Next Article in Journal
Influence of Alternative Prey on the Functional Response of a Predator in Two Contexts: With and without Intraguild Predation
Previous Article in Journal
Upf2-Mediated Nonsense-Mediated Degradation Pathway Involved in Genetic Compensation of TrpA1 Knockout Mutant Silkworm (Bombyx mori)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 5
10.3390/insects15050314
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CRISPR/Cas9-Based Functional Characterization of SfUGT50A15 Reveals Its Roles in the Resistance of Spodoptera frugiperda to Chlorantraniliprole, Emamectin Benzoate, and Benzoxazinoids

by
Zhan Shi
1,2,3,
Mei Luo
1,
Jinxi Yuan
1,
Bin Gao
1,4,
Minghuan Yang
1,5 and
Guirong Wang
1,*
1
Shenzhen Branch, Guangdong Laboratory of Lingnan Modern Agriculture, Genome Analysis Laboratory of the Ministry of Agriculture and Rural Affairs, Agricultural Genomics Institute at Shenzhen, Chinese Academy of Agricultural Sciences, Shenzhen 518120, China
2
School of Life Sciences, Henan University, Kaifeng 475004, China
3
Shenzhen Research Institute, Henan University, Shenzhen 518000, China
4
Guangxi Key Laboratory of Agri-Environmental and Agri-Products Safety, College of Agriculture, Guangxi University, Nanning 530004, China
5
Key Laboratory of Sustainable Forest Ecosystem Management—Ministry of Education, Northeast Forestry University, Harbin 150040, China
*
Author to whom correspondence should be addressed.
Insects 2024, 15(5), 314; https://doi.org/10.3390/insects15050314
Submission received: 22 March 2024 / Revised: 15 April 2024 / Accepted: 18 April 2024 / Published: 26 April 2024
(This article belongs to the Section Insect Pest and Vector Management)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Uridine diphosphate (UDP)-glycosyltransferases (UGTs) are significant phase II detoxification enzymes in insects. In this study, we have utilized CRISPR/Cas9 to generate SfUGT50A15 knockout strains to explore its possible function in governing sensitivity to chemical insecticides or benzoxazinoids. The bioassay results indicated that the SfUGT50A15 knockout strains were significantly more sensitive to chlorantraniliprole, emamectin benzoate, and benzoxazinoids than the wild-type strains. This finding highlights the involvement of SfUGT50A15 in the resistance of Spodoptera frugiperda to chlorantraniliprole, emamectin benzoate, and benzoxazinoids. This study not only presents new molecular targets for controlling S. frugiperda but also establishes a foundation for the control of lepidopteran pests.

Abstract

UDP-glycosyltransferases (UGTs) are a diverse superfamily of enzymes. Insects utilize uridine diphosphate-glucose (UDP-glucose) as a glycosyl donor for glycosylation in vivo, involved in the glycosylation of lipophilic endosymbionts and xenobiotics, including phytotoxins. UGTs act as second-stage detoxification metabolizing enzymes, which are essential for the detoxification metabolism of insecticides and benzoxazine compounds. However, the UGT genes responsible for specific glycosylation functions in S. frugiperda are unclear at present. In this study, we utilized CRISPR/Cas9 to produce a SfUGT50A15-KO strain to explore its possible function in governing sensitivity to chemical insecticides or benzoxazinoids. The bioassay results suggested that the SfUGT50A15-KO strain was significantly more sensitive to chlorantraniliprole, emamectin benzoate, and benzoxazinoids than the wild-type strains. This finding suggests that the overexpression of the SfUGT50A15 gene may be linked to S. frugiperda resistance to pesticides (chlorantraniliprole and emamectin benzoate) as well as benzoxazinoids (BXDs).

1. Introduction

Spodoptera frugiperda (Lepidoptera: Noctuidae) is a notorious invasive pest characterized by its broad host range, high fecundity, and high adaptability [1]. It can infest 353 plant species, including important crops such as maize (Zea mays), rice (Oryza sativus), cotton (Gossypium hirsutum), and sorghum (Sorghum bicolor) [2]. Spodoptera frugiperda is native to the tropical and subtropical regions of the Americas [3]. Following its invasion of Africa in 2016, it has spread to 44 countries throughout the continent in just two years [4]. Since invading China in January 2019, it has expanded across 26 provinces [5]. Currently, the utilization of chemical pesticides is the primary approach for controlling S. frugiperda [6]. However, the widespread use of chemical pesticides has resulted in genetic resistance, lowering the efficiency of common chemical pesticides. Therefore, understanding the genetic mechanism of pesticide resistance in S. frugiperda is critical for the efficient chemical management of this pest [7,8].
UDP-glycosyltransferases (UGTs) are a class of multifunctional enzymes, widely found in viruses, bacteria, fungi, plants, and animals [9]. UGTs primarily use UDP-glucuronic acid as a sugar donor in mammals, while UDP-glucose is used as a sugar donor in plants and insects [10]. Many studies have demonstrated that UGTs are located in various insect organs such as the fat body, midgut, and antennae [10,11,12]. Insect UGTs are important components of the phase II detoxification metabolizing enzymes, which have a crucial role in the metabolism of exogenous substances, hlorantraniliprole, tebufenozide, indoxacarb, chlorfenapyr, spinosyns, abamectin, and metaflumizone [13,14,15]. For instance, the expression levels of the genes UGT40R3 and UGT46A6 were significantly up-regulated following insecticide treatment in Spodoptera mauritia [11]. The suppression of the genes UGT40D17, UGT40F20, and UGT40R18 in S. frugiperda significantly elevates the insensitivity of field populations to chlorpyrifos and chlorfenapyr [16].
Besides chemical pesticides, it has been reported that UGTs of S. frugiperda can detoxify the predominant secondary metabolite of maize, benzoxazinoids (BXDs), which have been reported to suppress the growth of various insect herbivores of maize [17,18,19]. In maize, BXDs are constitutively stored in vacuoles as inactive glucosides. Upon insect attack, the disruption of maize tissues can lead to the exposure of BXD glucosides to their specific β-glucosidases, causing the release of the active aglucones and their toxic degradation products [20,21]. In S. frugiperda, SfUGT33F28 and SfUGT40L8 can re-glycosylate toxic benzoxazinoids into non-toxic stable glucosides to detoxify benzoxazinoids [22].
The UGT50 family is the most conserved among the UGT families and is considered the ancestor UGT family in insects [10]. However, functional studies on the UGT50 family in insects have not been reported. In this study, a SfUGT50A15 knockout strain (SfUGT50A15-KO) was developed using CRISPR/Cas9 technology to investigate its function in tolerance towards chemical pesticides and benzoxazinoids. In the results, the knockout strain exhibited higher mortality rates than the wild-type in the presence of chlorantraniliprole and emamectin benzoate. This strain also grew slower than the wild-type on maize tissues, but this difference was absent with a mutated maize genotype with minimal BXD. These findings indicate that SfUGT50A15 contributes to the detoxification of chemical pesticides and plant defense metabolites. This provides new insights into the function of the ancestral UGT gene family UGT50 in insects.

