Next Article in Journal
Mitogenomics Provide New Phylogenetic Insights of the Family Apataniidae (Trichoptera: Integripalpia)
Previous Article in Journal
Habitat Suitability of Danaus genutia Based on the Optimized MaxEnt Model
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota †

1
Tropical Research and Education Center, Department of Entomology and Nematology, University of Florida, Homestead, FL 33031, USA
2
Department of Soil, Plant and Food Sciences (Di.S.S.P.A.), University of Bari Aldo Moro, 70121 Bari, Italy
3
Departamento de Fitossanidade, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista (FCAV/Unesp), Jaboticabal 14884-900, São Paulo, Brazil
4
Systematic Entomology Laboratory, United States Department of Agriculture, Agricultural Research Service, Beltsville, MD 20705, USA
5
Subtropical Horticulture Research Station, United States Department of Agriculture, Agricultural Research Service, Miami, FL 33158, USA
*
Author to whom correspondence should be addressed.
urn:lsid:zoobank.org:pub:9E32CFB2-5520-4F58-9F19-BECC1FB316F2.
Insects 2024, 15(12), 972; https://doi.org/10.3390/insects15120972
Submission received: 10 November 2024 / Revised: 1 December 2024 / Accepted: 3 December 2024 / Published: 6 December 2024
(This article belongs to the Section Other Arthropods and General Topics)

Simple Summary

Abnormal leaf growth, including stunted leaves, outward curling, leaf yellowing, and diminishing overall tree vigor of Pouteria sapota [(Jacq.) H.E. Moore et Stearn] (Sapotaceae) was observed in multiple locations in Southern Florida and one location in Brazil. In search for possible causal agents of these damages, a new mite species of the family Eriophyidae was found persistently infesting closed leaf buds of P. sapota. It was morphologically described and named Eriophyes pouteriae sp. nov.; DNA sequences of usual regions were also obtained. This is the first eriophyoid mite associated with P. sapota.

Abstract

Pouteria sapota, or “mamey sapote”, is a tropical fruit tree native to Central America and Southern Mexico, producing sweet, nutrient and vitamin-rich fruit. Several insect pests are known to infest P. sapota, but none have been associated with plant growth alterations. Eriophyoid mites are well known to cause plant malformations, but mites that cause this type of damage to mamey sapote have not been reported. Trees with abnormal leaf growth, including stunted leaves, outward curling, leaf yellowing, and diminishing overall tree vigor, were found in multiple locations in Southern Florida and one location in Brazil. Numerous plant samples were examined for the presence of minute eriophyoid-like mites, and a new species was found. It was morphologically described, and DNA fragments of the mitochondrial gene cytochrome c oxidase subunit I (COI), the nuclear subunit D2 region in 28S rDNA, and the ITS nuclear regions were PCR-amplified and sequenced. Morphological and molecular descriptions of the new species, named E. pouteriae sp. nov., are provided to aid the identification and future detection of this mite. Even though several species within the genus Eriophyes have been reported on other Sapotaceae species, this is the first eriophyoid mite known to be associated with mamey sapote.

1. Introduction

Pouteria sapota [(Jacq.) H.E. Moore et Stearn] also known as “mamey sapote” or “mamey Colorado” is a tropical fruit tree belonging to the Sapotaceae family, putatively native to the lowlands of Central America and Southern Mexico [1]. It is an important fruit crop with commercial plantings in Miami-Dade, Florida (US), Mexico, Dominican Republic, Puerto Rico, and Cuba. Recently, small plantings have been established in other countries (e.g., Australia, Brazil, China, Israel, Philippines, Spain, Venezuela, and Vietnam). Cultivation is restricted to tropical and subtropical areas, as the plant is not tolerant to freezing temperatures. Pouteria sapota is appreciated and has long been cultivated as a dooryard tree throughout the tropical and subtropical Americas for producing a large and sweet, nutrient and vitamin-rich fruit [2], which was commonly named “chachaas” or “chachalhaas” by the Mayans and “tzapotl” by the Aztecs [3]. The entire mamey plant holds economic significance in various industries; its wood is used in furniture production, its leaves and stems provide chemical compounds for pharmacological and phytosanitary applications, its seeds are used in cosmetics, and its fruit pulp, both fresh and processed, serves as a food source [4,5,6]. Recently, the potential use of treated peel as a catalyst in the production of biodiesel has also been demonstrated, evaluated, and proposed [7].
Several insect pests are known to infest P. sapota, including the sapote fruit fly, Anastrepha serpentina (Wiedmann) (Diptera: Tephritidae), the Cuban may beetle, Phyllophaga bruneri Chapin (Coleoptera: Scarabeideae), and the sugarcane rootstalk borer Diaprepes abbreviatus L. (Coleoptera: Curculionidae), as well as several thrips species and scale insects [8]. Minor reports are communicated about spider mites (the Texas citrus mite Eutetranychus banksi (McGregor) and the two-spotted spider mite Tetranychus urticae Koch affecting this plant by leaf chlorosis [9,10], but no other mite taxa have been associated with P. sapota.
Abnormal leaf growth observed in commercial P. sapota plantings in Florida and Brazil was not associated with any macroscopically apparent agent, suggesting that very small mites could be involved. Eriophyoid mites are commonly overlooked because they are tiny and usually hide in different plant structures [11]. They frequently infest buds and young leaves, inducing plant malformations [12,13]. Their detection requires careful examination of samples, especially when present at low population density or inside architecturally intricate plant organs. Moreover, timely and reliable identification of Eriophyoid mites requires the application of specific protocols [14]. No eriophyoids are known from P. sapota, even though seven species of the genus Eriophyes have been associated with other species within the family Sapotaceae (Amrine & de Lillo, personal communication from unpublished databases). These include E. emphlopei Meyer (Smith) et Ueckermann and E. nermae Meyer (Smith) et Ueckermann, both found on Sideroxylon inerme L., E. gallitor Flechtmann et Etienne on Sideroxylon obovatum Lam., E. hexandrae Umapathy et Mohanasundaram and E. manilkarae (Keifer) on Manilkara hexandra Dubard, E. mimusi Meyer (Smith) et Ueckermann on Mimusops zeyheri Sond., and E. planchonellus Manson on Pleioluma novocaledonica (Dubard) Swenson et Munzinger. All these Eriophyes species induce the formation of closed and open galls, except for E. planchonellus, which causes distortions in flower buds [15,16,17,18,19].
This research aimed to discover and identify eriophyoid mites associated with P. sapota malformations and characterize them from a morphological and molecular point of view to facilitate future bio-ecological studies for their management.

