Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota †
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Samples
2.2. Morphological Characterization by Light Microscopy
2.3. Morphological Characterization by Scanning Electron Microscopy
2.4. Molecular Characterization—DNA Extraction, Amplification, and Sequencing
3. Results
3.1. Morphological Characterization
Eriophyes pouteriae sp. nov. (Figure 2) De Giosa, Tassi et de Lillo
3.2. Molecular Characterization
4. Discussion and Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Campbell, R.J.; Zill, G.; Mahdeem, H. New mamey sapote cultivars from tropical America. Proc. Interamer. Soc. Trop. Horticul. 1997, 41, 219–222. [Google Scholar]
- Alia-Tejacal, I.; Villanueva-Arce, R.; Pelayo-Zaldívar, C.; Colinas-León, M.T.; López-Martínez, V.; Bautista-Baños, S. Postharvest physiology and technology of sapote mamey fruit (Pouteria sapota (Jacq.) HE Moore & Stearn). Postharv. Biol. Technol. 2007, 45, 285–297. [Google Scholar] [CrossRef]
- Morton, J. Sapote. In Fruits of Warm Climates; Morton, J.F., Ed.; Creative Resources Systems: Miami, FL, USA, 1987; pp. 398–402. [Google Scholar]
- Torres-Rodríguez, A.; Salinas-Moreno, Y.; Valle-Guadarrama, S.; Alia-Tejacol, I. Soluble phenols and antioxidant activity in mamey sapote (Pouteria sapota) fruits in postharvest. Food Res. Int. 2011, 44, 1956–1961. [Google Scholar] [CrossRef]
- Carriço, C.; Pinto, Z.T.; Dutok, C.M.S.; Reyes-Tur, B.; Queiro, M.M.C. Biological activity of Pouteria sapota leaf extract on postembryonic development of blowfly Chrysomya putoria (Wiedemann, 1818) (Calliphoridae). Rev. Brasil. Farm. 2014, 24, 304–308. [Google Scholar] [CrossRef][Green Version]
- Wickramasinghe, A.S.D.; Kalansuriya, P.; Attanayake, A.P. Nanoformulation of plant-based natural products for Type 2 diabetes mellitus: From formulation design to therapeutic applications. Curr. Ther. Res.-Clin. Exp. 2022, 96, 100672. [Google Scholar] [CrossRef]
- Aleman-Ramirez, J.L.; Okoye Patrick, U.; Pal, U.; Sebastian, P.J. Agro-industrial residue of Pouteria sapota peels as a green heterogeneous catalyst to produce biodiesel from soybean and sunflower oils. Renew. Ener. 2024, 224, 120163. [Google Scholar] [CrossRef]
- Lopez-Martinez, V.; Alia-Tejacal, I.; Garcia-Ramirez, M.J.; Guillen-Sanchez, D. Insectos plaga del Zapote Mamey en Morelos. In El Zapote Mamey en Mexico: Avances en Investigacion; Editorial Universidad Autonoma del Estado de Morelos: Cuernavaca, Mexico, 2008; pp. 131–141. [Google Scholar]
- Bolland, H.R.; Gutierrez, J.; Flechtmann, C.H.W. World Catalogue of the Spider Mite Family (Acari: Tetranychidae); Brill Leiden: Boston, MA, USA; Koln, Germany, 1998; pp. 1–392. [Google Scholar]
- Balerdi, C.F.; Crane, J.H.; Maguire, I. Mamey Sapote Growing in the Florida Home Landscape; Horticultural Sciences Department, Document FC30; Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida: Gainesville, FL, USA, 2008; Available online: http://edis.ifas.ufl.edu/pdffiles/MG/MG33100.pdf (accessed on 2 December 2024).