2. Materials and Methods

2.1. Insects

The experimental S. frugiperda colony was collected from Ruili, Yunnan Province, China, in December 2019 and maintained in laboratory environments since then. The S. frugiperda larvae were grown on artificial diets [23] under routine laboratory conditions (a temperature of 27 ± 1 °C, humidity of 65 ± 5%, and a photoperiod of 14 h of light and 10 h of darkness). Adults were fed on 10% sucrose solution and were not exposed to any insecticides or benzoxazinoids during rearing.

2.2. Insecticides and Plants

The insecticides utilized in the bioassay (chlorantraniliprole, emamectin benzoate, chlorantraniliprole, spinetoram, lufenuron) were purchased from Mannhage (Shanghai, China) Biotechnology Company, and other reagents employed in the experiments were analytically pure. Two maize strains were utilized in this study, the BX knockout mutant BX2 (bx2::Ds) and the wild-type maize strain W22. Plants were grown for two weeks in a growth chamber under a controlled photoperiod of 16 h of light and 8 h of darkness, and 180 mm−2/s−1 of photons at a constant temperature of 23 °C and 60% humidity. The maize strains utilized in this study were provided by Dr. Shaoqun Zhou’s lab.

2.3. Characterization and Cluster Analysis of SfUGT50A15 Sequences

The cDNA sequence of the SfUGT50A15 gene was queried based on the transcriptome and genome databases of S. frugiperda (XP_035437704.2). The UGT50A protein sequences of other Lepidopteran species (Bombyx mori, Zygaena filipendulae, Tuta absoluta, Plutella xylostella, Chilo suppressalis, Helicoverpa armigera, and Spodoptera exigua) were retrieved and downloaded from the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 1 December 2023). Multiple alignments were performed for eight UGT50A genes using MAFFT v7.487 (https://mafft.cbrc.jp/align-ment/soft-ware/, accessed on 1 December 2023) and the phylogenetic tree was constructed using FastTree v2.1.10 with default parameters [24]. The tree was visualized by EvolView (https://www.evolgenius.info/evolview-v2/, accessed on 1 December 2023) ProtParam (https://web.expasy.org/protparam/, accessed on 1 December 2023) was utilized to examine the physicochemical properties of amino acids. SOPMA (NPS@: SOPMA secondary structure prediction (ibcp. fr)) was utilized to predict the secondary structure. TMHMM Server 2.0 (https://services.healthtech.dtu.dk/service.php?TMHMM-2.0, accessed on 1 December 2023) was employed to predict transmembrane structural domains.

2.4. Extraction of Total RNA and Synthesis of cDNA

The complete body of S. frugiperda individuals across different developmental stages, various tissues of 5th-instar larvae including fat body (FB), midgut (MG), marsupial tube (MT), salivary gland (SA), spermathecae (VD), head (H), and epidermis (EP) were obtained, and total RNA was extracted using the Trizol reagent (Ambion) [25]. The total RNA was reverse transcribed to produce cDNA using HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China, Cat. No. R312-02), following the manufacturer’s instructions.

2.5. Cloning and Analysis of the SfUGT50A15 Gene

To confirm the identity of the full-length sequence of the SfUGT50A15 gene, specific primers were designed according to the cDNA sequence (Table 1). PCR products were run on a 1.5% agarose gel, and the bands were recovered and purified through the use of an AxyPrep™ DNA Gel Extraction Kit (Axygen, Suzhou, China). The purified PCR products were subcloned into the pEASY-Blunt (pEASY®-Blunt Cloning Kit, TransGen, Beijing, China, Cat. No. CB101-01) vector for sequencing. Sequence accuracy was characterized by comparing genomic and cDNA sequences.

2.6. Quantitative Real-Time PCR

To characterize the stage and tissue expression profile of SfUGT50A15, RNA templates were generated from larval tissues at different developmental stages. The specific primers (Table 1) for qPCR of the SfUGT50A15 gene were designed using Primer Premier 5.0 software. SfActin was utilized as the reference gene to characterize the period and tissue expression of SfUGT50A15 by qRT-PCR, and analyzed using triplicate experiments. The results were analyzed using the 2−(∆∆Ct) method [26].

2.7. Design and Preparation of sgRNA for CRISPR/Cas9

According to the CRISPR/Cas9 target design principle 5′-20bp-NGG-3′, the ORF region of the SfUGT50A15 gene was used as a specific target with the online software CRISPOR (http://crispor.tefor.net accessed on 1 September 2023). The sgRNA site sequence (5′-TACTCCGTCACCCCATTCTTTGG-3′) was constructed and screened on the fifth exon. The selected sgRNA was compared to the S. frugiperda genome, and no potential off-target site was identified. A pair of primers (Table 1) was designed that flanked the editing site for edited allele screening at the genomic level. The sgRNA was synthesized according to the manufacturer’s instructions and transcribed in vitro using the GeneArt Precision gRNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA, Cat. No. A29377). The Cas9 protein (TrueCutTM Cas9 Protein v2) was acquired from Thermo Fisher Scientific.

2.8. Egg Collection and Microinjection

Fresh eggs within 1 h of laying were rinsed and treated with sterile water and attached to slides using double-sided adhesive tape. Samples of 8 μL of 300 ng/μL SfUGT50A15 sgRNA, 1 μL of 5mg/mL Cas9 protein, and 1 μL of phenol red solution were combined (a total 10 μL system), and 2 nL of the mixture was injected into each egg via microinjection (Nanoject III, Drummond, NC, USA). The microinjected eggs (G0 generation) were maintained at a temperature of 27 ± 1 °C and a humidity of 65 ± 5% until hatching.