2. Materials and Methods

2.1. Collection of Samples

Samples of P. sapota were collected during May–July, 2023, from 5 commercial orchards (ten samples per orchard) distributed throughout the Redland agricultural area in Homestead, FL, USA (Figure 1). Additional samples were obtained from P. sapota trees part of the germplasm bank of the São Paulo State University—Unesp, Campus of Jaboticabal, São Paulo State, Brazil, in September 2023. Similar samples from other plants in the family Sapotaceae, including Chrysophyllum cainito L. (caimito or star apple), and Manilkara zapota (L.)—P. Royen (sapodilla), were collected when available in the proximity of P. sapota trees.

2.2. Morphological Characterization by Light Microscopy

Samples composed of P. sapota leaves, stems, buds, and fruit were examined under a dissecting stereomicroscope (Nikon SMZ 1270, 400X, Nikon Instruments Inc., Melville, NY, USA) to determine the presence of mites, which were collected using a pin (Blick master synthetic round 3.0) and transferred to Eppendorf tubes containing Oudemans’ fluid [20]. Eriophyoid mites were cleared in Keifer’s booster and mounted in Keifer’s medium II [21]. The genus was determined using the generic key provided by Amrine et al. [22] and through comparisons with new genera described after that publication. The morphological terminology and setal notations followed Lindquist et al. [23]. The damage description followed that proposed by Keifer [24]. A phase contrast microscope (Olympus BX50, Tokyo, Japan) was used for taking line drawings and morphological measurements according to Amrine and Manson [25], as modified by de Lillo et al. [14]. Drawings and microphotographs were optimized using Adobe Photoshop© 10 version 21.0.3. Line drawings were made using a drawing tube as described in de Lillo et al. [14]. All measurements are given in micrometers (μm). For the adult female description, the holotype’s measurements are followed by the range values of the paratypes, which are reported in parentheses. Measurements are rounded off to the nearest integer and regard the length of the morphological traits unless otherwise specified. Abbreviations labeling line drawings follow Amrine et al. [22]. The host plant was identified by the Florida Department of Agriculture and Consumer Services Division of Plant Industry (FDACS-DPI), USA. The host plant name is in accordance with “The World Flora Online” [26].
Type materials are deposited at Acari reference collections of the Tropical Fruit Entomology laboratory (Tropical Research and Education Center, University of Florida), USA, FDACS-DPI, USA, the Smithsonian Natural Museum of Natural History, USA, and at the Department of Soil, Plant and Food Sciences (DiSSPA), University of Bari Aldo Moro, Italy (UNIBA). The holotype is deposited at UNIBA.

2.3. Morphological Characterization by Scanning Electron Microscopy

Leaves, stems, and buds of P. sapota were collected in October 2023 from a commercial orchard in Homestead, Florida, USA (25°30′33.8976″ N, −80°30′25.2648″ W). Mites were prepared and imaged with a TM 3030 Plus Tabletop Scanning Electron Microscope (Hitachi High Technologies America, Pleasanton, CA, USA) equipped with a Deben cooler system (Angstrom Scientific Inc., Ramsey, NJ, USA) following the methods of Otero-Colina [27]. Eriophyid specimens in situ on plant material were attached to 32 mm aluminum specimen holders with carbon sticky pads. Individual mites were removed from the plant material and mounted ventrally. The samples were cooled to −25 °C. An accelerating voltage of 5 KV was used to view the specimens. Micrographs were optimized using Adobe Photoshop© version 21.0.3.