- Navia, D.; Ochoa, R.; Welbourn, C.; Ferragut, F. Adventive eriophyoid mites: A global review of their impact, pathways, prevention and challenges. Exp. Appl. Acarol. 2010, 51, 225–255. [Google Scholar] [CrossRef]
- de Lillo, E.; Pozzebon, A.; Valenzano, D.; Duso, C. An intimate relationship between eriophyoid mites and their host plants–A review. Front. Plant Sci. 2018, 9, 1786. [Google Scholar] [CrossRef]
- Vacante, V. Handbook of Mites of Economic Plants, The: Identification, Bio-Ecology and Control; CABI Publishing: Wallingford, UK, 2016; pp. 1–890. [Google Scholar]
- de Lillo, E.; Craemer, C.; Amrine, J.W., Jr.; Nuzzaci, G. Recommended procedures and techniques for morphological studies of Eriophyoidea (Acari: Prostigmata). Exp. Appl. Acarol. 2010, 51, 283–307. [Google Scholar] [CrossRef]
- Keifer, H.H. Eriophyid Studies. ARS-USDA 1977, C-13, 1–24. [Google Scholar]
- Manson, D.C.M. Eriophyinae (Arachnida: Acari: Eriophyoidea). Fauna N. Z. 1984, 5, 1–123. [Google Scholar]
- Meyer-Smith, D.K.P.; Ueckermann, E.A. African Eriophyoidea: The genus Eriophyes von Siebold, 1851 (Acari: Eriophyidae). Phytophylactica 1989, 21, 331–342. [Google Scholar]
- Umapathy, G.; Mohanasundaram, M. New species of gall mites (Eriophyidae: Acari) from south India. In Advances in IPM for Horticultural Crops. Proceedings of the First National Symposium on Pest Management in Horticultural Crops: Environmental Implications and Thrusts, Bangalore, India, 15–17 October 1997; Reddy, P.P., Kumar, N.K.K., Verghese, A., Eds.; Association for Advancement of Pest Management in Horticultural Ecosystems, Indian Institute of Horticultural Research: Bengaluru, India, 1998; p. 560. [Google Scholar]
- Flechtmann, C.H.; Etienne, J. On plant mites from Guadeloupe, with descriptions of four new species of Eriophyidae. Zootaxa 2005, 1046, 55–68. [Google Scholar] [CrossRef]
- Krantz, G.W.; Walter, D.E. (Eds.) A Manual of Acarology, 3rd ed.; Texas Tech University Press: Lubbock, TX, USA, 2009; pp. 1–807. [Google Scholar]
- Keifer, H.H. Eriophyoidea Nalepa. Injurious eriophyoid mites. In Mites Injurious to Economic Plants; Jeppson, L.R., Keifer, H.H., Baker, E.W., Eds.; University California Press: Berkeley, CA, USA, 1975; pp. 327–533. [Google Scholar]
- Amrine, J.W., Jr.; Stasny, T.A.H.; Flechtmann, C.H.W. Revised Keys to World Genera of Eriophyoidea (Acari: Prostigmata); Indira Publishing House: West Bloomfield, MI, USA, 2003; pp. iv+–244. [Google Scholar]
- Lindquist, E.E.; Bruin, J.; Sabelis, M.W. Eriophyoid Mites: Their Biology, Natural Enemies and Control; World Crop Pests; Elsevier: Amsterdam, The Netherlands, 1996; Volume 6, pp. 1–790. [Google Scholar]
- Keifer, H.H. An Illustrated Guide to Plant Abnormalities Caused by Eriophyid Mites in North America (No. 573); US Department of Agriculture, Agricultural Research Service: Washington, DC, USA, 1982; Volume 573, pp. 1–178. [Google Scholar]
- Amrine, J.W., Jr.; Manson, D.C.M. Preparation, mounting and descriptive study of eriophyoid mites. In Eriophyoid Mites—Their Biology, Natural Enemies and Control; Lindquist, E.E., Sabelis, M.W., Bruin, J., Eds.; World Crop Pests; Elsevier: Amsterdam, The Netherlands, 1996; Volume 6, pp. 383–396. [Google Scholar] [CrossRef]
- World Flora Online. Available online: http://www.worldfloraonline.org (accessed on 24 January 2024).
