Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Selection of the Target Gene
2.2. In Silico Analysis of RNAi Effectiveness and Off-Targets
2.3. Cloning and Synthesis of ACE Fragments
2.4. In Vitro dsRNA Synthesis
2.5. Insect Growth Conditions
2.6. RNA Extraction
2.7. Quantitative Real-Time PCR (qPCR)
2.8. Statistical Analysis
3. Results
3.1. Selection and Analysis of the ACE Gene for Silencing
3.2. Design of RNAi and Off-Target Analysis
3.3. In Vitro Synthesis of dsRNA Targeting the ACE1 Sequence
3.4. Effects of Larval Feeding with dsRNA Targeting the ACE1 Gene
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kadoić Balaško, M.; Mikac, K.M.; Bažok, R.; Lemic, D. Modern techniques in Colorado Potato Beetle (Leptinotarsa decemlineata Say) control and resistance management: History review and future perspectives. Insects 2020, 11, 581. [Google Scholar] [CrossRef] [PubMed]
- Weber, D. Colorado Beetle: Pest on the move. Pestic. Outlook 2003, 14, 256–259. [Google Scholar] [CrossRef]
- Skryabin, K. Do Russia and Eastern Europe need GM plants? New Biotechnol. 2010, 27, 593–595. [Google Scholar] [CrossRef]
- Speese, J.; Sterrett, S.B. Crop rotation reduces the cost of Colorado Potato Beetle control in potatoes. HortTechnology 1998, 8, 229–234. [Google Scholar] [CrossRef]
- Wraight, S.P.; Ramos, M.E. Delayed efficacy of Beauveria bassiana foliar spray applications against Colorado Potato Beetle: Impacts of number and timing of applications on larval and next-generation adult populations. Biol. Control 2015, 83, 51–67. [Google Scholar] [CrossRef]
- Sablon, L.; Haubruge, E.; Verheggen, F.J. Consumption of immature stages of Colorado Potato Beetle by Chrysoperla carnea (Neuroptera: Chrysopidae) larvae in the laboratory. Am. J. Potato Res. 2013, 90, 51–57. [Google Scholar] [CrossRef]
- Alvarez, J.M.; Srinivasan, R.; Cervantes, F.A. Occurrence of the Carabid Beetle, Pterostichus melanarius (Illiger), in potato ecosystems of Idaho and its predatory potential on the Colorado Potato Beetle and aphids. Am. J. Potato Res. 2013, 90, 83–92. [Google Scholar] [CrossRef]
- Kuhar, T.P.; Philips, C.; Wallingford, A.; Aigner, J.D.; Wime, A. Management approaches. In Insect Pests of Potato, Global Perspectives on Biology and Management, 2nd ed.; Alyokhin, A., Rondon, S.I., Gao, Y., Eds.; Elsevier: London, UK, 2022; Volume 1, pp. 201–218. [Google Scholar]
- Chen, Y.H.; Cohen, Z.P.; Bueno, E.M.; Christensen, B.M.; Schoville, S.D. Rapid evolution of insecticide resistance in the Colorado Potato Beetle, Leptinotarsa decemlineata. Curr. Opin. Insect Sci. 2023, 55, 101000. [Google Scholar] [CrossRef]
- APRD. Arthropod Pesticide Resistance Database: Leptinotarsa decemlineata. Available online: https://www.pesticideresistance.org (accessed on 12 November 2024).
- Dubovskiy, I.M.; Grizanova, E.V.; Tereshchenko, D.; Krytsyna, T.I.; Alikina, T.; Kalmykova, G.; Kabilov, M.; Coates, C.J. Bacillus thuringiensis spores and Cry3A toxins act synergistically to expedite Colorado Potato Beetle mortality. Toxins 2021, 13, 746. [Google Scholar] [CrossRef]
- Perlak, F.J.; Stone, T.B.; Muskopf, Y.M.; Petersen, L.J.; Parker, G.B.; McPherson, S.A.; Wyman, J.; Love, S.; Reed, G.; Biever, D.; et al. Genetically improved potatoes: Protection from damage by Colorado Potato Beetles. Plant Mol. Biol. 1993, 22, 313–321. [Google Scholar] [CrossRef]
- Salim, M.; Bakhsh, A.; Gökçe, A. Stacked insecticidal genes in potatoes exhibit enhanced toxicity against Colorado Potato Beetle, Leptinotarsa decemlineata (Coleoptera: Chrysomelidae). Plant Biotechnol. Rep. 2021, 15, 197–215. [Google Scholar] [CrossRef]
- CERA. Center for Environmental Risk Assessment, Ilsi Research Foundation. A review of the environmental safety of the Cry1Ac protein. Environ. Biosaf. Res. 2011, 10, 27–49. [Google Scholar] [CrossRef]
- Wolfenbarger, L.L.; Naranjo, S.E.; Lundgren, J.G.; Bitzer, R.J.; Watrud, L.S. Bt crop effects on functional guilds of non-target arthropods: A meta-analysis. PLoS ONE 2008, 3, e2118. [Google Scholar] [CrossRef] [PubMed]