2.4. Molecular Characterization—DNA Extraction, Amplification, and Sequencing

Genomic DNA was isolated individually from fifteen specimens collected from P. sapota using the DNeasy Blood Tissue Kit (Qiagen, Hilden, Germany). Live mites were dipped directly in 90 μL of ATL buffer (Qiagen); 10 μL of Proteinase K (Qiagen) was added to each sample and incubated at 56 °C and shaken in a thermomixer for 16 h. All other steps of the standard Qiagen DNA extraction protocol ‘Purification of Total DNA from Animal Tissues’ were modified according to [28]. Three target DNA fragments were PCR-amplified and sequenced per single mite: one mitochondrial gene, the cytochrome c oxidase subunit I (COI) [29], and two nuclear DNA fragments, the subunit D2 region in 28S rDNA [30,31] and the ITS nuclear region including IT1 and ITS2 (Table 1) [32,33].
PCR was conducted with 25 μL reaction volumes using a DreamTaq™ Hot Start polymerase system (DreamTaq™, Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. All PCR products were visualized on a 1.0% agarose gel stained with SYBR™ Safe DNA gel stain (Invitrogen, Waltham, MA, USA); in case of successful amplification, the remaining PCR products were run in a 1.5% low melting agarose gel stained with SYBR™ Safe DNA gel stain. DNA bands were excised with an x-trata™ gel extraction tool (Promega, Madison, WI, USA) and then purified using the Wizard® SV Gel and PCR Clean-up System (Promega), according to manufacturer’s protocol. Both strand directions of the successfully amplified fragments (COI, partial 18S and 28S rRNA, and ITS) were Sanger sequenced (Eurofins Genomics, Louisville, KY, USA).
Staden Package v.1.6.0 [34] software was used to check the quality, and to edit and assemble the raw data into sequence contigs. Each marker’s nucleotide sequences were compared to those with the sequences of other Eriophyes available in the GenBank database using different blast algorithms (http://blast.ncbi.nlm.nih.gov/Blast.cgi accessed on 10 October 2024).