2.9. Phenotypic Observation and Mutation Analysis

The G0 generation of S. frugiperda was counted for hatching and mutation rates. One of the midfeet was removed at the adult stage, and genomic DNA was extracted using the PURELINK Genomic DNA Kit (Invitrogen, Waltham, MA, USA, Cat. No. K182001) following the product instructions, and gene fragments containing sgRNA targets were amplified with gene-specific primers (Table 1). The amplification conditions were established as one cycle of 98 °C for 3 min, followed by 35 cycles of 98 °C for 10 s, 56 °C for 15 s, and 72 °C for 15 s, and ultimately a final extension period at 72 °C for 10 min. The quality of amplification products was examined using agarose gel electrophoresis. The PCR products were sequenced, and mutant individuals were identified according to the double sequencing peaks. Following the screening of heterozygous mutants in the G1 generation, individuals of the G2 generation were obtained through mating. Subsequently, homozygous mutants of the G2 generation underwent screening. These homozygous mutants from the G2 generation serve as the basis for population expansion. Individuals homozygous for mutants in the G4 generation and beyond are designated for bioassay experiments.

2.10. Fitness Cost Analysis

Egg masses laid on the same day by the wild-type strain and the SfUGT50A15-KO strain were harvested and maintained in the same environment to hatch. Each strain was selected as a group of 30 first-hatched larvae, repeated in three groups. Each first-hatched larva was caged individually in a small box and reared on artificial feed until pupation. After fledging, five pairs of adults were randomly chosen from each strain for pairing. The number of eggs laid and the number of eggs hatched were counted. During the experiment, the larval stage, pupal weight, eclosion time, lifespan of adult, egg production and hatching rate were observed and counted.

2.11. Insect Bioassay

The toxicity of five pesticides towards wild-type S. frugiperda and the SfUGT50A15 knockout strain were characterized by dosing the artificial diet [27]. The pesticide-dosed diet was sectioned into approximately 5 mm3 cubes and placed in 24-well plates, with one third-instar larva kept in each well. Mortality was identified after two days, and the larvae were considered dead if they did not respond to gentle touching with a brush, or if there were obvious symptoms of poisoning (e.g., deformities, convulsions). Mortality data were used to compute the insecticide concentration killing 50% of the larvae and the corresponding 95% confidence limits. LC50 values were considered significantly different if the confidence limits did not overlap [28].
Toxicological treatments were performed using the feed mixing method, where the pesticides were sequentially diluted in sterile water to four concentrations (1 μg/g, 2 μg/g, 4 μg/g, 8 μg/g), and mortality was documented after 48 h. Four sets of biological replicates for each concentration were employed, with each replicate containing 48 3rd-instar larvae that hatched on the same day.
Both W22 and bx2::Ds maize seedlings were planted. Fourteen days following seedling emergence, neonates of wild-type S. frugiperda and the SfUGT50A15 knockout strain were gently placed on seedling leaves (three neonates per seedling), and caged with a plastic box. Each larva was weighed after seven days of feeding.

2.12. Statistical Analysis

Biological data were analyzed using IBM SPSS Statistics 23.0 software (IBM Corp., Armonk, NY, USA). Data are presented as mean ± standard error. Two treatments were compared using Student’s t-test with normal distributions. Statistical significance was determined using one-way ANOVA with LSD post-test (p ≤ 0.05 was considered significant) in different treatments [29]. Figures were prepared using GraphPad Prism 8.0 (https://www.graphpad.com, accessed on 1 December 2023).

3. Results

3.1. Sequence and Phylogenetic Analysis of the UGT Gene

The SfUGT50A15 gene sequence is 1635 bp in length and encodes 544 amino acids. In the generated phylogenetic tree of UGT, S. frugiperda was more homologous with S. exigua, with a high homology and close affinity, followed by a somewhat close affinity with H. armigera, supported by a good self-expansion value (100%), indicating a short differentiation time and lower variation (Figure 1a). The predicted secondary structure of SfUGT50A15 showed that the protein contained 35.29% random coils, 47.98% alpha helixes, 3.68% beta-turns, and 13.05% extended strands (Figure 1b). This protein is predicted to contain two transmembrane domains (Figure 1c).

3.2. Expression Profiles of SfUGT50A15

We employed quantitative real-time PCR to examine the expression pattern of SfUGT50A15 across various developmental stages and tissue types. The mRNA levels of SfUGT50A15 increased gradually from the egg stage to the third-instar larvae, were reduced from the third to the sixth instar, and significantly increased following the pupal stage in adult females (Figure 2a). In the tissue expression profile of the larvae, SfUGT50A15 expression was highest in the Malpighian tube (Figure 2b).

3.3. Generation of the SfUGT50A15-KO Line

A strain with a 3 bp deletion and a 2 bp insertion was selected from the mutations detected (Figure 3). The G1 generation larvae obtained by crossing G0-generation moths with the wild-type strain were reared to adulthood, and the midfeet of the adults were harvested for sequencing. Three hundred G1-generation adults of the same mutation type (3 bp deletion and a 2 bp insertion) were obtained. These adults were harvested and crossed with wild-type individuals to obtain the G2 generation. Three hundred individuals from the G2 group were genotyped using target genomic sequencing, of which 45.3% (136/300) were homozygous. These homozygous adult individuals were maintained in the same cage and mated to generate the SfUGT50A15 knockout strain (SfUGT50A15-KO).

3.4. No Fitness Costs Were Associated with the Knockout

We examined the cost of the adaptation of the SfUGT50A15 knockout strain. As a result, there were no significant differences in the larval period, eclosion time, pupae weight, adult lifespan, fecundity, or egg hatching rate between the two genotypes (Figure 4).

3.5. Effect of SfUGT50A15 Knockout on the Susceptibility of S. frugiperda Larvae to Insecticides

The susceptibility of third-instar larvae to chlorantraniliprole and emamectin benzoate in the SfUGT50A15-KO line was significantly elevated (according to non-overlapping confidence limits) by 5.67 and 5.00 times, respectively (based on LC50 values). The results of the bioassays using other insecticides exhibited no significant change in the susceptibility of the SfUGT50A15-KO larvae compared to the wild-type larvae (Table 2).
The bioassay findings indicated that the greatest difference in the mortality between the wild-type strain and SfUGT50A15-KO strain was found after treatment with chloramectin benzoate, followed by emamectin benzoate. For chlorantraniliprole, the mortality rate of SfUGT50A15-KO was consistently higher than that of the wild-type (Figure 5a). For emamectin benzoate, SfUGT50A15-KO had a similar mortality rate as that of the wild-type at 1 µg/g. However, at higher concentrations, the mortality rate of the SfUGT50A15-KO larvae was significantly higher than that of the wild-type (Figure 5b).