- Otero-Colina, G.; Ochoa, R.; Amrine, J.W., Jr.; Hammond, J.; Jordan, R.; Bauchan, G.R. Eriophyoid mites found on healthy and rose rosette diseased roses in the United States. J. Environ. Hortic. 2018, 36, 146–153. [Google Scholar] [CrossRef]
- de Mendonça, R.S.; Navia, D.; Diniz, I.R.; Auger, P.; Navajas, M. A critical review on some closely related species of Tetranychus sensu stricto (Acari: Tetranychidae) in the public DNA sequences databases. Exp. Appl. Acarol. 2011, 55, 1–23. [Google Scholar] [CrossRef]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.R.V. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotech. 1994, 3, 294–299. [Google Scholar]
- Skoracka, A.; Dabert, M. The cereal rust mite Abacarus hystrix (Acari: Eriophyoidea) is a complex of species: Evidence from mitochondrial and nuclear DNA sequences. Bull. Entomol. Res. 2010, 100, 263–272. [Google Scholar] [CrossRef]
- Skoracka, A.; Kuczyński, L.; de Mendonça, R.S.; Dabert, M.; Szydło, W.; Knihinicki, D.; Truol, G.; Navia, D. Cryptic species within the wheat curl mite Aceria tosichella (Keifer) (Acari: Eriophyoidea), revealed by mitochondrial, nuclear and morphometric data. Invertebr. Syst. 2012, 26, 417–433. [Google Scholar] [CrossRef]
- Ben Ali, Z.; Boursot, P.; Said, K.; Lagnel, J.; Chatti, N.; Navajas, M. Comparison of ribosomal ITS regions among Androctonus spp. scorpions (Scorpionida: Buthidae) from Tunisia. J. Med. Entomol. 2000, 37, 787–790. [Google Scholar] [CrossRef]
- Navajas, M.; Lagnel, J.; Gutierrez, J.; Boursot, P. Species-wide homogeneity of nuclear ribosomal ITS2 sequences in the spider mite Tetranychus urticae contrasts with extensive mitochondrial COI polymorphism. Heredity 1998, 80, 742–752. [Google Scholar] [CrossRef]
- Staden, R.; Beal, K.F.; Bonfield, J.K. The staden package, 1998. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S.A., Eds.; Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2000; pp. 115–130. [Google Scholar] [CrossRef]
- Skoracka, A.; Smith, L.; Oldfield, G.; Cristofaro, M.; Amrine, J.W., Jr. Host-plant specificity and specialization in eriophyoid mites and their importance for the use of eriophyoid mites as biocontrol agents of weeds. Exp. Appl. Acarol. 2010, 51, 93–113. [Google Scholar] [CrossRef]




| Region | Primer | Sequence for the Primer 5′–3′ | Length (bps) |
|---|---|---|---|
| COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG | 670 pbs |
| HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | ||
| 18S and 28S rRNA | fl230 | TGAAACTTAAAGGAATTGACG | 516 pbs |
| D1D2 rev 04 | GTTAGACTYCTTGGTCCGTG | ||
| ITS | 18S | AGAGGAAGTAAAAGTCGTAACAAG | 900 pbs |
| 28SC | ATATGCTTAAATTCAGCGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Giosa, M.; de Lillo, E.; Tassi, A.D.; Revynthi, A.M.; de Andrade, D.J.; Ochoa, R.; Yang, X.; Carrillo, D. Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota. Insects 2024, 15, 972. https://doi.org/10.3390/insects15120972
De Giosa M, de Lillo E, Tassi AD, Revynthi AM, de Andrade DJ, Ochoa R, Yang X, Carrillo D. Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota. Insects. 2024; 15(12):972. https://doi.org/10.3390/insects15120972
Chicago/Turabian StyleDe Giosa, Marcello, Enrico de Lillo, Aline D. Tassi, Alexandra M. Revynthi, Daniel J. de Andrade, Ronald Ochoa, Xiangbing Yang, and Daniel Carrillo. 2024. "Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota" Insects 15, no. 12: 972. https://doi.org/10.3390/insects15120972
APA StyleDe Giosa, M., de Lillo, E., Tassi, A. D., Revynthi, A. M., de Andrade, D. J., Ochoa, R., Yang, X., & Carrillo, D. (2024). Eriophyes pouteriae sp. nov., a New Mite Species Infesting Pouteria sapota. Insects, 15(12), 972. https://doi.org/10.3390/insects15120972