3. Results

3.1. Morphological Characterization

Eriophyes pouteriae sp. nov. (Figure 2) De Giosa, Tassi et de Lillo

Description
FEMALE: (n = 11) Body vermiform (Figure 3a), 130 (122–164, from frontal lobe to anal lobes), 31 (28–44) wide, 40 (29–43) thick. Gnathosoma: palps 17 (17–20), palp coxal setae ep 1 (no range), dorsal palp genual setae d 4 (3–4), unbranched, palp tarsus setae v 1 (no range), cheliceral stylets 15 (14–16).
Prodorsal shield 24 (22–25, including frontal lobe), 22 (19–25) wide; with small rounded frontal lobe 1 (no range) over gnathosomal base. Prodorsal shield design with lines: interrupted median line on the anterior half and posterior quarter of the prodorsal shield; admedian lines complete; an inner pair of submedian lines complete and posteriorly ending with a loop, 3 shorter pairs of outer submedian lines; granules on the lateral sides (Figure 3b). Tubercles of scapular setae sc on the rear shield margin directed ahead, 10 (9–12) apart, scapular setae sc 22 (19–25) (Figure 3c). Leg I 22 (21–24, from base of trochanter), femur 9 (8–9), genu 4 (no range), tibia 5 (4–5), tarsus 5 (4–5), solenidion ω 6 (5–6, tapering), empodium 4 (no range), simple, 6-rayed; femoral setae 6 (6–7), genual setae l″ 14 (13–16) and stiff, tibial setae l′ 6 (4–6), tarsal setae ft′ 12 (11–13), setae ft″ 14 (13–16). Leg II 19 (17–21), femur 8 (7–8), genu 3 (3–4), tibia 3 (no range), tarsus 4 (4–5), solenidion ω 7 (6–7, tapering), empodium 4 (no range), simple, 6-rayed, femoral setae bv 6 (5–7), genual setae l″ 8 (6–8), tarsal setae ft′ 4 (3–4), setae ft″ 17 (13–17). Coxae ornamented with several fine granules; setae 1b 7 (6–9), tubercles 1b 4 (3–5) apart, setae 1a 15 (12–18), tubercles 1a 5 (4–5) apart, setae 2a 30 (25–32), tubercles 2a 14 (12–15) apart. Prosternal apodeme 7 (6–7). Opisthosoma with 58 (53–62) dorsal semiannuli and 62 (58–65) ventral semiannuli; 6 (5–7) semiannuli with fine microtubercles between coxae and genital coverflap. Setae c2 12 (11–16), on ventral semiannulus 8 (7–8); setae d 26 (19–29), on ventral semiannulus 21 (21–24); setae e 22 (18–27), on ventral semiannulus 13 (11–55); setae f 13 (11–15), on ventral semiannulus 58 (55–64), 4 (no range) annuli after setae f. Setae h2 39 (36–45), setae h1 2 (1–2). Genital coverflap 9 (8–10), 17 (15–19) wide, coverflap with 15 (14–16) longitudinal striae, setae 3a 7 (6–9), 11 (10–12) apart (Figure 3d,e). Internal genitalia: spermatheca quite elliptical, oriented postero-laterad; spermathecal tubes short as long as the spermathecal length; transverse genital apodeme trapezoidal and distally folded.
MALE (n = 1). Body vermiform, 102, 26 wide, 36 thick. Gnathosoma: palps 18, chelicerae 14. Prodorsal shield 20, including frontal lobe, 18 wide, frontal lobe 1. Shield pattern similar to that of female. Tubercles of scapular setae sc on the rear shield margin directed ahead, 8 apart, scapular setae sc 17. Leg I 20, femur 8, genu 3, tibia 5, tarsus 5, solenidion ω 6, tapering, empodium 4, simple, 6-rayed; femoral setae bv 5, genual setae l″ 7, tibial setae l′ 3, tarsal setae ft′, setae ft″ 14. Leg II 19 (from base of trochanter), femur 8, genu 3, tibia 3, tarsus 4, femoral setae bv 3, genual setae l″ 5, tarsal setae ft′ 3, setae ft″ 12, solenidion ω 7, tapering, empodium 4, simple, 6-rayed. Coxae similar to those of female; setae 1b 5, tubercles 1b 4 apart, setae 1a 9, tubercles 1a 4 apart, setae 2a 17, tubercles 2a 11 apart. Prosternal apodeme 7. Opisthosoma with 54 dorsal semiannuli; 63 ventral semiannuli; 5 semiannuli between coxae and genital region. Setae c2 9 on ventral semiannulus 8, setae d 19 on ventral semiannulus 18; setae e 13 on ventral semiannulus 31; setae f 31 on ventral semiannulus 9, 4 annuli after setae f. Setae h2 32; setae h1 2; setae 3a 7, 8 apart.
Type host plant—Pouteria sapota (Jacq.) H.E. Moore et Stearn (Sapotaceae), mammey zapote.
Relation to the host plant—Eriophyes pouteriae sp. nov. was found inhabiting closed leaf buds, living between the vegetative apical buds (Figure 3f) in all P. sapota samples collected from different locations in Florida and Brazil. Infestations resulted in stunted leaves, leaves curling outward (clawing), and leaf yellowing (Figure 4a). Heavy infestations involve mite presence and damage to all new leaves on the entire tree and diminished tree vigor (Figure 4c). No mites were found on stems or fruit of P. sapota nor in any plant structure of other cultivated Sapotaceae, including C. caimito and M. zapota.
Type locality—Homestead, Florida, USA, 25°30′33.8976″ S, −80°30′25.2648″ W; 21 July 2023, coll. Carrillo Daniel and De Giosa Marcello.
Type material—Holotype: female on a microscope slide mounting a single specimen (indicated by an arrow on slide MS2306); paratypes: 25 females, 4 males, and 2 nymphs on 12 slides (slide codes from MS2301 to MS2312).
Further materials—Further specimens collected on the same location of the types are preserved in Oudemans’ fluid [19].
Etymology—The specific epithet, pouteriae, is based on the host plant species in the genitive case.
Remarks—Slide mounted specimens collected in Brazil are morphologically consistent with those described in Florida.

3.2. Molecular Characterization

Ten extractions yielded sequences of high quality for all three marker genes (COI DNA barcoding, ITS, and 18S and 28S rRNA partial sequence) of E. pouteriae sp. nov. Each sequence pair was found to be identical within their respective markers. Blastx search for COI sequences accs. numbers PQ167827, PQ182573-5 against Eriophyoidea GenBank returned as the best hit the sequence KY418168.1 (Aceria sp., 79.6% identity, 99% coverage); when sorted by identity, the best return hit was AKP20840.1 (Eriophyes padi (Nalepa), 83.15% identity, 87% coverage; host Prunus padus L. from Poland). For the marker ITS (PQ428922 PQ428924 and PQ428925), the best hit was OR139566.1 (Aceria sp., 96.92% identity, 19% coverage; host Tamarix usneoides E. Mey. ex Bunge from South Africa); and for the fragment including the partial sequence of 18S and 28S rRNA (accs. number PQ433866), the best hit was MK440017.1 (Aceria lespedezae Kuang, 89.63% identity, 78% coverage).

4. Discussion and Conclusions

Eriophyes pouteriae sp. nov. is the first eriophyid species associated with P. sapota. Seventeen Eriophyoid species have been described on plant species of the Sapotaceae family, including seven Eriophyes spp., and none of them have been reported in the Nearctic geographical area (Amrine & de Lillo, personal communication from unpublished databases). Eriophyes pouteriae sp. nov. is not morphologically similar to any of them. The closest species is E. planchonellus Mason, from which it differs in (1) the prodorsal shield size (as wide as long in E. pouteriae sp. nov. and one and a half times wider than long in E. planchonellus); (2) the prodorsal design (E. pouteriae sp. nov. has an incomplete median line and an inner submedian line posteriorly ending with a loop, whereas E. planchonellus is provided with a complete median line and an inner simple submedian line); (3) the coal ornamentation (sparse granules in E. pouteriae sp. nov. and very few dashes on the coxae II of E. planchonellus); (4) the number of semiannuli between the coxae and the external female genitalia (five–seven in E. pouteriae sp. nov. and four in E. planchonellus); and (5) the length of the opisthosoma setae (c2: 10–15; d: 19–29; e: 18–27; f: 12–15 in E. pouteriae sp. nov. and c2: 17–22; d: 30–37; e: 2–4; f: 15–19 in E. planchonellus).
Eriophyes pouteriae sp. nov. has a widespread distribution in Florida and is present in Brazil, suggesting that is probably present in other tropical and subtropical areas where P. sapota is cultivated, including its native range in Central America and Mexico. The finding of this mite inhabiting closed leaf buds of P. sapota and its absence on phylogenetically related plant species in the same area suggest that E. pouteriae sp. nov. specializes in feeding upon this plant. This high degree of specialization with a dominant monophagy is common in eriophyoid species [35]. However, additional sampling and host choice tests are required to fully understand the feeding habits, host range, and possible symbiotic associations of E. pouteriae sp. nov. The observed damage and abnormal leaf growth suggest that infestations by E. pouteriae sp. nov. can reduce the photosynthetic capacity of P. sapota. This is the only described species, along with E. planchonellus, that does not induce gall formation (galls), unlike the other Eriophyes species reported on Sapotaceae [24].
Public nucleotide sequences databases possess limited deposit data on Eriophyes species, including COI data of seven species, not necessarily linked to vouchers. Regarding ITS sequence only, no information is available, and for the 18S and 28S rRNA sequence fragments, just three representatives of the genus possess deposited nucleotide sequences. Blasting the obtained COI marker sequences against Eriophyes from GenBank showed the following information: for KT070227.1 E. padi (87% coverage and 80.72% identity), for MZ482942.1 E. armandis Xue et Hong (96% coverage and 76.82% identity), for MW691980.1 E. calycobius (Nalepa) (95% coverage and 74.92% identity), for E. tiliae (Pagenstecher) (85% coverage and 67.20% identity), for KU315235.1 E. lissonotus (Nalepa) (87% coverage and 72.58% identity), for EU254715.1 E. pyri (Pagenstecher) (69% coverage and 74% identity), and ON586803.1 E. sorbi (Canestrini) (84% coverage and 75.66% identity). Regarding the rRNA sequences, three species are available: for ON555745.1 E. tiliae (75% coverage and 90.86% identity), for MZ279784.1 E. hoheriae Lamb (69% coverage and 88.92% identity), and for ON555746.1 E. sorbi (71% coverage and 89.64% identity). Given the limited number of sequences deposited in GenBank for this genus within the Eriophyidae family, using BLAST tools for species identification and conducting phylogenetic studies are not feasible. Therefore, it is crucial to generate more data for further analysis. The information gathered on E. pouteriae sp. nov. in this study will contribute to enhancing the dataset for this genus, facilitating future research efforts.
Furthermore, adverse effects of E. pouteriae sp. nov. infestations on fruit production and yield have not been observed but warrant further investigation. In addition, sustainable management options should be explored to mitigate the damage caused by this mite.

Author Contributions

Conceptualization, M.D.G., A.D.T. and D.C.; methodology, M.D.G., A.D.T., D.J.d.A., R.O., D.C. and E.d.L.; investigation, M.D.G., A.D.T., A.M.R., D.J.d.A., D.C. and E.d.L.; resources, D.C., A.M.R., R.O., D.J.d.A. and E.d.L.; writing—original draft preparation, M.D.G., A.D.T., D.C. and E.d.L.; writing—review and editing, M.D.G., A.D.T., E.d.L., A.M.R., D.J.d.A., X.Y. and D.C.; supervision, D.C. and A.M.R.; project administration, D.C., A.M.R. and X.Y.; funding acquisition, D.C., A.M.R. and X.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by USDA ARS-UF Non-Assistance Cooperative Agreement No.58-6038-3-002 to Daniel Carrillo and Alexandra M. Revynthi.

Data Availability Statement

The raw data concerning the mite description will be made available by the authors on request.