3.6. Susceptibility of Larvae to Benzoxazinoids Following SfUGT50A15 Knockout

To characterize the role of SfUGT50A15 in the detoxification of benzoxazinoids, we performed bioassays using a BXD-deficient mutant line, bx2::Ds, and its wild-type progenitor, W22. Whereas the wild-type larvae grew similarly on the W22 and the bx2::Ds plants, the SfUGT50A15-KO larvae grew significantly better on the bx2::Ds plants than the W22 plants (Figure 6). This indicates that the SfUGT50A15 gene is important in the tolerance of S. frugiperda to benzoxazinoids.

4. Discussion

Glucuronidation is a major reaction catalyzed by the UGT family, which is associated with the detoxification process and that is reported in many insect genomes, like Bemisia tabaci [18], P. xylostella [19], S. exigua [30], S. litura [31], and S. frugiperda [32]. The function of UGTs in drug resistance in insects has attracted increasing attention, as UGT genes are associated with insects’ detoxification of exogenous substances. However, functional studies on the tolerance of the UGT50 family are limited. The UGT50 family is the most conserved UGT family in insects, and UGT50A from Lepidoptera is a single-copy gene [10]. Therefore, whether the UGT50A in Lepidoptera could evolve to develop the ability to detoxify plant secondary metabolites and pesticides is the big question in this study.
Previous studies have indicated that UGTs enhance catalytic activity leading to the resistance of Musca domestica to insecticides [33]. Through bioassays and transcriptome sequencing, it has been observed that certain UGT mRNAs have shown an upregulation trend, suggesting the potential involvement of UGT in resistance to other classes of insecticides, including pyrethroids, carbamates, and neonicotinoids [34,35]. In Lepidoptera, the role of UGTs has been demonstrated to correlate with detoxification tolerance to insecticides. For instance, chlorantraniliprole significantly induced the expression of UGT2B17 in susceptible P. xylostella. RNA interference with this UGT increased the toxicity of chlorantraniliprole to P. xylostella larvae [36]. The inhibitor of UGTs, 5-nitrouracil, heightened the toxicity of indoxacarb against S. litura. Additionally, the knockdown of UGT33J17 and UGT41D10 reduced the viability of Spli-221 cells and increased the S. litura larval susceptibility to indoxacarb [31]. In Myzus persicae, the overexpression of UGT344P2 significantly enhanced field populations’ resistance to sulfoxaflor [34]. Similarly, the overexpression of UGT genes (UGT386H2, UGT386J2, UGT386N2, and UGT386P1) in N. lugens was associated with resistance to both chlorpyrifos and clothianidin [37].
Many studies have shown that plant secondary metabolites are partially metabolized by UGTs via glycosylation for host adaptation. For example, UGT41B3 and UGT40D1 from H. armigera facilitate the glycosylation of gossypol, primarily resulting in the formation of the diglycosylated gossypol isomer [38]. Additionally, the depletion of four UGTs, namely, UGT330A3, UGT344D5, UGT348A3, and UGT349A3, resulted in a notable increase in the susceptibility of M. persicae to nicotine [39]. Furthermore, the UGT33 and UGT40 families in S. frugiperda, particularly UGT33F28 and UGT40L8, have demonstrated resistance to the benzoxazines of maize, and the homologous gene UGT33F28 exhibits conservative functionality in the closely related species S. littoralis [22].
In our study, we observed similar findings, in which the knockout of SfUGT50A15 elevated the toxicity of chlorantraniliprole and emetamectin benzoate towards S. frugiperda larvae. We speculate that S. frugiperda larvae without the SfUGT50A15 gene are unable to efficiently excrete chlorantraniliprole, emetamectin benzoate, and benzoxazinoids, resulting in the accumulation of exogenous substances in their bodies and enhancing the susceptibility of SfUGT50A15 knockout strains. Hormesis is a toxicological phenomenon whereby exposures to low doses of stress results in biological stimulation [40]. In a bioassay, we observed that under low concentrations of chlorantraniliprole treatment, the mortality rate of the wild-type strains was higher than that of the knockout strains. This may be attributed to the induction of a hormetic dose response in the knockout strain of S. frugiperda by low concentrations of chlorantraniliprole. The specific mechanisms underlying this phenomenon warrant further investigation.
The CRISPR/Cas9 system has been successfully utilized globally across various fields, enabling the manipulation of multiple target genes in diverse non-model species, such as S. frugiperda [41,42]. In this study, the editing frequency of the target site reached 28.2% in the G0 generation. The efficiency of gene editing can be measured by the mutation frequency, but it may be impacted by various factors, including the target gene, the concentration of sgRNA or Cas9, the injection location, and the depth of injection [43,44].
SfUGT50A15 was highly expressed in the larval Malpighian tube, while its ortholog in S. exigua displayed a different tissue-specific expression pattern. The Malpighian tube is the primary organ of excretion in insects. The high expression of SfUGT50A15 in the Malpighian tube may indicate its involvement in the metabolism and detoxification of xenobiotic substances (insecticides) [45]. Furthermore, the SfUGT50A15 gene may also be associated with morphogenetic processes linked to the Malpighian tube, and further investigation into biochemical and physiological changes following knockdown is warranted.
A statistical analysis was conducted on the biological characteristics of homozygous knockout strains of S. frugiperda SfUGT50A15. The results revealed no significant differences between the SfUGT50A15 knockout homozygous strains and the wild-type strain in terms of larval duration, eclosion time, pupal weight, adult lifespan, adult oviposition quantity, and egg hatching rate. These findings suggest that SfUGT50A15 may not be involved in the growth and development of S. frugiperda, or its deletion may have led to the compensatory upregulation of other growth-regulating genes [46,47]. Further research is needed to elucidate the specific regulatory mechanisms.

5. Conclusions

The results of this study offer new functional evidence that SfUGT50A15 can participate in the metabolism and detoxification of exogenous substances like chlorantraniliprole, emamectin benzoate (insecticides), and benzoxazinoids, offering a new molecular target for the greening and control of global pests.

Author Contributions

Conceptualization, Z.S., M.L. and G.W.; methodology, Z.S., M.L., J.Y., B.G. and M.Y.; writing—original draft preparation, Z.S.; writing—review and editing, all authors; funding acquisition, G.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Shenzhen Science and Technology Program (Grant No. KQTD20180411143628272) and special funds for science technology innovation and industrial development of Shenzhen Dapeng New District (Grant No. PT202101-02), the Youth Program of the National Natural Science Foundation of China (award 32202305 to ML) and the China Postdoctoral Science Foundation (award 2022M723451 to ML).

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

We would like to thank Shaoqun Zhou for their editorial assistance and comments on the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gutiérrez-Moreno, R.; Mota-Sanchez, D.; Blanco, C.A.; Whalon, M.E.; Terán-Santofimio, H.; Rodriguez-Maciel, J.C.; DiFonzo, C. Field-Evolved Resistance of the Fall Armyworm (Lepidoptera: Noctuidae) to Synthetic Insecticides in Puerto Rico and Mexico. J. Econ. Entomol. 2019, 112, 792–802. [Google Scholar] [CrossRef] [PubMed]
  2. Westbrook, J.K.; Nagoshi, R.N.; Meagher, R.L.; Fleischer, S.J.; Jairam, S. Modeling seasonal migration of fall armyworm moths. Int. J. Biometeorol. 2016, 60, 255–267. [Google Scholar] [CrossRef] [PubMed]
  3. Goergen, G.; Kumar, P.L.; Sankung, S.B.; Togola, A.; Tamò, M. First Report of Outbreaks of the Fall Armyworm Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a New Alien Invasive Pest in West and Central Africa. PLoS ONE 2016, 11, e0165632. [Google Scholar] [CrossRef] [PubMed]
  4. Day, R.; Abrahams, P.; Bateman, M.; Beale, T.; Clottey, V.; Cock, M.; Colmenarez, Y.; Corniani, N.; Early, R.; Godwin, J.; et al. Fall Armyworm: Impacts and Implications for Africa. Outlooks Pest Manag. 2017, 28, 196–201. [Google Scholar] [CrossRef]
  5. Sun, X.-X.; Hu, C.-X.; Jia, H.-R.; Wu, Q.-L.; Shen, X.-J.; Zhao, S.-Y.; Jiang, Y.-Y.; Wu, K.-M. Case study on the first immigration of fall armyworm, Spodoptera frugiperda invading into China. J. Integr. Agric. 2021, 20, 664–672. [Google Scholar] [CrossRef]
  6. Pitre, H.N. Chemical control of the fall armyworm (Lepidoptera: Noctuidae): An update. Fla. Entomol. 1986, 69, 570–578. [Google Scholar] [CrossRef]
  7. Zhao, J.; Fang, H.; Zhang, D. Expanding application of CRISPR-Cas9 system in microorganisms. Synth. Syst. Biotechnol. 2020, 5, 269–276. [Google Scholar] [CrossRef] [PubMed]
  8. Zhang, D.-D.; Xiao, Y.-T.; Xu, P.-J.; Yang, X.-M.; Wu, Q.-L.; Wu, K.-M. Insecticide resistance monitoring for the invasive populations of fall armyworm, Spodoptera frugiperda in China. J. Integr. Agric. 2021, 20, 783–791. [Google Scholar] [CrossRef]
  9. Burchell, B.; Coughtrie, M.W. UDP-glucuronosyltransferases. Pharmacol. Ther. 1989, 43, 261–289. [Google Scholar] [CrossRef]
  10. Ahn, S.J.; Vogel, H.; Heckel, D.G. Comparative analysis of the UDP-glycosyltransferase multigene family in insects. Insect Biochem. Mol. Biol. 2012, 42, 133–147. [Google Scholar] [CrossRef]
  11. Bozzolan, F.; Siaussat, D.; Maria, A.; Durand, N.; Pottier, M.A.; Chertemps, T.; Maïbèche-Coisne, M. Antennal uridine diphosphate (UDP)-glycosyltransferases in a pest insect: Diversity and putative function in odorant and xenobiotics clearance. Insect Mol. Biol. 2014, 23, 539–549. [Google Scholar] [CrossRef]
  12. Zhang, Y.-N.; Ma, J.-F.; Xu, L.; Dong, Z.-P.; Xu, J.-W.; Li, M.-Y.; Zhu, X.-Y. Identification and expression patterns of UDP-glycosyltransferase (UGT) genes from insect pest Athetis lepigone (Lepidoptera: Noctuidae). J. Asia-Pac. Entomol. 2017, 20, 253–259. [Google Scholar] [CrossRef]
  13. Kennedy, C.J.; Tierney, K.B. Xenobiotic Protection/Resistance Mechanisms in Organisms. In Environmental Toxicology: Selected Entries from the Encyclopedia of Sustainability Science and Technology; Laws, E.A., Ed.; Springer: New York, NY, USA, 2013; pp. 689–721. [Google Scholar]
  14. Li, X.; Shi, H.; Gao, X.; Liang, P. Characterization of UDP-glucuronosyltransferase genes and their possible roles in multi-insecticide resistance in Plutella xylostella (L.). Pest Manag. Sci. 2018, 74, 695–704. [Google Scholar] [CrossRef] [PubMed]
  15. Heidel-Fischer, H.M.; Vogel, H. Molecular mechanisms of insect adaptation to plant secondary compounds. Curr. Opin. Insect Sci. 2015, 8, 8–14. [Google Scholar] [CrossRef]
  16. Su, X.N.; Li, C.Y.; Zhang, Y.P. Chlorpyrifos and chlorfenapyr resistance in Spodoptera frugiperda (Lepidoptera: Noctuidae) relies on UDP-glucuronosyltransferases. J. Econ. Entomol. 2023, 116, 1329–1341. [Google Scholar] [CrossRef]
  17. Wouters, F.C.; Reichelt, M.; Glauser, G.; Bauer, E.; Erb, M.; Gershenzon, J.; Vassão, D.G. Reglucosylation of the benzoxazinoid DIMBOA with inversion of stereochemical configuration is a detoxification strategy in lepidopteran herbivores. Angew. Chem. (Int. Ed. Engl.) 2014, 53, 11320–11324. [Google Scholar] [CrossRef]
  18. Chen, W.; Hasegawa, D.K.; Kaur, N.; Kliot, A.; Pinheiro, P.V.; Luan, J.; Stensmyr, M.C.; Zheng, Y.; Liu, W.; Sun, H.; et al. The draft genome of whitefly Bemisia tabaci MEAM1, a global crop pest, provides novel insights into virus transmission, host adaptation, and insecticide resistance. BMC Biol. 2016, 14, 110. [Google Scholar] [CrossRef]
  19. You, M.; Yue, Z.; He, W.; Yang, X.; Yang, G.; Xie, M.; Zhan, D.; Baxter, S.W.; Vasseur, L.; Gurr, G.M.; et al. A heterozygous moth genome provides insights into herbivory and detoxification. Nat. Genet. 2013, 45, 220–225. [Google Scholar] [CrossRef] [PubMed]
  20. Esen, A. Purification and Partial Characterization of Maize (Zea mays L.) beta-Glucosidase. Plant Physiol. 1992, 98, 174–182. [Google Scholar] [CrossRef]
  21. Oikawa, A.; Ebisui, K.; Sue, M.; Ishihara, A.; Iwamura, H. Purification and Characterization of a β-Glucosidase Specific for 2,4-Dihydroxy-7-methoxy-1,4-benzoxazin-3-one (DIMBOA) Glucoside in Maize. Z. Für Naturforschung C 1999, 54, 181–185. [Google Scholar] [CrossRef]
  22. Israni, B.; Wouters, F.C.; Luck, K.; Seibel, E.; Ahn, S.J.; Paetz, C.; Reinert, M.; Vogel, H.; Erb, M.; Heckel, D.G.; et al. The Fall Armyworm Spodoptera frugiperda Utilizes Specific UDP-Glycosyltransferases to Inactivate Maize Defensive Benzoxazinoids. Front. Physiol. 2020, 11, 604754. [Google Scholar] [CrossRef]
  23. Jin, T.; Lin, Y.Y.; Chi, H.; Xiang, K.P.; Ma, G.C.; Peng, Z.Q.; Yi, K.X. Comparative Performance of the Fall Armyworm (Lepidoptera: Noctuidae) Reared on Various Cereal-Based Artificial Diets. J. Econ. Entomol. 2020, 113, 2986–2996. [Google Scholar] [CrossRef] [PubMed]
  24. Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree: Computing large minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. Evol. 2009, 26, 1641–1650. [Google Scholar] [CrossRef]
  25. Toni, L.S.; Garcia, A.M.; Jeffrey, D.A.; Jiang, X.; Stauffer, B.L.; Miyamoto, S.D.; Sucharov, C.C. Optimization of phenol-chloroform RNA extraction. Methods X 2018, 5, 599–608. [Google Scholar] [CrossRef]
  26. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  27. Idrees, A.; Qadir, Z.A.; Afzal, A.; Ranran, Q.; Li, J. Laboratory efficacy of selected synthetic insecticides against second instar invasive fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae) larvae. PLoS ONE 2022, 17, e0265265. [Google Scholar] [CrossRef] [PubMed]
  28. Payton, M.E.; Greenstone, M.H.; Schenker, N. Overlapping Confidence Intervals or Standard Error Intervals: What Do they Mean in Terms of Statistical Significance. J. Insect Sci. 2003, 3, 34. [Google Scholar] [CrossRef]
  29. Sachdev, B.; Khan, Z.; Zarin, M.; Malhotra, P.; Seth, R.K.; Bhatnagar, R.K. Irradiation influence on the phenoloxidase pathway and an anti-oxidant defense mechanism in Spodoptera litura (Lepidoptera: Noctuidae) and its implication in radio-genetic ‘F1 sterility’ and biorational pest suppression tactics. Bull. Entomol. Res. 2017, 107, 281–293. [Google Scholar] [CrossRef]
  30. Hu, B.; Zhang, S.H.; Ren, M.M.; Tian, X.R.; Wei, Q.; Mburu, D.K.; Su, J.Y. The expression of Spodoptera exigua P450 and UGT genes: Tissue specificity and response to insecticides. Insect Sci. 2019, 26, 199–216. [Google Scholar] [CrossRef] [PubMed]
  31. Yang, X.Y.; Yang, W.; Zhao, H.; Wang, B.J.; Shi, Y.; Wang, M.Y.; Liu, S.Q.; Liao, X.L.; Shi, L. Functional analysis of UDP-glycosyltransferase genes conferring indoxacarb resistance in Spodoptera litura. Pestic. Biochem. Physiol. 2023, 196, 105589. [Google Scholar] [CrossRef]
  32. Gui, F.; Lan, T.; Zhao, Y.; Guo, W.; Dong, Y.; Fang, D.; Liu, H.; Li, H.; Wang, H.; Hao, R.; et al. Genomic and transcriptomic analysis unveils population evolution and development of pesticide resistance in fall armyworm Spodoptera frugiperda. Protein Cell 2022, 13, 513–531. [Google Scholar] [CrossRef] [PubMed]
  33. Lee, S.W.; Ohta, K.; Tashiro, S.; Shono, T. Metabolic resistance mechanisms of the housefly (Musca domestica) resistant to pyraclofos. Pestic. Biochem. Physiol. 2006, 85, 76–83. [Google Scholar] [CrossRef]
  34. Silva, A.X.; Jander, G.; Samaniego, H.; Ramsey, J.S.; Figueroa, C.C. Insecticide resistance mechanisms in the green peach aphid Myzus persicae (Hemiptera: Aphididae) I: A transcriptomic survey. PLoS ONE 2012, 7, e36366. [Google Scholar] [CrossRef] [PubMed]
  35. Yang, N.; Xie, W.; Yang, X.; Wang, S.; Wu, Q.; Li, R.; Pan, H.; Liu, B.; Shi, X.; Fang, Y.; et al. Transcriptomic and proteomic responses of sweetpotato whitefly, Bemisia tabaci, to thiamethoxam. PLoS ONE 2013, 8, e61820. [Google Scholar] [CrossRef] [PubMed]
  36. Li, X.; Zhu, B.; Gao, X.; Liang, P. Over-expression of UDP-glycosyltransferase gene UGT2B17 is involved in chlorantraniliprole resistance in Plutella xylostella (L.). Pest Manag. Sci. 2017, 73, 1402–1409. [Google Scholar] [CrossRef] [PubMed]
  37. Yang, Z.; Xiao, T.; Lu, K. Contribution of UDP-glycosyltransferases to chlorpyrifos resistance in Nilaparvata lugens. Pestic. Biochem. Physiol. 2023, 190, 105321. [Google Scholar] [CrossRef] [PubMed]
  38. Krempl, C.; Sporer, T.; Reichelt, M.; Ahn, S.J.; Heidel-Fischer, H.; Vogel, H.; Heckel, D.G.; Joußen, N. Potential detoxification of gossypol by UDP-glycosyltransferases in the two Heliothine moth species Helicoverpa armigera and Heliothis virescens. Insect Biochem. Mol. Biol. 2016, 71, 49–57. [Google Scholar] [CrossRef]
  39. Pan, Y.; Xu, P.; Zeng, X.; Liu, X.; Shang, Q. Characterization of UDP-Glucuronosyltransferases and the Potential Contribution to Nicotine Tolerance in Myzus persicae. Int. J. Mol. Sci. 2019, 20, 3637. [Google Scholar] [CrossRef] [PubMed]
  40. Agathokleous, E. The hormetic response of heart rate of fish embryos to contaminants—Implications for research and policy. Sci. Total Environ. 2022, 815, 152911. [Google Scholar] [CrossRef]
  41. Wu, K.; Shirk, P.D.; Taylor, C.E.; Furlong, R.B.; Shirk, B.D.; Pinheiro, D.H.; Siegfried, B.D. CRISPR/Cas9 mediated knockout of the abdominal-A homeotic gene in fall armyworm moth (Spodoptera frugiperda). PLoS ONE 2018, 13, e0208647. [Google Scholar] [CrossRef]
  42. Huang, Y.; Chen, Y.; Zeng, B.; Wang, Y.; James, A.A.; Gurr, G.M.; Yang, G.; Lin, X.; Huang, Y.; You, M. CRISPR/Cas9 mediated knockout of the abdominal-A homeotic gene in the global pest, diamondback moth (Plutella xylostella). Insect Biochem. Mol. Biol. 2016, 75, 98–106. [Google Scholar] [CrossRef] [PubMed]
  43. Zhu, G.H.; Xu, J.; Cui, Z.; Dong, X.T.; Ye, Z.F.; Niu, D.J.; Huang, Y.P.; Dong, S.L. Functional characterization of SlitPBP3 in Spodoptera litura by CRISPR/Cas9 mediated genome editing. Insect Biochem. Mol. Biol. 2016, 75, 1–9. [Google Scholar] [CrossRef]
  44. Wei, W.; Xin, H.; Roy, B.; Dai, J.; Miao, Y.; Gao, G. Heritable genome editing with CRISPR/Cas9 in the silkworm, Bombyx mori. PLoS ONE 2014, 9, e101210. [Google Scholar] [CrossRef] [PubMed]
  45. Dow, J.A.; Davies, S.A. The Malpighian tubule: Rapid insights from post-genomic biology. J. Insect Physiol. 2006, 52, 365–378. [Google Scholar] [CrossRef] [PubMed]
  46. Sun, D.; Zhu, L.; Guo, L.; Wang, S.; Wu, Q.; Crickmore, N.; Zhou, X.; Bravo, A.; Soberón, M.; Guo, Z.; et al. A versatile contribution of both aminopeptidases N and ABC transporters to Bt Cry1Ac toxicity in the diamondback moth. BMC Biol. 2022, 20, 33. [Google Scholar] [CrossRef]
  47. Guo, L.; Cheng, Z.; Qin, J.; Sun, D.; Wang, S.; Wu, Q.; Crickmore, N.; Zhou, X.; Bravo, A.; Soberón, M.; et al. MAPK-mediated transcription factor GATAd contributes to Cry1Ac resistance in diamondback moth by reducing PxmALP expression. PLoS Genet. 2022, 18, e1010037. [Google Scholar] [CrossRef]
Insects 15 00314 g001