- Tabashnik, B.E.; Fabrick, J.A.; Carrière, Y. Global patterns of insect resistance to transgenic Bt crops: The first 25 years. J. Econ. Entomol. 2023, 116, 297–309. [Google Scholar] [CrossRef]
- Welch, K.L.; Unnithan, G.C.; Degain, B.A.; Wei, J.; Zhang, J.; Li, X.; Tabashnik, B.E.; Carrière, Y. Cross-resistance to toxins used in pyramided Bt crops and resistance to Bt sprays in Helicoverpa zea. J. Invertebr. Pathol. 2015, 132, 149–156. [Google Scholar] [CrossRef]
- Tabashnik, B.E.; Carrière, Y. Surge in insect resistance to transgenic crops and prospects for sustainability. Nat. Biotechnol. 2017, 35, 926–935. [Google Scholar] [CrossRef]
- Alyokhin, A.V.; Ferro, D.N. Relative fitness of Colorado Potato Beetle (Coleoptera: Chrysomelidae) resistant and susceptible to the Bacillus thuringiensis Cry3A toxin. J. Econ. Entomol. 1999, 92, 510–515. [Google Scholar] [CrossRef]
- Svoboda, P. Key mechanistic principles and considerations concerning RNA interference. Front. Plant Sci. 2020, 11, 1237. [Google Scholar] [CrossRef]
- Gordon, K.H.J.; Waterhouse, P.M. RNAi for insect-proof plants. Nat. Biotechnol. 2007, 25, 1231–1232. [Google Scholar] [CrossRef]
- Zhu, F.; Xu, J.; Palli, R.; Ferguson, J.; Palli, S.R. Ingested RNA interference for managing the populations of the Colorado Potato Beetle, Leptinotarsa decemlineata. Pest Manag. Sci. 2011, 67, 175–182. [Google Scholar] [CrossRef]
- Bally, J.; McIntyre, G.J.; Doran, R.L.; Lee, K.; Perez, A.; Jung, H.; Naim, F.; Larrinua, I.M.; Narva, K.E.; Waterhouse, P.M. In-plant protection against Helicoverpa armigera by production of long hpRNA in chloroplasts. Front. Plant Sci. 2016, 7, 1453. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Khan, S.A.; Hasse, C.; Ruf, S.; Heckel, D.G.; Bock, R. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science 2015, 347, 991–994. [Google Scholar] [CrossRef] [PubMed]
- Baum, J.A.; Bogaert, T.; Clinton, W.; Heck, G.R.; Feldmann, P.; Ilagan, O.; Johnson, S.; Plaetinck, G.; Munyikwa, T.; Pleau, M.; et al. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 2007, 25, 1322–1326. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, A.; Rajamani, V.; Reddy, V.S.; Mukherjee, S.K.; Bhatnagar, R.K. Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: An alternative to Bt-toxin technology. Transgenic Res. 2015, 24, 791–801. [Google Scholar] [CrossRef]
- Chen, C.-Y.; Liu, Y.-Q.; Song, W.-M.; Chen, D.-Y.; Chen, F.-Y.; Chen, X.-Y.; Chen, Z.-W.; Ge, S.-X.; Wang, C.-Z.; Zhan, S.; et al. An effector from cotton bollworm oral secretion impairs host plant defense signaling. Proc. Natl. Acad. Sci. USA 2019, 116, 14331. [Google Scholar] [CrossRef]
- Saini, R.P.; Raman, V.; Dhandapani, G.; Malhotra, E.V.; Sreevathsa, R.; Kumar, P.A.; Sharma, T.R.; Pattanayak, D. Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera. PLoS ONE 2018, 13, e0194150. [Google Scholar] [CrossRef]
- Guo, H.; Song, X.; Wang, G.; Yang, K.; Wang, Y.; Niu, L.; Chen, X.; Fang, R. Plant-generated artificial small RNAs mediated aphid resistance. PLoS ONE 2014, 9, e97410. [Google Scholar] [CrossRef]
- Bhatia, V.; Bhattacharya, R. Host-mediated RNA interference targeting a cuticular protein gene impaired fecundity in the green peach aphid Myzus persicae. Pest Manag. Sci. 2018, 74, 2059–2068. [Google Scholar] [CrossRef]
- Rauf, I.; Asif, M.; Amin, I.; Naqvi, R.Z.; Umer, N.; Mansoor, S.; Jander, G. Silencing cathepsin L expression reduces Myzus persicae protein content and the nutritional value as prey for Coccinella septempunctata. Insect Mol. Biol. 2019, 28, 785–797. [Google Scholar] [CrossRef]
- Eakteiman, G.; Moses-Koch, R.; Moshitzky, P.; Mestre-Rincon, N.; Vassão, D.G.; Luck, K.; Sertchook, R.; Malka, O.; Morin, S. Targeting detoxification genes by phloem-mediated RNAi: A new approach for controlling phloem-feeding insect pests. Insect Biochem. Mol. Biol. 2018, 100, 10–21. [Google Scholar] [CrossRef]
- Xu, H.-X.; Qian, L.-X.; Wang, X.-W.; Shao, R.-X.; Hong, Y.; Liu, S.-S.; Wang, X.-W. A salivary effector enables whitefly to feed on host plants by eliciting salicylic acid-signaling pathway. Proc. Natl. Acad. Sci. USA 2019, 116, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Sparks, C.; Jones, H.; Riley, M.; Francis, F.; Du, W.; Xia, L. Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants. Plant Biotechnol. J. 2019, 17, 852–854. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zou, Z.; Zhang, C.; Liu, X.; Wang, J.; Xin, T.; Xia, B. Knockdown of the Trehalose-6-Phosphate Synthase gene using RNA interference inhibits synthesis of trehalose and increases lethality rate in Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae). Insects 2020, 11, 605. [Google Scholar] [CrossRef] [PubMed]
- Fu, S.; Liu, Z.; Chen, J.; Sun, G.; Jiang, Y.; Li, M.; Xiong, L.; Chen, S.; Zhou, Y.; Asad, M.; et al. Silencing arginine kinase/integrin β1 subunit by transgenic plant expressing dsRNA inhibits the development and survival of Plutella xylostella. Pest Manag. Sci. 2020, 76, 1761–1771. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Wu, H.; Liu, H.; Zheng, J.; Lin, Y.; Chen, H. The overexpression of insect endogenous small RNAs in transgenic rice inhibits growth and delays pupation of striped stem borer (Chilo suppressalis). Pest Manag. Sci. 2017, 73, 1453–1461. [Google Scholar] [CrossRef]
- He, K.; Xiao, H.; Sun, Y.; Ding, S.; Situ, G.; Li, F. Transgenic microRNA-14 rice shows high resistance to rice stem borer. Plant Biotechnol. J. 2019, 17, 461–471. [Google Scholar] [CrossRef]
- ISAAA. GM Approval Database. Available online: https://www.isaaa.org/gmapprovaldatabase/ (accessed on 13 November 2024).
- EPA. U.S. Environmental Protection Agency, REGISTERS innovative Tool to Control Corn Rootworm. Available online: https://www.epa.gov/ (accessed on 13 November 2024).
- Head, G.P.; Carroll, M.W.; Evans, S.P.; Rule, D.M.; Willse, A.R.; Clark, T.L.; Storer, N.P.; Flannagan, R.D.; Samuel, L.W.; Meinke, L.J. Evaluation of SmartStax and SmartStax PRO maize against western corn rootworm and northern corn rootworm: Efficacy and resistance management. Pest Manag. Sci. 2017, 73, 1883–1899. [Google Scholar] [CrossRef]
- EPA. U.S. Environmental Protection Agency: EPA Registers Novel Pesticide Technology for Potato Crops. Available online: https://www.epa.gov/pesticides/epa-registers-novel-pesticide-technology-potato-crops (accessed on 2 November 2024).
- Rodrigues, T.B.; Mishra, S.K.; Sridharan, K.; Barnes, E.R.; Alyokhin, A.; Tuttle, R.; Kokulapalan, W.; Garby, D.; Skizim, N.J.; Tang, Y.-w.; et al. First sprayable double-stranded rna-based biopesticide product targets proteasome subunit beta type-5 in Colorado Potato Beetle (Leptinotarsa decemlineata). Front. Plant Sci. 2021, 12, 728652. [Google Scholar] [CrossRef]
- Liu, X.-P.; Fu, K.-Y.; Lü, F.-G.; Meng, Q.-W.; Guo, W.-C.; Li, G.-Q. Involvement of FTZ-F1 in the regulation of pupation in Leptinotarsa decemlineata (Say). Insect Biochem. Mol. Biol. 2014, 55, 51–60. [Google Scholar] [CrossRef]
- Ochoa-Campuzano, C.; Martínez-Ramírez, A.C.; Contreras, E.; Rausell, C.; Real, M.D. Prohibitin, an essential protein for Colorado Potato Beetle larval viability, is relevant to Bacillus thuringiensis Cry3Aa toxicity. Pestic. Biochem. Physiol. 2013, 107, 299–308. [Google Scholar] [CrossRef]
- Kong, Y.; Liu, X.-P.; Wan, P.-J.; Shi, X.-Q.; Guo, W.-C.; Li, G.-Q. The P450 enzyme Shade mediates the hydroxylation of ecdysone to 20-hydroxyecdysone in the Colorado Potato Beetle, Leptinotarsa decemlineata. Insect Mol. Biol. 2014, 23, 632–643. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.-T.; Jia, S.; Wan, P.-J.; Kong, Y.; Guo, W.-C.; Ahmat, T.; Li, G.-Q. RNA interference of a putative S-adenosyl-L-homocysteine hydrolase gene affects larval performance in Leptinotarsa decemlineata (Say). J. Insect Physiol. 2013, 59, 1049–1056. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.-H.; Jin, L.; Fu, K.-Y.; Guo, W.-C.; Li, G.-Q. RNA interference targeting Ras GTPase gene Ran causes larval and adult lethality in Leptinotarsa decemlineata. Pest Manag. Sci. 2022, 78, 3849–3858. [Google Scholar] [CrossRef] [PubMed]
- Fu, K.-Y.; Guo, W.-C.; Ahmat, T.; Li, G.-Q. Knockdown of a nutrient amino acid transporter gene LdNAT1 reduces free neutral amino acid contents and impairs Leptinotarsa decemlineata pupation. Sci. Rep. 2015, 5, 18124. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.-C.; Liu, X.-P.; Fu, K.-Y.; Shi, J.-F.; Lü, F.-G.; Li, G.-Q. Functions of nuclear receptor HR3 during larval-pupal molting in Leptinotarsa decemlineata (Say) revealed by in vivo RNA interference. Insect Biochem. Mol. Biol. 2015, 63, 23–33. [Google Scholar] [CrossRef]
- Lü, F.-G.; Fu, K.-Y.; Guo, W.-C.; Li, G.-Q. Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle. Gene 2015, 570, 264–271. [Google Scholar] [CrossRef]
- Wan, P.-J.; Fu, K.-Y.; Lü, F.-G.; Guo, W.-C.; Li, G.-Q. Knockdown of a putative alanine aminotransferase gene affects amino acid content and flight capacity in the Colorado Potato Beetle Leptinotarsa decemlineata. Amino Acids 2015, 47, 1445–1454. [Google Scholar] [CrossRef]
- Wan, P.-J.; Fu, K.-Y.; Lü, F.-G.; Wang, X.-X.; Guo, W.-C.; Li, G.-Q. Knocking down a putative -pyrroline-5-carboxylate dehydrogenase gene by RNA interference inhibits flight and causes adult lethality in the Colorado Potato Beetle Leptinotarsa decemlineata (Say). Pest Manag. Sci. 2015, 71, 1387–1396. [Google Scholar] [CrossRef]
- Shi, J.-F.; Fu, J.; Mu, L.-L.; Guo, W.-C.; Li, G.-Q. Two Leptinotarsa uridine diphosphate N-acetylglucosamine pyrophosphorylases are specialized for chitin synthesis in larval epidermal cuticle and midgut peritrophic matrix. Insect Biochem. Mol. Biol. 2016, 68, 1–12. [Google Scholar] [CrossRef]
- Shi, J.F.; Mu, L.L.; Chen, X.; Guo, W.C.; Li, G.Q. RNA interference of chitin synthase genes inhibits chitin biosynthesis and affects larval performance in Leptinotarsa decemlineata (Say). Int. J. Biol. Sci. 2016, 12, 1319–1331. [Google Scholar] [CrossRef]
- Shi, J.-F.; Xu, Q.-Y.; Sun, Q.-K.; Meng, Q.-W.; Mu, L.-L.; Guo, W.-C.; Li, G.-Q. Physiological roles of trehalose in Leptinotarsa larvae revealed by RNA interference of trehalose-6-phosphate synthase and trehalase genes. Insect Biochem. Mol. Biol. 2016, 77, 52–68. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.-C.; Liu, X.-P.; Fu, K.-Y.; Shi, J.-F.; Lü, F.-G.; Li, G.-Q. Nuclear receptor ecdysone-induced protein 75 is required for larval–pupal metamorphosis in the Colorado Potato Beetle Leptinotarsa decemlineata (Say). Insect Mol. Biol. 2016, 25, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Petek, M.; Coll, A.; Ferenc, R.; Razinger, J.; Gruden, K. Validating the potential of double-stranded RNA targeting Colorado Potato Beetle mesh gene in laboratory and field trials. Front. Plant Sci. 2020, 11, 1250. [Google Scholar] [CrossRef]
- Fu, K.-Y.; Li, Q.; Zhou, L.-T.; Meng, Q.-W.; Lü, F.-G.; Guo, W.-C.; Li, G.-Q. Knockdown of juvenile hormone acid methyl transferase severely affects the performance of Leptinotarsa decemlineata (Say) larvae and adults. Pest Manag. Sci. 2016, 72, 1231–1241. [Google Scholar] [CrossRef] [PubMed]
- Fu, K.-Y.; Zhu, T.-T.; Guo, W.-C.; Ahmat, T.; Li, G.-Q. Knockdown of a putative insulin-like peptide gene LdILP2 in Leptinotarsa decemlineata by RNA interference impairs pupation and adult emergence. Gene 2016, 581, 170–177. [Google Scholar] [CrossRef]
- Xu, Q.-Y.; Meng, Q.-W.; Deng, P.; Guo, W.-C.; Li, G.-Q. Leptinotarsa hormone receptor 4 (HR4) tunes ecdysteroidogenesis and mediates 20-hydroxyecdysone signaling during larval-pupal metamorphosis. Insect Biochem. Mol. Biol. 2018, 94, 50–60. [Google Scholar] [CrossRef]
- Gaddelapati, S.C.; Kalsi, M.; Roy, A.; Palli, S.R. Cap ‘n’ collar C regulates genes responsible for imidacloprid resistance in the Colorado Potato Beetle, Leptinotarsa decemlineata. Insect Biochem. Mol. Biol. 2018, 99, 54–62. [Google Scholar] [CrossRef]
- Hussain, T.; Aksoy, E.; Çalışkan, M.E.; Bakhsh, A. Transgenic potato lines expressing hairpin RNAi construct of molting-associated EcR gene exhibit enhanced resistance against Colorado Potato Beetle (Leptinotarsa decemlineata, Say). Transgenic Res. 2019, 28, 151–164. [Google Scholar] [CrossRef]
- Xu, Q.-Y.; Deng, P.; Mu, L.-L.; Fu, K.-Y.; Guo, W.-C.; Li, G.-Q. Silencing Taiman impairs larval development in Leptinotarsa decemlineata. Pestic. Biochem. Physiol. 2019, 160, 30–39. [Google Scholar] [CrossRef]
- Yoshinari, K.; Miyagishi, M.; Taira, K. Effects on RNAi of the tight structure, sequence and position of the targeted region. Nucleic Acids Res. 2004, 32, 691–699. [Google Scholar] [CrossRef]
- Elbashir, S.M.; Harborth, J.; Weber, K.; Tuschl, T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 2002, 26, 199–213. [Google Scholar] [CrossRef] [PubMed]
- Fakhr, E.; Zare, F.; Teimoori-Toolabi, L. Precise and efficient siRNA design: A key point in competent gene silencing. Cancer Gene Ther. 2016, 23, 73–82. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Xu, W.; Xu, L.; Fu, K.; Guo, W.; Bock, R.; Zhang, J. Length-dependent accumulation of double-stranded RNAs in plastids affects RNA interference efficiency in the Colorado Potato Beetle. J. Exp. Bot. 2020, 71, 2670–2677. [Google Scholar] [CrossRef]
- Dong, Y.; Yang, Y.; Wang, Z.; Wu, M.; Fu, J.; Guo, J.; Chang, L.; Zhang, J. Inaccessibility to double-stranded RNAs in plastids restricts RNA interference in (whitefly). Pest Manag. Sci. 2020, 76, 3168–3176. [Google Scholar] [CrossRef]
- Wu, M.; Dong, Y.; Zhang, Q.; Li, S.; Chang, L.; Loiacono, F.V.; Ruf, S.; Zhang, J.; Bock, R. Efficient control of western flower thrips by plastid-mediated RNA interference. Proc. Natl. Acad. Sci. USA 2022, 119, e2120081119. [Google Scholar] [CrossRef]
- Miller, S.C.; Miyata, K.; Brown, S.J.; Tomoyasu, Y. Dissecting systemic RNA interference in the red flour beetle Tribolium castaneum: Parameters affecting the efficiency of RNAi. PLoS ONE 2012, 7, e47431. [Google Scholar] [CrossRef]
- Bally, J.; Fishilevich, E.; Doran, R.L.; Lee, K.; de Campos, S.B.; German, M.A.; Narva, K.E.; Waterhouse, P.M. Plin-amiR, a pre-microRNA-based technology for controlling herbivorous insect pests. Plant Biotechnol. J. 2020, 18, 1925–1932. [Google Scholar] [CrossRef]
- Kumar, M.; Gupta, G.P.; Rajam, M.V. Silencing of acetylcholinesterase gene of Helicoverpa armigera by siRNA affects larval growth and its life cycle. J. Insect Physiol. 2009, 55, 273–278. [Google Scholar] [CrossRef]
- Holm, L.; Laiho, A.; Toronen, P.; Salgado, M. DALI shines a light on remote homologs: One hundred discoveries. Protein Sci. 2023, 23, e4519. [Google Scholar] [CrossRef]
- Eberhardt, J.; Santos-Martins, D.; Tillack, A.F.; Forli, S. AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J. Chem. Inf. Model. 2021, 61, 3891–3898. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Revuelta, L.; Ortego, F.; Díaz-Ruíz, J.R.; Castañera, P.; Tenllado, F.; Hernández-Crespo, P. Contribution of Ldace1 gene to acetylcholinesterase activity in Colorado Potato Beetle. Insect Biochem. Mol. Biol. 2011, 41, 795–803. [Google Scholar] [CrossRef] [PubMed]
- Zhu, K.Y.; Clark, J.M. Cloning and sequencing of a cDNA encoding acetylcholinesterase in Colorado Potato Beetle, Leptinotarsa decemlineata (say). Insect Biochem. Mol. Biol. 1995, 25, 1129–1138. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.-C.; Fu, K.-Y.; Yang, S.; Li, X.-X.; Li, G.-Q. Instar-dependent systemic RNA interference response in Leptinotarsa decemlineata larvae. Pestic. Biochem. Physiol. 2015, 123, 64–73. [Google Scholar] [CrossRef]
- Paoletti, M.G.; Pimentel, D. Environmental risks of pesticides versus genetic engineering for agricultural pest control. J. Agric. Environ. Ethics 2000, 12, 279–303. [Google Scholar] [CrossRef]
- Alyokhin, A.; Benkovskayab, G.; Udalovc, M. Colorado Potato Beetle. In Insect Pests of Potato, Global Perspectives on Biology and Management, 2nd ed.; Alyokhin, A., Rondon, S.I., Gao, Y., Eds.; Elsevier: London, UK, 2022; Volume 1, pp. 29–43. [Google Scholar]
- Alyokhin, A.; Baker, M.; Mota-Sanchez, D.; Dively, G.; Grafius, E. Colorado Potato Beetle resistance to insecticides. Am. J. Potato Res. 2008, 85, 395–413. [Google Scholar] [CrossRef]
- Zhu, F.; Moural, T.W.; Nelson, D.R.; Palli, S.R. A specialist herbivore pest adaptation to xenobiotics through up-regulation of multiple Cytochrome P450s. Sci. Rep. 2016, 6, 20421. [Google Scholar] [CrossRef]
- Casagrande, R.A. The Colorado Potato Beetle: 125 years of mismanagement. Bull. Entomol. Soc. Am. 1987, 33, 142–150. [Google Scholar] [CrossRef]
- Wang, K.; Peng, Y.; Fu, W.; Shen, Z.; Han, Z. Key factors determining variations in RNA interference efficacy mediated by different double-stranded RNA lengths in Tribolium castaneum. Insect Mol. Biol. 2019, 28, 235–245. [Google Scholar] [CrossRef]
- Pallis, S.; Alyokhin, A.; Manley, B.; Rodrigues, T.; Barnes, E.; Narva, K. Effects of low doses of a novel dsRNA-based biopesticide (Calantha) on the Colorado Potato Beetle. J. Econ. Entomol. 2023, 116, 456–461. [Google Scholar] [CrossRef]
- Pallis, S.; Alyokhin, A.; Manley, B.; Rodrigues, T.B.; Barnes, E.; Narva, K. Baseline susceptibility to a novel dsrna-based insecticide across US populations of Colorado Potato Beetle. Agriculture 2023, 13, 2283. [Google Scholar] [CrossRef]
- McHardy, S.F.; Wang, H.-Y.L.; McCowen, S.V.; Valdez, M.C. Recent advances in acetylcholinesterase Inhibitors and Reactivators: An update on the patent literature (2012–2015). Expert Opin. Ther. Pat. 2017, 27, 455–476. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.H.; Lee, S.H. Which acetylcholinesterase functions as the main catalytic enzyme in the Class Insecta? Insect Biochem. Mol. Biol. 2013, 43, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.-W.; Kim, S.-S.; Shin, S.W.; Kim, W.T.; Boo, K.S. Molecular characterization of two acetylcholinesterase genes from the oriental tobacco budworm, Helicoverpa assulta (Guenee). Biochim. Biophys. Acta-Gen. Subj. 2006, 1760, 125–133. [Google Scholar] [CrossRef]
- Lu, Y.; Park, Y.; Gao, X.; Zhang, X.; Yao, J.; Pang, Y.-P.; Jiang, H.; Zhu, K.Y. Cholinergic and non-cholinergic functions of two acetylcholinesterase genes revealed by gene-silencing in Tribolium castaneum. Nature 2012, 2, 288. [Google Scholar] [CrossRef]
- Weill, M.; Fort, P.; Berthomieu, A.; Dubois, M.P.; Pasteur, N.; Raymond, M. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is non-homologous to the ace gene in Drosophila. Proc. R. Soc. London. Ser. B Biol. Sci. 2002, 269, 2007–2016. [Google Scholar] [CrossRef]
- Fournier, D.; Bergé, J.-B.; de Almeida, M.-L.C.; Bordier, C. Acetylcholinesterases from Musca domestica and Drosophila melanogaster Brain are linked to membranes by a glycophospholipid anchor sensitive to an endogenous phospholipase. J. Neurochem. 1988, 50, 1158–1163. [Google Scholar] [CrossRef]
- Yoon, K.A.; Kim, J.H.; Nauen, R.; Alyokhin, A.; Clark, J.M.; Lee, S.H. Characterization of molecular and kinetic properties of two acetylcholinesterases from the Colorado potato beetle, Leptinotarsa decemlineata. Pestic. Biochem. Physiol. 2022, 185, 105137. [Google Scholar] [CrossRef]
- Zhang, J.; Khan, S.A.; Heckel, D.G.; Bock, R. Next-generation insect-resistant plants: RNAi-mediated crop protection. Trends Biotechnol. 2017, 35, 871–882. [Google Scholar] [CrossRef]
- Bolognesi, R.; Ramaseshadri, P.; Anderson, J.; Bachman, P.; Clinton, W.; Flannagan, R.; Ilagan, O.; Lawrence, C.; Levine, S.; Moar, W.; et al. Characterizing the mechanism of action of double-stranded RNA activity against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte). PLoS ONE 2012, 7, e47534. [Google Scholar] [CrossRef]
- Li, H.; Khajuria, C.; Rangasamy, M.; Gandra, P.; Fitter, M.; Geng, C.; Woosely, A.; Hasler, J.; Schulenberg, G.; Worden, S.; et al. Long dsRNA but not siRNA initiates RNAi in western corn rootworm larvae and adults. J. Appl. Entomol. 2015, 139, 432–445. [Google Scholar] [CrossRef]
- Romeis, J.; Widmer, F. Assessing the risks of topically applied dsRNA-based products to non-target arthropods. Front. Plant Sci. 2020, 11, 679. [Google Scholar] [CrossRef] [PubMed]
- Shukla, J.N.; Kalsi, M.; Sethi, A.; Narva, K.E.; Fishilevich, E.; Singh, S.; Mogilicherla, K.; Palli, S.R. Reduced stability and intracellular transport of dsRNA contribute to poor RNAi response in lepidopteran insects. RNA Biol. 2016, 13, 656–669. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Peng, Y.; Pu, J.; Fu, W.; Wang, J.; Han, Z. Variation in RNAi efficacy among insect species is attributable to dsRNA degradation in vivo. Insect Biochem. Mol. Biol. 2016, 77, 1–9. [Google Scholar] [CrossRef]
- Allen, M.L.; Walker, W.B. Saliva of Lygus lineolaris digests double stranded ribonucleic acids. J. Insect Physiol. 2012, 58, 391–396. [Google Scholar] [CrossRef]
- Abbasi, R.; Heschuk, D.; Kim, B.; Whyard, S. A novel paperclip double-stranded RNA structure demonstrates clathrin-independent uptake in the mosquito Aedes aegypti. Insect Biochem. Mol. Biol. 2020, 127, 103492. [Google Scholar] [CrossRef]
- Vermeulen, A.; Behlen, L.; Reynolds, A.; Wolfson, A.; Marshall, W.S.; Karpilow, J.; Khvorova, A. The contributions of dsRNA structure to Dicer specificity and efficiency. RNA 2005, 11, 674–682. [Google Scholar] [CrossRef]
- MacRae, I.J.; Zhou, K.; Doudna, J.A. Structural determinants of RNA recognition and cleavage by Dicer. Nat. Struct. Mol. Biol. 2007, 14, 934–940. [Google Scholar] [CrossRef]
- Jin, S.; Singh, N.D.; Li, L.; Zhang, X.; Daniell, H. Engineered chloroplast dsRNA silences cytochrome p450 monooxygenase, V-ATPase and chitin synthase genes in the insect gut and disrupts Helicoverpa armigera larval development and pupation. Plant Biotechnol. J. 2015, 13, 435–446. [Google Scholar] [CrossRef]
- Whyard, S.; Singh, A.D.; Wong, S. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem. Mol. Biol. 2009, 39, 824–832. [Google Scholar] [CrossRef]
- Huvenne, H.; Smagghe, G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: A review. J. Insect Physiol. 2010, 56, 227–235. [Google Scholar] [CrossRef]
- Kumar, P.; Pandit, S.S.; Baldwin, I.T. Tobacco Rattle Virus Vector: A rapid and transient means of silencing Manduca sexta genes by plant mediated RNA interference. PLoS ONE 2012, 7, e31347. [Google Scholar] [CrossRef]




| Gene | Length (bp) | Production | Amount | mRNA Reduction | Effects | Reference |
|---|---|---|---|---|---|---|
| Sec23 | 1506 | In vitro synthesis | 50 µg | 83% | Mortality and reduced weight gain. | [22] |
| ATPase E | 469 | 93% | ||||
| ATPase B | 530 | 93% | ||||
| COPβ | 228 | 79% | ||||
| β-Actin | 279 | Modified plants | 50 µg | — | Mortality and reduced growth. | [22,24] |
| 201 | — | 61% | ||||
| FTZ-F1 | 319 | Bacterial production | 0.5 µg∙µL−1 | 70.2% | Failure of ecdysis and mortality. | [44] |
| Prohibitin-1 | 350 | In vitro synthesis | 10 µg | 90% | Mortality and reduced growth. | [45] |
| Shd | 438 | Bacterial production | — | 46.8% | Mortality and reduced weight. | [46] |
| SAHase | 521 | Bacterial production | — | 84% | Decreased larval weight, failed pre-pupation, reduced larval development time, and mortality. | [47] |
| Ran | 361 | Bacterial production | 0.5 µg∙mL−1 | ~90% | Weight reduction and mortality. | [48] |
| NAT1 | 357 | Bacterial production | 0.5 µg∙mL−1 | ~90% | Delayed larval growth and impaired pupation. | [49] |
| HR3 | 141 | Bacterial production | 0.05 µg∙µL−1 | ~70% | Pupation failure, cuticle defects, and mortality. | [50] |
| JHEH | 284–316 | Bacterial production | 0.05 µg∙µL−1 | 94.5% | Slightly reduced larval weight and delayed larval development with impaired adult emergence. | [51] |
| alt 1 | 398 | Bacterial production | 0.5 µg∙µL−1 | 79.5% | Flight impairment and mortality. | [52] |
| alt 2 | 392 | 71.1% | ||||
| p5cdh1 | 490 | Bacterial production | 0.5 µg∙µL−1 | ~60% | Reduced ATP content, flight impairment, and mortality. | [53] |
| p5cdh2 | 473 | ~70% | ||||
| UAP1 | 367 | Bacterial production | 0.5 µg∙mL−1 | ~70% | Impaired molting and mortality. | [54] |
| UAP2 | 331 | |||||
| ChSA (a,b) | ~300 | Bacterial production | 0.5 µg∙mL−1 | ~80% | Failure of ecdysis, emergence, decreased chitin content, and delayed larval growth. | [55] |
| ChSB | ~500 | |||||
| TPS | 325/500 | Bacterial production | 0.5 µg∙µL−1 | - | Mortality, with surviving larvae showing greater body mass, glycogen, lipids, and proline but reduced chitin content. | [56] |
| TRE | 426/414 | |||||
| E75A, B and C | ~300 | Bacterial production | 0.5 µg∙µL−1 | ~80% | Average pupal weight with pupation arrest. | [57] |
| Mesh | 417 | In vitro synthesis | 0.5 µg∙µL−1 | 71% | Mortality and lower adult emergence rate. | [58] |
| JHAMT1 | 261 | Bacterial production | 0.05 µg∙µL−1 | 98.3% | Death of larvae, weight loss, shortened larval development period, and impaired pupation. | [59] |
| JHAMT2 | 332 | 93.2% | ||||
| ILP1 | 201 | Bacterial production | 0.05 µg∙µL−1 | 80% | Impaired molting. | [60] |
| ILP2 | 179 | |||||
| HR4 | 337 | Bacterial production | 0.5 µg∙mL−1 | 80% | Failure in pupation and mortality. | [61] |
| CncC | — | In vitro synthesis | 5 µg∙µL−1 | ~80% | Decreased expression of ABC transporters, which reduces resistance to imidacloprid. | [62] |
| EcR | 445 bp | Transgenic plants | — | ~55% | Mortality and reduction in larval weight. | [63] |
| Tai | — | Bacterial production | 0.5 µg∙mL−1 | 80% | Pupation failure, cuticle defects, and mortality. | [64] |
| Length (bp) | Sequence (5′—3′) |
|---|---|
| First amplicon | |
| 222 | Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′ |
| Rv—5′TCTCTCCTGGTGAAGTCGCGTT3′ | |
| 543 | Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′ |
| Rv—5′CTCGGCTTCGGCACCACCACGT3′ | |
| 670 | Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′ |
| Rv —5′CTGCATCGACACCAGAATGATA3′ | |
| 870 | Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′ |
| Rv—5′GATAGCGGCGAGAAGAGGTGAA3′ | |
| Second amplicon | |
| 222 | Fw—5′GGGAGCGACGATGACAACAACG3′ |
| Rv—5′TAATACGACTCACTATAGGTCTCTCCTGGTGAAGTCGCGTT3′ | |
| 543 | Fw—5′GGGAGCGACGATGACAACAACG3′ |
| Rv—5′TAATACGACTCACTATAGGCTCGGCTTCGGCACCACCACGT3′ | |
| 670 | Fw—5′GGGAGCGACGATGACAACAACG3′ |
| Rv—5′TAATACGACTCACTATAGGCTGCATCGACACCAGAATGATA3′ | |
| 870 | Fw—5′GGGAGCGACGATGACAACAACG3′ |
| Rv—5′TAATACGACTCACTATAGGGATAGCGGCGAGAAGAGGTGAA3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Julian-Chávez, B.; Siqueiros-Cendón, T.S.; Torres-Castillo, J.A.; Sinagawa-García, S.R.; Abraham-Juárez, M.J.; González-Barriga, C.D.; Rascón-Cruz, Q.; Siañez-Estrada, L.I.; Arévalo-Gallegos, S.; Espinoza-Sánchez, E.A. Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata. Insects 2024, 15, 1000. https://doi.org/10.3390/insects15121000
Julian-Chávez B, Siqueiros-Cendón TS, Torres-Castillo JA, Sinagawa-García SR, Abraham-Juárez MJ, González-Barriga CD, Rascón-Cruz Q, Siañez-Estrada LI, Arévalo-Gallegos S, Espinoza-Sánchez EA. Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata. Insects. 2024; 15(12):1000. https://doi.org/10.3390/insects15121000
Chicago/Turabian StyleJulian-Chávez, Brenda, Tania S. Siqueiros-Cendón, Jorge Ariel Torres-Castillo, Sugey Ramona Sinagawa-García, María Jazmín Abraham-Juárez, Carmen Daniela González-Barriga, Quintín Rascón-Cruz, Luis Ignacio Siañez-Estrada, Sigifredo Arévalo-Gallegos, and Edward Alexander Espinoza-Sánchez. 2024. "Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata" Insects 15, no. 12: 1000. https://doi.org/10.3390/insects15121000
APA StyleJulian-Chávez, B., Siqueiros-Cendón, T. S., Torres-Castillo, J. A., Sinagawa-García, S. R., Abraham-Juárez, M. J., González-Barriga, C. D., Rascón-Cruz, Q., Siañez-Estrada, L. I., Arévalo-Gallegos, S., & Espinoza-Sánchez, E. A. (2024). Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata. Insects, 15(12), 1000. https://doi.org/10.3390/insects15121000