Acknowledgments

We thank Max Gosselin, Claudiane M. Rocha, and Jonathan Crane for their assistance in the mite field collections, and Andrew Ulsamer for his assistance with the SEM imagery. The mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the USDA; USDA is an equal opportunity provider and employer.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Campbell, R.J.; Zill, G.; Mahdeem, H. New mamey sapote cultivars from tropical America. Proc. Interamer. Soc. Trop. Horticul. 1997, 41, 219–222. [Google Scholar]
  2. Alia-Tejacal, I.; Villanueva-Arce, R.; Pelayo-Zaldívar, C.; Colinas-León, M.T.; López-Martínez, V.; Bautista-Baños, S. Postharvest physiology and technology of sapote mamey fruit (Pouteria sapota (Jacq.) HE Moore & Stearn). Postharv. Biol. Technol. 2007, 45, 285–297. [Google Scholar] [CrossRef]
  3. Morton, J. Sapote. In Fruits of Warm Climates; Morton, J.F., Ed.; Creative Resources Systems: Miami, FL, USA, 1987; pp. 398–402. [Google Scholar]
  4. Torres-Rodríguez, A.; Salinas-Moreno, Y.; Valle-Guadarrama, S.; Alia-Tejacol, I. Soluble phenols and antioxidant activity in mamey sapote (Pouteria sapota) fruits in postharvest. Food Res. Int. 2011, 44, 1956–1961. [Google Scholar] [CrossRef]
  5. Carriço, C.; Pinto, Z.T.; Dutok, C.M.S.; Reyes-Tur, B.; Queiro, M.M.C. Biological activity of Pouteria sapota leaf extract on postembryonic development of blowfly Chrysomya putoria (Wiedemann, 1818) (Calliphoridae). Rev. Brasil. Farm. 2014, 24, 304–308. [Google Scholar] [CrossRef]
  6. Wickramasinghe, A.S.D.; Kalansuriya, P.; Attanayake, A.P. Nanoformulation of plant-based natural products for Type 2 diabetes mellitus: From formulation design to therapeutic applications. Curr. Ther. Res.-Clin. Exp. 2022, 96, 100672. [Google Scholar] [CrossRef]
  7. Aleman-Ramirez, J.L.; Okoye Patrick, U.; Pal, U.; Sebastian, P.J. Agro-industrial residue of Pouteria sapota peels as a green heterogeneous catalyst to produce biodiesel from soybean and sunflower oils. Renew. Ener. 2024, 224, 120163. [Google Scholar] [CrossRef]
  8. Lopez-Martinez, V.; Alia-Tejacal, I.; Garcia-Ramirez, M.J.; Guillen-Sanchez, D. Insectos plaga del Zapote Mamey en Morelos. In El Zapote Mamey en Mexico: Avances en Investigacion; Editorial Universidad Autonoma del Estado de Morelos: Cuernavaca, Mexico, 2008; pp. 131–141. [Google Scholar]
  9. Bolland, H.R.; Gutierrez, J.; Flechtmann, C.H.W. World Catalogue of the Spider Mite Family (Acari: Tetranychidae); Brill Leiden: Boston, MA, USA; Koln, Germany, 1998; pp. 1–392. [Google Scholar]
  10. Balerdi, C.F.; Crane, J.H.; Maguire, I. Mamey Sapote Growing in the Florida Home Landscape; Horticultural Sciences Department, Document FC30; Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida: Gainesville, FL, USA, 2008; Available online: http://edis.ifas.ufl.edu/pdffiles/MG/MG33100.pdf (accessed on 2 December 2024).
  11. Navia, D.; Ochoa, R.; Welbourn, C.; Ferragut, F. Adventive eriophyoid mites: A global review of their impact, pathways, prevention and challenges. Exp. Appl. Acarol. 2010, 51, 225–255. [Google Scholar] [CrossRef]
  12. de Lillo, E.; Pozzebon, A.; Valenzano, D.; Duso, C. An intimate relationship between eriophyoid mites and their host plants–A review. Front. Plant Sci. 2018, 9, 1786. [Google Scholar] [CrossRef]
  13. Vacante, V. Handbook of Mites of Economic Plants, The: Identification, Bio-Ecology and Control; CABI Publishing: Wallingford, UK, 2016; pp. 1–890. [Google Scholar]
  14. de Lillo, E.; Craemer, C.; Amrine, J.W., Jr.; Nuzzaci, G. Recommended procedures and techniques for morphological studies of Eriophyoidea (Acari: Prostigmata). Exp. Appl. Acarol. 2010, 51, 283–307. [Google Scholar] [CrossRef]
  15. Keifer, H.H. Eriophyid Studies. ARS-USDA 1977, C-13, 1–24. [Google Scholar]
  16. Manson, D.C.M. Eriophyinae (Arachnida: Acari: Eriophyoidea). Fauna N. Z. 1984, 5, 1–123. [Google Scholar]
  17. Meyer-Smith, D.K.P.; Ueckermann, E.A. African Eriophyoidea: The genus Eriophyes von Siebold, 1851 (Acari: Eriophyidae). Phytophylactica 1989, 21, 331–342. [Google Scholar]
  18. Umapathy, G.; Mohanasundaram, M. New species of gall mites (Eriophyidae: Acari) from south India. In Advances in IPM for Horticultural Crops. Proceedings of the First National Symposium on Pest Management in Horticultural Crops: Environmental Implications and Thrusts, Bangalore, India, 15–17 October 1997; Reddy, P.P., Kumar, N.K.K., Verghese, A., Eds.; Association for Advancement of Pest Management in Horticultural Ecosystems, Indian Institute of Horticultural Research: Bengaluru, India, 1998; p. 560. [Google Scholar]
  19. Flechtmann, C.H.; Etienne, J. On plant mites from Guadeloupe, with descriptions of four new species of Eriophyidae. Zootaxa 2005, 1046, 55–68. [Google Scholar] [CrossRef]
  20. Krantz, G.W.; Walter, D.E. (Eds.) A Manual of Acarology, 3rd ed.; Texas Tech University Press: Lubbock, TX, USA, 2009; pp. 1–807. [Google Scholar]
  21. Keifer, H.H. Eriophyoidea Nalepa. Injurious eriophyoid mites. In Mites Injurious to Economic Plants; Jeppson, L.R., Keifer, H.H., Baker, E.W., Eds.; University California Press: Berkeley, CA, USA, 1975; pp. 327–533. [Google Scholar]
  22. Amrine, J.W., Jr.; Stasny, T.A.H.; Flechtmann, C.H.W. Revised Keys to World Genera of Eriophyoidea (Acari: Prostigmata); Indira Publishing House: West Bloomfield, MI, USA, 2003; pp. iv+–244. [Google Scholar]
  23. Lindquist, E.E.; Bruin, J.; Sabelis, M.W. Eriophyoid Mites: Their Biology, Natural Enemies and Control; World Crop Pests; Elsevier: Amsterdam, The Netherlands, 1996; Volume 6, pp. 1–790. [Google Scholar]
  24. Keifer, H.H. An Illustrated Guide to Plant Abnormalities Caused by Eriophyid Mites in North America (No. 573); US Department of Agriculture, Agricultural Research Service: Washington, DC, USA, 1982; Volume 573, pp. 1–178. [Google Scholar]
  25. Amrine, J.W., Jr.; Manson, D.C.M. Preparation, mounting and descriptive study of eriophyoid mites. In Eriophyoid Mites—Their Biology, Natural Enemies and Control; Lindquist, E.E., Sabelis, M.W., Bruin, J., Eds.; World Crop Pests; Elsevier: Amsterdam, The Netherlands, 1996; Volume 6, pp. 383–396. [Google Scholar] [CrossRef]
  26. World Flora Online. Available online: http://www.worldfloraonline.org (accessed on 24 January 2024).
  27. Otero-Colina, G.; Ochoa, R.; Amrine, J.W., Jr.; Hammond, J.; Jordan, R.; Bauchan, G.R. Eriophyoid mites found on healthy and rose rosette diseased roses in the United States. J. Environ. Hortic. 2018, 36, 146–153. [Google Scholar] [CrossRef]
  28. de Mendonça, R.S.; Navia, D.; Diniz, I.R.; Auger, P.; Navajas, M. A critical review on some closely related species of Tetranychus sensu stricto (Acari: Tetranychidae) in the public DNA sequences databases. Exp. Appl. Acarol. 2011, 55, 1–23. [Google Scholar] [CrossRef]
  29. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.R.V. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotech. 1994, 3, 294–299. [Google Scholar]
  30. Skoracka, A.; Dabert, M. The cereal rust mite Abacarus hystrix (Acari: Eriophyoidea) is a complex of species: Evidence from mitochondrial and nuclear DNA sequences. Bull. Entomol. Res. 2010, 100, 263–272. [Google Scholar] [CrossRef]
  31. Skoracka, A.; Kuczyński, L.; de Mendonça, R.S.; Dabert, M.; Szydło, W.; Knihinicki, D.; Truol, G.; Navia, D. Cryptic species within the wheat curl mite Aceria tosichella (Keifer) (Acari: Eriophyoidea), revealed by mitochondrial, nuclear and morphometric data. Invertebr. Syst. 2012, 26, 417–433. [Google Scholar] [CrossRef]
  32. Ben Ali, Z.; Boursot, P.; Said, K.; Lagnel, J.; Chatti, N.; Navajas, M. Comparison of ribosomal ITS regions among Androctonus spp. scorpions (Scorpionida: Buthidae) from Tunisia. J. Med. Entomol. 2000, 37, 787–790. [Google Scholar] [CrossRef]
  33. Navajas, M.; Lagnel, J.; Gutierrez, J.; Boursot, P. Species-wide homogeneity of nuclear ribosomal ITS2 sequences in the spider mite Tetranychus urticae contrasts with extensive mitochondrial COI polymorphism. Heredity 1998, 80, 742–752. [Google Scholar] [CrossRef]
  34. Staden, R.; Beal, K.F.; Bonfield, J.K. The staden package, 1998. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S.A., Eds.; Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2000; pp. 115–130. [Google Scholar] [CrossRef]
  35. Skoracka, A.; Smith, L.; Oldfield, G.; Cristofaro, M.; Amrine, J.W., Jr. Host-plant specificity and specialization in eriophyoid mites and their importance for the use of eriophyoid mites as biocontrol agents of weeds. Exp. Appl. Acarol. 2010, 51, 93–113. [Google Scholar] [CrossRef]