Figure 1. Bioinformatics analysis of SfUGT50A15. (a) Phylogenetic analysis of SfUGT50A15 protein and its homologs. Bmor-Bombyx mori, Csup-Chilo suppressalis, Harm-Helicoverpa armigera, Sfru-S. frugiperda, Sexi-Spodoptera exigua, Pxyl-Plutella xylostella, Tabs-Tuta absoluta, Zfil-Zygaena filipendulae. (b) SfUGT50A15 secondary structure prediction peaks. Blue: alpha helix, green: beta turn, yellow: random coil, red: extended strand. (c) Predicted transmembrane domains of SfUGT50A15 protein.
Figure 1. Bioinformatics analysis of SfUGT50A15. (a) Phylogenetic analysis of SfUGT50A15 protein and its homologs. Bmor-Bombyx mori, Csup-Chilo suppressalis, Harm-Helicoverpa armigera, Sfru-S. frugiperda, Sexi-Spodoptera exigua, Pxyl-Plutella xylostella, Tabs-Tuta absoluta, Zfil-Zygaena filipendulae. (b) SfUGT50A15 secondary structure prediction peaks. Blue: alpha helix, green: beta turn, yellow: random coil, red: extended strand. (c) Predicted transmembrane domains of SfUGT50A15 protein.
Insects 15 00314 g001
Insects 15 00314 g002
Figure 2. Relative expression levels of the SfUGT50A15 gene in S. frugiperda. (a) Different developmental stages. L1-L6, 1st-6th-instar larvae. (b) Different tissues; Mean ± SE from three replicates is shown. Different letters above bars indicate significant differences (p < 0.05) according to the Student’s t-test.
Figure 2. Relative expression levels of the SfUGT50A15 gene in S. frugiperda. (a) Different developmental stages. L1-L6, 1st-6th-instar larvae. (b) Different tissues; Mean ± SE from three replicates is shown. Different letters above bars indicate significant differences (p < 0.05) according to the Student’s t-test.
Insects 15 00314 g002
Insects 15 00314 g003
Figure 3. Schematic representation of the SfUGT50A15 knockout. (a) Target location of sgRNA. The SfUGT50A15 gene has seven exons and the sgRNA was designed to be in exon 5; the target sequence is shown below the fold. (b) Representative sequencing chromatograms of PCR products from wild-type (WT) and G0 injected eggs. Sequences determined by TA clone sequencing are shown at the top of the image. In the mutant sequence SfUGT50A15-KO, the deletion is shown as a dash, the insertion as a blue lowercase letter, and the yellow shading as the mutated region, totaling 2 bp for the deletion and 3 bp for the insertion.
Figure 3. Schematic representation of the SfUGT50A15 knockout. (a) Target location of sgRNA. The SfUGT50A15 gene has seven exons and the sgRNA was designed to be in exon 5; the target sequence is shown below the fold. (b) Representative sequencing chromatograms of PCR products from wild-type (WT) and G0 injected eggs. Sequences determined by TA clone sequencing are shown at the top of the image. In the mutant sequence SfUGT50A15-KO, the deletion is shown as a dash, the insertion as a blue lowercase letter, and the yellow shading as the mutated region, totaling 2 bp for the deletion and 3 bp for the insertion.
Insects 15 00314 g003
Insects 15 00314 g004aInsects 15 00314 g004b
Figure 4. Statistics on biological characteristics of S. frugiperda one generation after SfUGT50A15 gene knockout. (a) Larval period. (b) Eclosion time. (c) Pupal weight. (d) Lifespan of adult. (e) Total egg production. (f) Hatching rate. ns, not significant.
Figure 4. Statistics on biological characteristics of S. frugiperda one generation after SfUGT50A15 gene knockout. (a) Larval period. (b) Eclosion time. (c) Pupal weight. (d) Lifespan of adult. (e) Total egg production. (f) Hatching rate. ns, not significant.
Insects 15 00314 g004aInsects 15 00314 g004b
Insects 15 00314 g005
Figure 5. Mortality of wild-type S. frugiperda and SfUGT50A15 knockout strain at different concentrations of (a) chlorantraniliprole and (b) emamectin benzoate. ***, p < 0.001.
Figure 5. Mortality of wild-type S. frugiperda and SfUGT50A15 knockout strain at different concentrations of (a) chlorantraniliprole and (b) emamectin benzoate. ***, p < 0.001.
Insects 15 00314 g005
Insects 15 00314 g006
Figure 6. Body weight of S. frugiperda larvae after feeding for 7 days on W22 and BX2 strains of maize. **, p < 0.01. ns, not significant.
Figure 6. Body weight of S. frugiperda larvae after feeding for 7 days on W22 and BX2 strains of maize. **, p < 0.01. ns, not significant.
Insects 15 00314 g006
Table 1. Primer used in this study.
Table 1. Primer used in this study.
Primer NamePrimer Sequence (5′-3′)Primer Purpose
SfUGT50A15.qFACAGAGCCCTGAATGCCATCRT-qPCR
SfUGT50A15.qRTGAAGCTCACATTCTTCGCC
SfruActinFTACTCCTAAGCCTGTTGATGRT-qPCR
SfruActinRTTATGTCATGGTGCCGAAT
SfUGT50A15.F1ACGTAGTAGGGGCAGCCCCloning the SfUGT50A15 gene
SfUGT50A15.R1TATGTACATTACATTTTATAAACTGAACATCGATC
SfUGT50A15.sgFGAAATTAATACGACTCACTATAGGACTCCGTCACCCCATTCTTPreparation of sgRNA templates
SfUGT50A15.sgRTTCTAGCTCTAAAACAAGAATGGGGTGACGGAGT
SfUGT50A15.F2TCAGGAAGGACTTTTGATCTCGIdentification of somatic mutations
SfUGT50A15.R2CATTCTGGAGTATGAAGCTCACAT
Table 2. Sensitivity of 3rd-instar larvae of SfUGT50A15 knockout strain of S. frugiperda and wild-type strain to five pesticides.
Table 2. Sensitivity of 3rd-instar larvae of SfUGT50A15 knockout strain of S. frugiperda and wild-type strain to five pesticides.
InsecticideStrainLC50 (µg/g) a95% FL bN cToxicity Ratio d
ChlorantraniliproleWT19.30511.08–33.6361925.67 e
SfUGT50A15-KO3.4021.919–6.032192
Emamectin benzoateWT15.9887.803–32.7571925.00 e
SfUGT50A15-KO3.1961.046–6.228192
SpinetoramWT0.2440.244–8.8151923.87
SfUGT50A15-KO0.0630.063–8.601192
LufenuronWT0.1370.137–5.0971921.28
SfUGT50A15-KO0.1070.107–3.737192
ChlorfenapyrWT4.0814.081–31.1461921.12
SfUGT50A15-KO3.6423.642–27.171192
a Lethal concentration that kills 50% of S. frugiperda. b The 95% fiducial limits of LC50. c Number of larvae used in the bioassay. d Toxicity Ratio = LC50 value for wild-type strain (WT) divided by LC50 value for knockout strain (SfUGT50A15-KO). e The LC50 of the wild-type strain of the same pesticide was significantly higher than that of SfUGT50A15-KO.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shi, Z.; Luo, M.; Yuan, J.; Gao, B.; Yang, M.; Wang, G. CRISPR/Cas9-Based Functional Characterization of SfUGT50A15 Reveals Its Roles in the Resistance of Spodoptera frugiperda to Chlorantraniliprole, Emamectin Benzoate, and Benzoxazinoids. Insects 2024, 15, 314. https://doi.org/10.3390/insects15050314

AMA Style

Shi Z, Luo M, Yuan J, Gao B, Yang M, Wang G. CRISPR/Cas9-Based Functional Characterization of SfUGT50A15 Reveals Its Roles in the Resistance of Spodoptera frugiperda to Chlorantraniliprole, Emamectin Benzoate, and Benzoxazinoids. Insects. 2024; 15(5):314. https://doi.org/10.3390/insects15050314

Chicago/Turabian Style

Shi, Zhan, Mei Luo, Jinxi Yuan, Bin Gao, Minghuan Yang, and Guirong Wang. 2024. "CRISPR/Cas9-Based Functional Characterization of SfUGT50A15 Reveals Its Roles in the Resistance of Spodoptera frugiperda to Chlorantraniliprole, Emamectin Benzoate, and Benzoxazinoids" Insects 15, no. 5: 314. https://doi.org/10.3390/insects15050314

APA Style

Shi, Z., Luo, M., Yuan, J., Gao, B., Yang, M., & Wang, G. (2024). CRISPR/Cas9-Based Functional Characterization of SfUGT50A15 Reveals Its Roles in the Resistance of Spodoptera frugiperda to Chlorantraniliprole, Emamectin Benzoate, and Benzoxazinoids. Insects, 15(5), 314. https://doi.org/10.3390/insects15050314

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop