One Step beyond Species Description: Unveiling a Fine-Scale Diversity within the Genus Dzhanokmenia Kostjukov (Hymenoptera: Eulophidae) †
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples Collection
2.2. Specimen Preparations
2.3. DNA Extraction, Amplification and Sequence Editing
| Voucher Number | Species | Sex | Locality | COI | 28S |
|---|---|---|---|---|---|
| CHX_DZH_117 | D. brevifunis | female | Xinjiang, Aletai | C_AA071359.1 | C_AA071403.1 |
| CHX_DZH_118 | D. cf. brevifunis | female | Xinjiang, Aletai | C_AA071360.1 | C_AA071404.1 |
| CHX_DZH_119 | D. brevifunis | female | Xinjiang, Aletai | C_AA071361.1 | C_AA071405.1 |
| CHX_BAR_177 | Baryscapus sp. | female | Beijing | C_AA071358.1 | C_AA071402.1 |
| CHX_DZH_737 | D. brevifunis | female | Qinghai, Ge-Ermu | C_AA071362.1 | C_AA071406.1 |
| CHX_DZH_738 | D. brevifunis | female | Qinghai, Ge-Ermu | C_AA071363.1 | C_AA071407.1 |
| CHX_DZH_739 | D. brevifunis | female | Qinghai, Ge-Ermu | C_AA071364.1 | C_AA071408.1 |
| CHX_DZH_740 | D. brevifunis | female | Qinghai, Ge-Ermu | C_AA071365.1 | C_AA071409.1 |
| CHX_DZH_741 | D. brevifunis | female | Qinghai, Ge-Ermu | C_AA071366.1 | C_AA071410.1 |
| CHX_DZH_742 | D. brevifunis | female | Qinghai, Ge-Ermu | C_AA071367.1 | C_AA071411.1 |
| CHX_DZH_743 | D. brevifunis | female | Xinjiang, Tulufan | C_AA071368.1 | C_AA071412.1 |
| CHX_DZH_744 | D. brevifunis | female | Xinjiang, Tulufan | C_AA071369.1 | C_AA071413.1 |
| CHX_DZH_747 | D. brevifunis | female | Xinjiang, Tulufan | C_AA071370.1 | C_AA071414.1 |
| CHX_DZH_748 | D. brevifunis | female | Xinjiang, Tulufan | C_AA071371.1 | C_AA071415.1 |
| CHX_DZH_888 | D. cf. brevifunis | female | Xinjiang, Aletai | C_AA071372.1 | C_AA071416.1 |
| CHX_DZH_890 | D. brevifunis | female | Xinjiang, Aletai | C_AA071373.1 | - |
| CHX_DZH_891 | D. cf. brevifunis | female | Xinjiang, Aletai | C_AA071374.1 | C_AA071417.1 |
| CHX_DZH_892 | D. brevifunis | female | Xinjiang, Tulufan | C_AA071375.1 | - |
| CHX_DZH_893 | D. sp.1 | female | Xinjiang, Tulufan | C_AA071376.1 | - |
| CHX_DZH_894 | D. cf. brevifunis | female | Xinjiang, Tulufan | C_AA071377.1 | - |
| CHX_DZH_895 | D. brevifunis | female | Xinjiang, Tulufan | C_AA071378.1 | - |
| CHX_DZH_896 | D. cf. antonovae | female | Xinjiang, Aletai | C_AA071379.1 | C_AA071418.1 |
| CHX_DZH_897 | D. cf. antonovae | male | Xinjiang, Aletai | C_AA071380.1 | C_AA071419.1 |
| CHX_DZH_898 | D. sp.2 | female | Xinjiang Aletai | C_AA071381.1 | C_AA071420.1 |
| CHX_DZH_900 | D. brevifunis | female | Xinjiang, Tulufan | C_AA071382.1 | - |
| CHX_DZH_901 | D. brevifunis | female | Qinghai, Germu | C_AA071383.1 | - |
| CHX_DZH_902 | D. cf. brevifunis | female | Xinjiang, Aletai | C_AA071384.1 | C_AA071421.1 |
| CHX_DZH_903 | D. brevifunis | male | Xinjiang, Tulufan | C_AA071385.1 | C_AA071422.1 |
| CHX_DZH_904 | D. brevifunis | male | Xinjiang, Tulufan | C_AA071386.1 | C_AA071423.1 |
| CHX_DZH_906 | D. karamayica | female | Xinjiang, Karamay | C_AA071387.1 | C_AA071424.1 |
| CHX_DZH_907 | D. gobica | female | Xinjiang, Shihezi | C_AA071388.1 | C_AA071425.1 |
| CHX_DZH_908 | D. cf. sugonjaevi | female | Xinjiang, Aletai | C_AA071389.1 | C_AA071426.1 |
| CHX_DZH_909 | D. muleica | female | Xinjiang, Karamay | - | C_AA071427.1 |
| CHX_DZH_910 | D. gobica | female | Xinjiang, Fukang | C_AA071390.1 | C_AA071428.1 |
| CHX_TET_054 | Tetrastichus howardi | female | Brazil, Sete Lagoas | C_AA071391.1 | OP538682.1 |
| NT-04 | D. karamayica | female | Xinjiang, Karamay | C_AA071392.1 | C_AA071429.1 |
| NT-05 | D. karamayica | female | Xinjiang, Karamay | C_AA071393.1 | C_AA071430.1 |
| NT-06 | D. karamayica | male | Xinjiang, Karamay | C_AA071394.1 | C_AA071431.1 |
| NT-07 | D. karamayica | male | Xinjiang, Karamay | C_AA071395.1 | C_AA071432.1 |
| NT-08 | D. gobica | male | Xinjiang, Shihezi | C_AA071396.1 | C_AA071433.1 |
| NT-09 | D. gobica | female | Xinjiang, Shihezi | C_AA071397.1 | C_AA071434.1 |
| NT-10 | D. gobica | male | Xinjiang, Shihezi | C_AA071398.1 | C_AA071435.1 |
| NT-11 | D. gobica | male | Xinjiang, Shihezi | C_AA071399.1 | C_AA071436.1 |
| NT-13 | D. gobica | female | Xinjiang, Shihezi | C_AA071400.1 | C_AA071437.1 |
| NT-16 | D. gobica | male | Xinjiang, Shihezi | C_AA071401.1 | C_AA071438.1 |
| Gene | Primer | Sequence (5′-3′) | References |
|---|---|---|---|
| COI | LCO1490 | GGTCA ACAAA TCATA AAGAT ATTGG | [30] |
| COI | HCOout | CCAGG TAAAA TTAAA ATATA AACTTC | [31] |
| COI | FWPTF1 | CCTGG TTCTT TRATT GGTAA TGATC | [32] |
| COI | Lep-R1 | TAAAC TTCTG GATGT CCAAA AAATCA | [33] |
| 28S | D2-3549F | AGTCG TGTTG CTTGA TAGTG CAG | [34] |
| 28S | D2-3665F | AAGAGAGAGTTCAAGAGTACGTG | [35] |
| 28S | D2-4068R | TTGGT CCGTG TTTCA AGACG GG | [34] |
| 28S | D3-4083R | TAGTT CACCA TCTTT CGGGT CCC | [35] |
2.4. Species Delimitation
2.5. Phylogenetic Analysis
3. Results
3.1. Species Identification and Delimitation
3.2. Phylogenetic Analyses
3.3. Morphological Diagnosis and Species Treatments of Dzhanokmenia
3.3.1. Genus Dzhanokmenia Kostjukov, 1977
3.3.2. Dzhanokmenia brevifunis Ganbaatar & Cao, sp. nov.
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Noyes, J. Universal Chalcidoidea Database. 2019. Available online: http://www.nhm.ac.uk/chalcidoids (accessed on 18 April 2024).
- Gauthier, N.; LaSalle, J.; Quicke, D.L.; Godfray, H. Phylogeny of Eulophidae (Hymenoptera: Chalcidoidea), with a reclassification of Eulophinae and the recognition that Elasmidae are derived eulophids. Syst. Entomol. 2000, 25, 521–539. [Google Scholar] [CrossRef]
- Burks, R.A.; Heraty, J.M.; Gebiola, M.; Hansson, C. Combined molecular and morphological phylogeny of Eulophidae (Hymenoptera: Chalcidoidea), with focus on the subfamily Entedoninae. Cladistics 2011, 27, 581–605. [Google Scholar] [CrossRef] [PubMed]
- Cruaud, A.; Rasplus, J.-Y.; Zhang, J.; Burks, R.; Delvare, G.; Fusu, L.; Gumovsky, A.; Huber, J.T.; Janšta, P.; Mitroiu, M.-D.; et al. The Chalcidoidea bush of life: Evolutionary history of a massive radiation of minute wasps. Cladistics 2023, 40, 34–63. [Google Scholar] [CrossRef] [PubMed]
- Rasplus, J.Y.; Blaimer, B.B.; Brady, S.G.; Burks, R.A.; Delvare, G.; Fisher, N.; Gates, M.; Gauthier, N.; Gumovsky, A.V.; Hansson, C.; et al. A first phylogenomic hypothesis for Eulophidae (Hymenoptera, Chalcidoidea). J. Nat. Hist. 2020, 54, 597–609. [Google Scholar] [CrossRef]
- UCD Community. Universal Chalcidoidea Database Website. 2023. Available online: https://ucd.chalcid.org (accessed on 18 April 2024).
- Kostjukov, V.V. Comparative morphology of chalcids of the subfamily Tetrastichinae and the system of the genus Tetrastichus Haliday, 1844 (Hymenoptera, Eulophidae). Entomol. Obozr. 1977, 56, 177–194, (In Russian with English Summary). [Google Scholar]
- Kostjukov, V.V. Subfam. 5. Tetrastichinae. In Keys to the Insects of the European Part of the USSR—Volume III, Hymenoptera, Part 2; Medvedev, G.S., Trjapitzin, V.A., Eds.; Nauka Leningrad Division: Leningrad, Russia, 1978; pp. 430–467. (In Russian) [Google Scholar]
- Kostjukov, V.V. New species of the genus Tetrastichus Haliday, 1844 (Hymenoptera, Eulophidae) from Turkmenistan. In Entomophages of the Orchards Pests; Shtiintsa: Kishinev, Moldova, 1984; pp. 30–35. (In Russian) [Google Scholar]
- Graham, M.W.R.d.V. A Reclassification of the European Tetrastichinae (Hymenoptera: Eulophidae): Revision of the Remaining Genera; Associated Publishers c/o American Entomological Institute: Gainesville, FL, USA, 1991; pp. 1–322. [Google Scholar]
- Kostjukov, V.V. New species of Dzhanokmenia Kostjukov, 1977 and Kolopterna Graham, 1987 (Hymenoptera, Eulophidae, Tetrastichinae) from Turkmenistan. Biol. Plant Prot. Basis Ecosyst. Stab. Agroecosyst. 2014, 8, 84–91. [Google Scholar]
- Kostjukov, V.V.; Kosheleva, O.V. New species of Dzhanokmenia Kostjukov and Kolopterna Graham (Hymenoptera: Eulophidae: Tetrastichinae) from Russia. Proc. Russ. Entomol. Soc. 2014, 85, 160–164. [Google Scholar]
- Kostjukov, V.V.; Kosheleva, O.V. A new species of the eulophid-wasp genus Dzhanokmenia Kostjukov, 1977 (Hymenoptera, Eulophidae: Tetrastichinae) from Stavropol Territory. Entomol. Obozr. 2015, 94, 451–454. [Google Scholar] [CrossRef]
- Li, Q.; Wang, C.; Hu, H.Y.; Kostjukov, V.V.; LaSalle, J.; Zhu, C.D. Descriptions of three new species of Dzhanokmenia (Hymenoptera: Eulophidae) from China. Zootaxa 2016, 4121, 447–457. [Google Scholar] [CrossRef]
- Li, Q.; Wang, C.; Hu, H.Y. Two new species of Dzhanokmenia (Hymenoptera, Eulophidae) from China, with first report on a host association for the genus. ZooKeys 2021, 1009, 67–79. [Google Scholar] [CrossRef]
- Guo, S.H.; Kang, N.; Li, Q.; Hu, H.Y. Species and identification of Dzhanokmenia in China (Hymenoptera:Eulophidae). Sichuan Anim. 2022, 41, 63–73. [Google Scholar]
- Burks, R.; Mitroiu, M.-D.; Fusu, L.; Heraty, J.M.; Janšta, P.; Heydon, S.; Papilloud, N.D.-S.; Peters, R.S.; Tselikh, E.V.; Woolley, J.B.; et al. From Hell’s Heart I Stab at Thee! A Determined Approach towards a Monophyletic Pteromalidae and Reclassification of Chalcidoidea (Hymenoptera). J. Hymenopt. Res. 2022, 94, 13–88. [Google Scholar] [CrossRef]
- Munro, J.B.; Heraty, J.M.; Burks, R.A.; Hawks, D.; Mottern, J.; Cruaud, A.; Rasplus, J.Y.; Jansta, P. A Molecular Phylogeny of the Chalcidoidea (Hymenoptera). PLoS ONE 2011, 6, e27023. [Google Scholar] [CrossRef]
- van Noort, S.; Mitroiu, M.-D.; Burks, R.; Gibson, G.; Hanson, P.; Heraty, J.; Jansta, P.; Cruaud, A.; Rasplus, J.-Y. Redefining Ormyridae (Hymenoptera, Chalcidoidea) with establishment of subfamilies and description of new genera. Syst. Entomol. 2024, 1–48. [Google Scholar] [CrossRef]
- Zhang, J.X.; Lindsey, A.R.I.; Peters, R.S.; Heraty, J.M.; Hopper, K.R.; Werren, J.H.; Martinson, E.O.; Woolley, J.B.; Yoder, M.J.; Krogmann, L. Conflicting signal in transcriptomic markers leads to a poorly resolved backbone phylogeny of chalcidoid wasps. Syst. Entomol. 2020, 45, 783–802. [Google Scholar] [CrossRef]
- Cruaud, A.; Delvare, G.; Nidelet, S.; Sauné, L.; Ratnasingham, S.; Chartois, M.; Blaimer, B.B.; Gates, M.; Brady, S.G.; Faure, S.; et al. Ultra-conserved elements and morphology reciprocally illuminate conflicting phylogenetic hypotheses in Chalcididae (Hymenoptera, Chalcidoidea). Cladistics 2021, 37, 1–35. [Google Scholar] [CrossRef] [PubMed]
- Hong, D.; Zhuang, W.; Zhu, M.; Ma, K.; Wang, X.; Huang, D.; Zhang, Y.; Ren, G.; Bu, W.; Cai, W.; et al. Positioning taxonomic research for the future. Zool. Syst. 2022, 47, 185–187. [Google Scholar]
- Mitroiu, M.D.; Rasplus, J.Y.; van Noort, S. New genera of Afrotropical Chalcidoidea (Hymenoptera: Cerocephalidae, Epichrysomallidae, Pirenidae and Pteromalidae). PeerJ 2024, 12, e16798. [Google Scholar] [CrossRef]
- Zhu, C.; Luo, A.; Bai, M.; Orr, M.C.; Hou, Z.; Ge, S.; Chen, J.; Hu, Y.; Zhou, X.; Qiao, G.; et al. A joint call for actions to advance taxonomy in China. Zool. Syst. 2022, 47, 188–197. [Google Scholar]
- Cao, H.X.; Dale-Skey, N.; Guo, P.F.; Zhu, C.D. Parasitoid wasps with enlarged mandibles associated with aculeate Hymenoptera: An integrative taxonomy of Chaenotetrastichus Graham and Styotrichia LaSalle (Hymenoptera: Eulophidae). Insect Syst. Evol. 2024, 53, 1–26. [Google Scholar] [CrossRef]
- Gibson, G.A.P. Morphology and terminology. In Annotated Keys to the Genera of Nearctic Chalcidoidea (Hymenoptera); Gibson, G.A.P., Huber, J.T., Woolley, J.B., Eds.; NRC Research Press: Ottawa, ON, Canada, 1997; pp. 16–44. [Google Scholar]
- Huangfu, N.; Cao, H.-X.; Zhu, C.-D. Notes on the Genus Aceratoneuromyia Girault (Hymenoptera: Eulophidae). Insects 2022, 13, 450. [Google Scholar] [CrossRef]
- Hall, T. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Carpenter, J.M. Towards simultaneous analysis of morphological and molecular data in Hymenoptera. Zool. Scr. 1999, 28, 251–260. [Google Scholar] [CrossRef]
- Li, Y.W.; Zhou, X.; Feng, G.; Hu, H.Y.; Niu, L.M.; Hebert, P.D.N.; Huang, D.W. COI and ITS2 sequences delimit species, reveal cryptic taxa and host specificity of fig-associated Sycophila (Hymenoptera, Eurytomidae). Mol. Ecol. Resour. 2010, 10, 31–40. [Google Scholar] [CrossRef] [PubMed]
- Hebert, P.D.N.; Penton, E.H.; Burns, J.M.; Janzen, D.H.; Hallwachs, W. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. Acad. Sci. USA 2004, 101, 14812–14817. [Google Scholar] [CrossRef]
- Campbell, B.C.; Steffen-Campbell, J.D.; Werren, J.H. Phylogeny of the Nasonia species complex (Hymenoptera: Pteromalidae) inferred from an internal transcribed spacer (ITS2) and 28S rDNA sequences. Insect Mol. Biol. 1993, 2, 225–237. [Google Scholar] [CrossRef]
- Gillespie, J.J.; Munro, J.B.; Heraty, J.M.; Yoder, M.J.; Owen, A.K.; Carmichael, A.E. A secondary structural model of the 28S rRNA expansion segments D2 and D3 for chalcidoid wasps (Hymenoptera: Chalcidoidea). Mol. Biol. Evol. 2005, 22, 1593–1608. [Google Scholar] [CrossRef]
- Puillandre, N.; Lambert, A.; Brouillet, S.; Achaz, G. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 2012, 21, 1864–1877. [Google Scholar] [CrossRef]
- Pons, J.; Barraclough, T.G.; Gomez-Zurita, J.; Cardoso, A.; Duran, D.P.; Hazell, S.; Kamoun, S.; Sumlin, W.D.; Vogler, A.P. Sequence-Based Species Delimitation for the DNA Taxonomy of Undescribed Insects. Syst. Biol. 2006, 55, 595–609. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2024; Available online: https://www.R-project.org/ (accessed on 26 April 2024).
- Suchard, M.A.; Lemey, P.; Baele, G.; Ayres, D.L.; Drummond, A.J.; Rambaut, A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef] [PubMed]
- Drummond, A.J.; Ho, S.Y.W.; Phillips, M.J.; Rambaut, A. Relaxed phylogenetics and dating with confidence. PLoS Biol. 2006, 4, 699–710. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, M.; Kishino, H.; Yano, T. Dating of human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 1985, 22, 160–174. [Google Scholar] [CrossRef] [PubMed]
- Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v6: Recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024, gkae268. [Google Scholar] [CrossRef]
- LaSalle, J.; Graham, M.W.R.d.V. On the identity of Baryscapus Förster (Hymenoptera: Eulophidae: Tetrastichinae). Entomol. Gaz. 1990, 41, 121–128. [Google Scholar]
- LaSalle, J. North American genera of Tetrastichinae (Hymenoptera, Eulophidae). J. Nat. Hist. 1994, 28, 109–236. [Google Scholar] [CrossRef]
- Song, H.-T.; Fei, M.-H.; Li, B.-P.; Zhu, C.-D.; Cao, H.-X. A new species of Oomyzus Rondani (Hymenoptera, Eulophidae) reared from the pupae of Coccinella septempunctata (Coleoptera, Coccinellidae) in China. ZooKeys 2020, 953, 49–60. [Google Scholar] [CrossRef]








Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ganbaatar, B.; Li, Q.; Xi, O.; Cao, H.; Zhu, C. One Step beyond Species Description: Unveiling a Fine-Scale Diversity within the Genus Dzhanokmenia Kostjukov (Hymenoptera: Eulophidae). Insects 2024, 15, 406. https://doi.org/10.3390/insects15060406
Ganbaatar B, Li Q, Xi O, Cao H, Zhu C. One Step beyond Species Description: Unveiling a Fine-Scale Diversity within the Genus Dzhanokmenia Kostjukov (Hymenoptera: Eulophidae). Insects. 2024; 15(6):406. https://doi.org/10.3390/insects15060406
Chicago/Turabian StyleGanbaatar, Bolormaa, Qin Li, Ouyan Xi, Huanxi Cao, and Chaodong Zhu. 2024. "One Step beyond Species Description: Unveiling a Fine-Scale Diversity within the Genus Dzhanokmenia Kostjukov (Hymenoptera: Eulophidae)" Insects 15, no. 6: 406. https://doi.org/10.3390/insects15060406
APA StyleGanbaatar, B., Li, Q., Xi, O., Cao, H., & Zhu, C. (2024). One Step beyond Species Description: Unveiling a Fine-Scale Diversity within the Genus Dzhanokmenia Kostjukov (Hymenoptera: Eulophidae). Insects, 15(6), 406. https://doi.org/10.3390/insects15060406