Figure 1. Eriophyes pouteriae sp. nov. found in five Pouteria sapota commercial orchards distributed throughout the Redland agricultural area in Homestead, FL. (site 1: 25°30′33.8976″, −80°30′25.2648″; site 2: 25°34′28.347″, −80°31′7.881″; site 3: 25°25′23.199″, −80°30′51.4008″; site 4: 25°33′53.0094″, −80°24′35.697″; site 5: 25°30′25.527″, −80°30′1.0332″).
Figure 1. Eriophyes pouteriae sp. nov. found in five Pouteria sapota commercial orchards distributed throughout the Redland agricultural area in Homestead, FL. (site 1: 25°30′33.8976″, −80°30′25.2648″; site 2: 25°34′28.347″, −80°31′7.881″; site 3: 25°25′23.199″, −80°30′51.4008″; site 4: 25°33′53.0094″, −80°24′35.697″; site 5: 25°30′25.527″, −80°30′1.0332″).
Insects 15 00972 g001
Figure 2. Line drawings of Eriophyes pouteriae sp. nov.: AD. Prodorsal shield; AL. Lateral view of anterior body region; CG. Female coxigenital region; em. Empodium; IG. Internal female genitalia; LO. Lateral view of annuli; L1. Leg I; PM. Lateral view of posterior opisthosoma. Scale bar: 10 μm for AD, AL, CG, IG, PM; 5 μm for LO, L1; 2.5 μm for em.
Figure 2. Line drawings of Eriophyes pouteriae sp. nov.: AD. Prodorsal shield; AL. Lateral view of anterior body region; CG. Female coxigenital region; em. Empodium; IG. Internal female genitalia; LO. Lateral view of annuli; L1. Leg I; PM. Lateral view of posterior opisthosoma. Scale bar: 10 μm for AD, AL, CG, IG, PM; 5 μm for LO, L1; 2.5 μm for em.
Insects 15 00972 g002
Figure 3. Scanning electron microscope images of adult female of Eriophyes pouteriae sp. nov.: (a,b) dorsal view, scales 50 µm and 30 µm, respectively; (c,e) lateral view, scales 50 µm and 30 µm, respectively; (d) coxigenital region, scale 20 µm; (f) female hiding within the trichomes of a plant bud, scale 200 µm.
Figure 3. Scanning electron microscope images of adult female of Eriophyes pouteriae sp. nov.: (a,b) dorsal view, scales 50 µm and 30 µm, respectively; (c,e) lateral view, scales 50 µm and 30 µm, respectively; (d) coxigenital region, scale 20 µm; (f) female hiding within the trichomes of a plant bud, scale 200 µm.
Insects 15 00972 g003
Figure 4. Pouteria sapota infested by Eriophyes pouteriae sp. nov. (a,c) and healthy (b,d): (a,b) detail of new leaves; (c,d) detail of branches of the tree.
Figure 4. Pouteria sapota infested by Eriophyes pouteriae sp. nov. (a,c) and healthy (b,d): (a,b) detail of new leaves; (c,d) detail of branches of the tree.
Insects 15 00972 g004
Table 1. Fragments amplified and primers utilized in PCR reactions and DNA sequencing for Eriophyes pouteriae sp. nov.
Table 1. Fragments amplified and primers utilized in PCR reactions and DNA sequencing for Eriophyes pouteriae sp. nov.
RegionPrimerSequence for the Primer 5′–3′Length (bps)
COILCO1490GGTCAACAAATCATAAAGATATTGG670 pbs
HCO2198TAAACTTCAGGGTGACCAAAAAATCA
18S and 28S rRNAfl230TGAAACTTAAAGGAATTGACG516 pbs
D1D2 rev 04GTTAGACTYCTTGGTCCGTG
ITS18SAGAGGAAGTAAAAGTCGTAACAAG900 pbs
28SCATATGCTTAAATTCAGCGGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

De Giosa, M.; de Lillo, E.; Tassi, A.D.; Revynthi, A.M.; de Andrade, D.J.; Ochoa, R.; Yang, X.; Carrillo, D. Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota. Insects 2024, 15, 972. https://doi.org/10.3390/insects15120972

AMA Style

De Giosa M, de Lillo E, Tassi AD, Revynthi AM, de Andrade DJ, Ochoa R, Yang X, Carrillo D. Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota. Insects. 2024; 15(12):972. https://doi.org/10.3390/insects15120972

Chicago/Turabian Style

De Giosa, Marcello, Enrico de Lillo, Aline D. Tassi, Alexandra M. Revynthi, Daniel J. de Andrade, Ronald Ochoa, Xiangbing Yang, and Daniel Carrillo. 2024. "Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota" Insects 15, no. 12: 972. https://doi.org/10.3390/insects15120972

APA Style

De Giosa, M., de Lillo, E., Tassi, A. D., Revynthi, A. M., de Andrade, D. J., Ochoa, R., Yang, X., & Carrillo, D. (2024). Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota. Insects, 15(12), 972. https://doi.org/10.3390/insects15120972

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop