory Locust, Locusta Migratoria" Insects 6, no. 2: 368-380. https://doi.org/10.3390/insects6020368
APA StylePulpitel, T., Pernice, M., Simpson, S. J., & Ponton, F. (2015). Tissue-Specific Immune Gene Expression in the Migratory Locust, Locusta Migratoria. Insects, 6(2), 368-380. https://doi.org/10.3390/insects6020368
