Next Article in Journal
Spodoptera frugiperda (Lepidoptera: Noctuidae) Life Table Comparisons and Gut Microbiome Analysis Reared on Corn Varieties
Next Article in Special Issue
Mechanisms of Neuroendocrine Stress Response in Drosophila and Its Effect on Carbohydrate and Lipid Metabolism
Previous Article in Journal
Quantitative Effects of Temperature and Exposure Duration on the Occurrence and Repair of Indirect Chilling Injury in the Fall Armyworm Spodoptera frugiperda
Previous Article in Special Issue
Hemolymph Metabolism Analysis of Honey Bee (Apis mellifera L.) Response to Different Bee Pollens
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Wolbachia Effect on Drosophila melanogaster Lipid and Carbohydrate Metabolism

by
Evgenia K. Karpova
*,
Margarita A. Bobrovskikh
,
Maksim A. Deryuzhenko
,
Olga D. Shishkina
and
Nataly E. Gruntenko
Institute of Cytology and Genetics SB RAS, 630090 Novosibirsk, Russia
*
Author to whom correspondence should be addressed.
Insects 2023, 14(4), 357; https://doi.org/10.3390/insects14040357
Submission received: 7 March 2023 / Accepted: 31 March 2023 / Published: 3 April 2023
(This article belongs to the Special Issue Insect Hormones, Metabolism, Immunity and Development)

Simple Summary

A study to investigate the effect that different Wolbachia pipientis strains have on the carbohydrate and lipid metabolism, starvation resistance and feeding behavior of Drosophila melanogaster females has been performed. The data obtained demonstrate that Wolbachia most likely change their hosts’ metabolism in different aspects, including the effect on energy metabolism, fitness and behavior, to ensure the host’s competitive advantage over uninfected insects, which contributes to the spread of the bacteria in the population.

Abstract

The effect of maternally inherited endosymbiotic bacteria Wolbachia on triglyceride and carbohydrate metabolism, starvation resistance and feeding behavior of Drosophila melanogaster females was studied. Eight D. melanogaster lines of the same nuclear background were investigated; one had no infection and served as the control, and seven others were infected with different Wolbachia strains pertaining to wMel and wMelCS groups of genotypes. Most of the infected lines had a higher overall lipid content and triglyceride level than the control line and their expression of the bmm gene regulating triglyceride catabolism was reduced. The glucose content was higher in the infected lines compared to that in the control, while their trehalose levels were similar. It was also found that the Wolbachia infection reduced the level of tps1 gene expression (coding for enzyme for trehalose synthesis from glucose) and had no effect on treh gene expression (coding for trehalose degradation enzyme). The infected lines exhibited lower appetite but higher survival under starvation compared to the control. The data obtained may indicate that Wolbachia foster their hosts’ energy exchange through increasing its lipid storage and glucose content to ensure the host’s competitive advantage over uninfected individuals. The scheme of carbohydrate and lipid metabolism regulation under Wolbachia’s influence was suggested.

1. Introduction

Intracellular bacteria Wolbachia pipientis are the most wide-spread prokaryotic symbiont in invertebrates. Being maternally inherited, they can control the biological, morphological and behavioral features of their hosts. Thus, Wolbachia-caused fertility disorders such as cytoplasmic incompatibility, feminization, induced parthenogenesis and male-killing have been described in different insect species [1]. At the same time, infected hosts have been known to obtain a competitive advantage over uninfected individuals [2]. Today, more than 470 different strains of Wolbachia have been described [3] that are divided into 17 possible phylogenetic supergroups [4]. Some of these strains have been shown to provide their hosts with important cofactors [5,6,7], improving the host’s fertility [8,9,10,11] and protecting it from lethal RNA viruses [12,13,14,15,16]. However, if Wolbachia’s parasitic effects modulating the host’s fertility and hence increasing the bacteria’s spread in insect population have been sufficiently described, Wolbachia’s effect on their host’s survivability remains understudied.
In all living beings, carbohydrates, proteins and lipids are the three main energy sources to sustain their vital function. Among them, lipids are the main way to store energy [17]. They also play a crucial role in many cell functions such as membrane formation, energy generation, intra-and intercellular signal transmission and cell death regulation [17]. Carbohydrates are another necessity for every living organism and are essential for growth, fertility and vitality. Two main carbohydrates circulating in D. melanogaster hemolymph are glucose and trehalose [18]. Trehalose is the most widespread carbohydrate circulating in insects [18]. It is a disaccharide consisting of two α-glucose molecules linked in a 1,1-glycosidic bond. An insect receives glucose with food, while trehalose is synthesized in its fat body and circulates in the hemolymph to be consumed by the insect’s muscle tissues [19]. While glucose’s function is conservative, and it serves as the primary source of energy in both flies and mammals, trehalose is the main source of energy insects use to fly. The genetic control of carbohydrate and lipid metabolism is a complex issue; however, in D. melanogaster several key genes participating in it have been identified. Thus, the tps1 gene encodes trehalose-6-phosphate synthase converting glucose into trehalose, and the treh gene encodes trehalase, launching the reverse conversion. Insulin/insulin-like growth factor signaling (IIS) pathway also plays an important role in the control. In Drosophila, there is only one receptor; the gene (dInR) expression of which responds not only to feeding changes, but also to different adverse factors such as oxidative and heat stress [20,21]. As for lipid storage and triglyceride (TAG) homeostasis, in Drosophila they are controlled by the bmm gene, which encodes the lipid storage droplet-associated TAG lipase Brummer, a homolog of human adipocyte triglyceride lipase [22].
Recent studies have demonstrated that Wolbachia can affect the energy metabolism of their host and depend on glycolytic intermediates for energy supply [23]. Specifically, the bacteria seem to have to depend on intermediate carbohydrates to produce ATP and modulate the host’s metabolism in a way to obtain these molecules. Since Wolbachia are maternally inherited, this modulation probably starts during embryogenesis and continues throughout the host’s life [24]. Ponton et al. [25] demonstrated that Wolbachia changed the protein/carbohydrate ratio throughout D. melanogaster’s life. As a result, both infected and uninfected flies fed with proteins and carbohydrates in proportion 1:16 lived longer (pairwise comparisons, p = 0.125, median lifespan (mean ± s.e.): Wolbachia-infected = 27.1 ± 0.6 days, non-infected = 24.2 ± 0.6 days) than those fed in proportion 1:1; however, the latter, if uninfected, lived longer than infected ones (pairwise comparisons, p < 0.001, median lifespan (mean ± s.e.): Wolbachia-infected = 7.6 ± 0.6 days, non-infected = 8.2 ± 0.7 days) [25]. This phenomenon can probably be explained by a competition for carbohydrates between Wolbachia and the host, which results in a decrease in the lifespan of infected flies under carbohydrate deficiency conditions.
To study the effect different Wolbachia genotypes have on D. melanogaster survivability, eight conplastic lines bearing isogenic wild type Bi90 line’s nuclear background and infected with different wMel and wMelCS Wolbachia genotypes were bred and characterized for their effect on D. melanogaster dopamine metabolism [26,27]. Here we investigate the effect these Wolbachia strains have on the carbohydrate and lipid metabolism and feeding behavior in D. melanogaster females. We believe this study will help clarify the physiological mechanisms underlying Wolbachia’s effect on host adaptation.

2. Materials and Methods

2.1. Drosophila Lines

To examine Wolbachia’s effect on D. melanogaster metabolism, eight lines with the nuclear background of wild type line Bi90 and different cytoplasmic backgrounds were used. Bi90 line was established from a wild-caught female of the Bishkek (Kyrgyzstan) population and interbred for more than 300 generations; thereby, it could be considered a nearly isogenic line. It was originally infected with wMel genotype of Wolbachia. One pair of flies from line Bi90 was isolated to create a branch, which was then treated with tetracycline for three generations to make Wolbachia-free line Bi90T. The six D. melanogaster conplastic lines carrying the nuclear background of Bi90 line and cytoplasm with different types of Wolbachia infection were created (Table 1) by 20 successive backcrosses of Bi90T males with the appropriate source of Wolbachia, as described in [26,27]. Wolbachia donor lines were isolated from nature, maintained in the laboratory and characterized for infection [28,29,30]. Wolbachia infection status was regularly verified using PCR with primers specific to Wolbachia: the 81F/691R set for the wsp gene [31] and 99F/994R for the 16SrRNA gene [32]. The uninfected Bi90T line was used as a control.
All lines were kept on standard Drosophila medium (agar–agar, 7 g L−1; corn grits, 50 g L−1; dry yeast, 18 g L−1; sugar, 40 g L−1) at 25 °C and relative humidity 50% under a 12 h:12 h light:dark cycle. Imagoes were synchronized at eclosion (flies were collected every 3–4 h). All the experiments were carried out on 6-day-old females.

2.2. Body Mass and TAG Content Measurements

For body mass evaluation, females from the control and experimental groups (10 flies per group, 1 fly at a time) were weighed using precision scales (Ohaus Corp. Pine Brook, Parsippany-Troy Hills, NJ, USA). TAG content was measured using Mukherjee and Mishra’s spectrophotometric assay [33]. Flies were grouped by 10 individuals to obtain a sufficient amount of TAGs per sample (3 samples were measured for each group under study). Flies were decapitated to avoid the effect of red pigment on the spectrophotometry, homogenized in 100 µL of a cooled PBST (0.2% Tween-20 (Medigen, Novosibirsk, Russia) в 1X PBS, (Invitrogen Corporation, Waltham, MA, USA)) and centrifuged for 5 min at 3075× g. Supernatant was transferred into a microcentrifuge tube, which was then heated at 70 °C for 10 min. Next, 20 μL of PBST or 20 μL of Triglyceride reagent (Sigma-T2449, St. Louis, MO, USA) was added to 20 μL of supernatant, PBST blank or glycerol standard. The tubes were incubated at 37 °C for 1 h and then centrifuged at 17.709× g for 3 min. A total of 30 μL from each tube were taken to a 96-well plate, 100 μL Free glycerol reagent (Sigma-F6428, St. Louis, MO, USA) was added to each well, and the plate was incubated at 37 °C for 5 min. The absorbance was measured at the wavelength of 540 nm using a Multiscan SkyHigh spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). To evaluate the TAG concentration, the absorbance of free glycerol in the untreated sample without Triglyceride reagent was subtracted from the concentration of total glycerol of samples treated with Triglyceride reagent.

2.3. Colorimetric Method for Quantitative Determination of Total Lipid Content Using Sulfophosphovaniline (SPV) Reaction

Total lipid content was evaluated using modified Van Handel’s method [34]. For each experimental group, 9 to 14 flies were homogenized separately in 100 µL of a cooled mixture of chloroform–methanol (v/v) per fly. A total of 50 µL of the supernatant was shaken for 10 min, transferred into a clean test tube and heated at 90 °C in an M-208 microthermostat (Bis-N, Novosibirsk, Russia) until complete evaporation of the solvent. Next, 10 µL of H2SO4 was added to the samples, they were heated at the same temperature for 2 more min and then cooled on ice. Phosphovanillin reagent was added to the samples to a total volume of 1 mL and they were incubated at room temperature in the dark until a pink color appeared. The samples were then analyzed at a wavelength of 525 nm against a “blank” sample containing only Phosphovaniline reagent with the use of Smart Spec Plus spectrophotometer (Bio-Rad, Philadelphia, PA, USA).

2.4. Spectrophotometric Method of Evaluation of Carbohydrates Metabolism

The glucose titer in D. melanogaster females was evaluated with the use of a Glucose (HK) Assay Kit (Lot #SLBL3912V; Sigma-Aldrich, St. Louis, MO, USA) using the spectrophotometric method of Musselman et al. [35] with adjustments. Flies were decapitated to eliminate eye pigment, homogenized in a hypotonic lysing buffer (20 mM HEPES, 2 mM MgCl2, 2 mM EGTA) and then placed into a cooled microcentrifuge tubes. After 10 min of incubation, samples were centrifuged at 13,400× g for 5 min and titers of metabolites were determined in supernatant. To evaluate trehalose titer, it was converted into glucose by adding trehalase (Sigma-Aldrich; 0.5 U/mL) with a further measurement of glucose concentration. The samples were analyzed at a wavelength of 340 nm with the use of a Smart Spec Plus spectrophotometer (Bio-Rad, Philadelphia, PA, USA). Each experiment was performed with three biological replicates.

2.5. Quantitative Real-Time PCR (qPCR)

The relative mRNA amount was evaluated using qRT-PCR. The total RNA was extracted from whole bodies of 6-day-old D. melanogaster females (25 flies per sample for every biological replicate) using TRI reagent (Lot #BCBT8883, Sigma-Aldrich, St. Louis, MO, USA). The remaining genomic DNA was removed from the samples by processing them with DNase I (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instructions. The complementary DNA was synthesized from 1 µg of total RNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Vilnius, Lithuania, USA) with an oligo(dT)18 primer as per the manufacturer’s protocol. Primers were synthesized by Biolabmix (Novosibirsk, Russia).
qRT-PCR was carried out in a reaction mixture of 20 µL in the presence of SYBR-Green I (Syntol, Moscow, Russia) in a CFX96 Real Time System amplifier (Bio-Rad, Hercules, California, USA) under the following conditions: initial 3 min denaturation at 95 °C followed by 45-cycle amplification, each cycle took 15 s at 95 °C; 15 s annealing at 56–62 °C (depending on primers in use); cyclic amplification followed by 5 s elongation at 78 °C; the melting curve covered a temperature range from 65 to 95 °C. The relative mRNA amount to determine the expression levels of the tps1 (F: CGTGTGACATCGTCGGATATT, R: AGTGTCGTTCCACCCATTTC), treh (F: GAAAATGCTGTCTCTCTCGCTC, R: ATTCCTGGCGGTGCTGTA), bmm (F: AATGGCGTCGAATCAGACTT, R: AACACAGATGGGGATTTGGA) and dInR (F: AAGCGTGGGAAAATTAAGATGGA, R: GGCTGTCAACTGCTTCTACTG) genes was calculated by applying the comparative Ct method [36] using Actin 5C (F: GCGCCCTTACTCTTTCACCA, R: ATGTCACGGACGATTTCACG) and β-Tubulin (F: TGTCGCGTGTGAAACACTTC, R: AGCAGGCGTTTCCAATCTG) as reference genes regularly expressed in 6-day-old females infected with different Wolbachia strains. Each reaction was performed in triplicate with three biological replicates.

2.6. Capillary Feeding Assay

The food consumption was evaluated as in Williams et al. [37]. A total of 5 mated 6-day-old females of each D. melanogaster line under study were placed in a vial, 10 cm × 2 cm (height × diameter), which contained 1% agarose (5 cm high) providing moisture and humidity for the flies during the experiment. A capillary glass tube (10 × 80 mm) was filled with 15 μL of liquid food (5% sucrose, 5% yeast extract, 90% water) and was put in a vial stopper using two pipet tips (plugged into one another). The initial food level in the capillary tube was marked and 0.1 μL of mineral oil was applied over the liquid food to prevent its evaporation. The vials were kept in a 25 °C incubator for 24 h, and then the total food intake per day was evaluated by marking the final food level in the capillary tube. The “blank” vial without flies was used to detect the rate of food evaporation. The average food consumption was calculated by dividing the total food intake (minus the “blank” value) by the number of flies in the vial (5 vials for each line). Each experiment was performed with four biological replicates.

2.7. Starvation Resistance Analysis

For starvation resistance analysis, 5 6-day-old females were placed into a vial (10 vials per group) with pure sugar medium (20 g of agar and 4 g of sucrose per 1 L of water) and then were transferred to vials with fresh medium daily. The daily survival rate (DSR) was calculated every day as a proportion of flies alive per day to a total number of flies enlisted in the experimental group initially.

2.8. Statistical Analysis

Data were analyzed via the Kruskal–Wallis ANOVA (with infection as the between-subjects factor). The data on starvation resistance were analyzed via one-way ANOVA (infection as a factor). Differences between groups were assessed using Dunn’s post hoc, in which p ≤ 0.001 was considered highly significant and p ≤ 0.05 was considered significant.

3. Results

3.1. Lipid Content

The total lipid content was investigated in uninfected flies and the flies infected with Wolbachia of wMel (wMel and wMel4) and wMelCS (wMelPlus, wMelCS2, wMelCS45, wMelCS112 and wMelCS128) genotypes as it was shown earlier that one of the strains from wMelCS group, wMelPlus, had a positive effect on the host’s heat stress tolerance [27]. It was found that the lipid content was higher in the infected lines compared to that of the control (Figure 1a, infection—H(7.67) = 71.7, p = 6.69 × 10−13). For lines Bi90wMel, Bi90wMelCS2, Bi90wMel4 and Bi90wMelCS112, the statistical difference with the control was significant at p < 0.001; for Bi90wMelPlus, p < 0.01. Evidently, Wolbachia facilitated the increase in the lipid stores of the host.
The weights measured in lines Bi90wMel, Bi90wMel4, Bi90wMelPlus, Bi90wMelCS2, Bi90wMelCS45, Bi90wMelCS112 and Bi90wMelCS128 (Figure 1b) were matched against the lipid contents obtained for these lines and were higher than in the control (H(7.67) = 71.7, p = 6.69 × 10−13). For line Bi90wMelCS112, the statistical difference with the control was significant at p < 0.001; for Bi90wMel, Bi90wMelPlus and Bi90wMelCS2, p < 0.01, and for Bi90wMel4 differences were on the verge of significance (p = 0.089).
At the same time, the total lipid content and weight of the flies of Bi90wMelCS45 and Bi90wMelCS128 lines did not differ from the control Bi90T ones.
The obtained results enabled us to choose three Wolbachia strains (wMel, wMelPlus and wMelCS45) that had the most contrasting effects on their host’s lipid content for further analysis.
First, the amount of TAGs [38], the main storage fraction of lipids in Drosophila, was measured in the control and the three infected lines (Figure 2). The measurement results demonstrated that TAG content was statistically higher in all studied infected lines compared to the control (infection—H(4.30) = 37.44, p = 3.86 × 10−6) including line Bi90wMelCS45, which did not differ from the control in total lipid content and weight. The statistical difference with the control was significant at p < 0.001 for Bi90wMel; it was at p < 0.01 for Bi90wMel45 and Bi90wMelPlus. This allowed us to assume that any Wolbachia strain might have an effect on its host’s energy metabolism.
To test this assumption, we examined the carbohydrate content in the same three infected lines, since carbohydrates, like lipids, are essential for proper energy exchange.

3.2. Carbohydrate Content

The content of two main insect carbohydrates, trehalose and glucose, was measured in females of the infected lines Bi90wMel, Bi90wMel45 and Bi90wMelPlus and compared to that of the control line Bi90T. The results are presented in Figure 3.
The measurement results showed increased glucose content, as well as TAG content, in all infected lines regardless of Wolbachia genotype if compared to the control (Figure 3a, H(3.30) = 27.22, p = 1.79 × 10−5). Notably, the trehalose level remained unchanged in all infected lines (Figure 3b, H(3.44) = 2.861, p = 0.4136).

3.3. Evaluation of the Effect the Wolbachia Infection Had on the Expression of Key Genes for Carbohydrate and Lipid Metabolism Using Quantitative Real-Time PCR

In the search for mechanism providing the changes in carbohydrates’ and TAG contents that we found, we performed qRT-PCR analysis of expression of several genes involved in carbohydrate and lipid metabolism. We demonstrated that any Wolbachia strain reduced the expression of the tps1 gene (coding for an enzyme for trehalose synthesis from glucose) but did not affect the expression of the treh gene (coding for an enzyme that degrades trehalose to produce glucose) in all infected lines (Figure 4a, infection—H(3.8) = 9.435, p = 0.02 for tps1; and Figure 4b, infection—H(3.8) = 0.598, p = 0.47 for treh). The activity of the bmm gene encoding for the homolog of human adipocyte triglyceride lipase and playing a key role in regulation of lipid metabolism in D. melanogaster was demonstrated to be reduced in all infected lines (Figure 4c, infection—H(3.8) = 9.154, p = 0.02).
To estimate IIS condition in the infected flies, the level of dInR expression was measured, and the results demonstrated that none of the endosymbiont strains under study affected it (Figure 4d, infection—H(3.8) = 1.932, p = 0.58).

3.4. Feeding Behavior and Starvation Resistance

Based on the detected changes in carbohydrate and lipid contents in the Wolbachia-infected lines, an assumption was made that differences would also be seen in the flies’ feeding behavior. To clarify this issue, the effect of wMel, wMelPlus and wMelCS45 strains on D. melanogaster feeding behavior was estimated. For this purpose, the intensity of 24 h capillary feeding of 6-day-old females was assessed (Figure 5). The measurements demonstrated a statistically significant decrease in the food consumption in all the infected lines compared to the control (infection—H(5.54) = 12.56, p = 0.02), which was a highly unexpected result.
However, in spite of the decreased appetite of the females infected with wMelPlus Wolbachia strain, their survival under starvation turned out to be higher than that of the females of uninfected Bi90T control line (Figure 6).

4. Discussion

The performed investigation demonstrated that Wolbachia stimulated carbohydrate metabolism in D. melanogaster, which was confirmed by a higher level of glucose in the infected lines than in the control. Since it became an intercellular endosymbiont, Wolbachia have lost many of their genes, including those responsible for metabolism [39]. Thus, it stands to reason that the bacteria rely on their host for providing components necessary for survival and reproduction. This idea has also been supported by other authors, e.g., Zhang et al. [40] found that the glucose level in Wolbachia-infected male flies significantly exceeded that in non-infected ones. Using comparative metabolomics analysis, they also discovered that the transcription level of the glycolysis-related genes such as Gapdh (coding for the glyceraldehyde-3-phosphate dehydrogenase) and Adh (coding for the alcohol dehydrogenase) turned out to be significantly higher due to Wolbachia infection. Their study also demonstrated a significant reduction of glycogen (main storage sugar) content in Wolbachia-infected D. melanogaster males compared to an uninfected control. The increased glucose content found in our study probably occurred for the same reason. Increased levels of glucose-6-phosphate have also been described in Wolbachia-infected mosquitoes A. fluviatilis [41].
In the case of trehalose, no Wolbachia-related effect was found, and the level of this carbohydrate was similar in both infected and uninfected flies, which was probably due to glucose regulation being more dynamic compared to trehalose. That had been demonstrated earlier for D. melanogaster larvae [42]. Ugrankar et al. [43] also demonstrated that in different physiological conditions, including breeding in crowded conditions, in larvae, the level of circulating glucose, but not of trehalose, was regulated. In D. melanogaster, trehalose is synthesized in its fat body from glucose through the catalytic activity of the Tps1 protein [44], and losing Tps1 results in trehalose deficiency in animals [45]. Trehalose-deficient larvae are sensitive to nutrient shortage and quickly die during starvation [44]. The trehalase encoding by treh gene catalyzes trehalose hydrolysis to produce glucose and Treh’s inactivation prevents trehalose catabolism, significantly increasing its content in hemolymph [44]. The data obtained in our study demonstrate that Wolbachia reduced tps1 gene expression and had no effect on the treh gene, which is probably why the trehalose level remained the same at the high levels of glucose observed in the infected flies.
The detected effect Wolbachia had on the level of dInR expression corresponds with the unchanged trehalose level in the infected flies since IIS regulation of this carbohydrate has been found in D. melanogaster and Bombyx mori [46,47,48,49,50,51]. Thus, in B. mori the IIS affects trehalose homeostasis through the expression of the treh gene [47,48].
Wolbachia also do not have the key genes for lipid biosynthesis, so they probably rely on their host in this respect as well [52]. That is why the infection significantly increased lipid content in the studied infected lines, increasing the total lipid level and that of TAG, which corresponds to the data published by Zhang et al. [40] who demonstrated that Wolbachia-infected Drosophila males had higher levels of linolenoyl-CoA, palmitoleic and gamolenic acids involved in lipid metabolic pathway, TAGs and many other intermediate products of fatty acid metabolism compared to those of the control. In the experiments with A. aegypti artificially infected with wMel Wolbachia, reduced expression of the bmm gene, playing the key role in the Drosophila lipid metabolism regulation, was found in all the infected lines investigated [53]. Taken together, this implies that Wolbachia decreases lipolysis through the expression inhibition of certain genes, reducing the activity of the enzymes enabling TAG degradation. The scheme of a supposed Wolbachia effect on the regulation of carbohydrate and lipid metabolism in D. melanogaster is shown in Figure 7.
As lipids deposited into the oocytes significantly contribute to the whole body fat level, and oocytes are one of the main locations of Wolbachia in Drosophila’s tissues, further studies in this field may include an investigation of potential changes in oogenesis input in the obese phenotype of Wolbachia-infected flies.
Reduced appetite in the infected flies in our study came as a surprise since increased starvation resistance and glucose’s and TAGs’ levels allowed an assumption of an intensification of food intake. However, the data published on this subject are rather contradictory. Turley at al. [54] investigated the feeding behavior in the mosquito and found that transinfecting A. aegypti with Wolbachia strain wMelPop reduced the frequency and volume of blood consumption by females. The experiments performed by Zhang et al. [40] in D. melanogaster males demonstrated that the Wolbachia infection led to a significant increase in consumed food during 24 h after eclosion. He et al. [55] compared the feeding behavior of D. melanogaster females after coupling with Wolbachia-infected and uninfected males and observed that the females coupling with infected males had a higher feeding frequency if compared to those coupling with uninfected males. At the same time, the infection status of the females did not affect the feeding frequency, which implies the infected males could cause a significant reduction in the amount of food consumed by their females. This corresponds to our data, since the females used in our experiments coupled with the males of the same Wolbachia infection status. Possibly, the enhanced metabolism of infected insects enables them to reduce their need for nutrients for a while, whereas at other times, they can accumulate nutrients in double the amount, which increases the survivability of Wolbachia-infected insects under unfavorable environmental conditions. This suggestion allows one to explain the wide spread of Wolbachia in D. melanogaster populations despite the mild cytoplasmic incompatibility in this species [56]. Cytoplasmic incompatibility occurs when Wolbachia-infected males mate with uninfected females, which results in embryo death; this is considered one of the most significant mechanisms behind the spread of Wolbachia in host populations.

5. Conclusions

It can be assumed that in D. melanogaster, Wolbachia transform the host’s metabolism in different ways to affect the energy exchange and starvation resistance, providing the host with a competitive advantage which increases the infection’s spread in the population.

Author Contributions

Conceptualization, N.E.G.; methodology, E.K.K. and M.A.B.; validation, E.K.K. and M.A.B.; formal analysis, M.A.D.; investigation, E.K.K., M.A.B. and O.D.S.; data curation, N.E.G.; writing—original draft preparation, M.A.B., E.K.K. and M.A.D.; writing—review and editing, N.E.G.; visualization, M.A.D.; supervision, N.E.G.; project administration, N.E.G. and E.K.K.; funding acquisition, E.K.K. and M.A.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Russian Foundation for Basic Research #19-04-00458). The maintenance of experimental D. melanogaster strains was carried out in the Drosophila collection fund of the Institute of Cytology and Genetics SB RAS and was supported by BP #FWNR-2022-0019 of the Ministry of Science and Higher Education of the Russian Federation.

Data Availability Statement

The data is available within this article.

Acknowledgments

We thank Darya Kochetova for language editing.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Werren, J.H.; Baldo, L.; Clark, M.E. Wolbachia: Master manipulators of invertebrate biology. Nat. Rev. Microbiol. 2008, 6, 741–751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Burdina, E.V.; Gruntenko, N.E. Physiological Aspects of Wolbachia pipientis–Drosophila melanogaster Relationship. J. Evol. Biochem. Phys. 2022, 58, 303–317. [Google Scholar] [CrossRef] [Scilit]
  3. Baldo, J.V.; Schwartz, S.; Wilkins, D.; Dronkers, N.F. Role of frontal versus temporal cortex in verbal fluency as revealed by voxel-based lesion-symptom mapping. J. Int. Neuropsychol. Soc. 2006, 12, 896–900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Kaur, R.; Shropshire, J.D.; Cross, K.L.; Leigh, B.; Mansueto, A.J.; Stewart, V.; Bordenstein, S.R.; Bordenstein, S.R. Living in the endosymbiotic world of Wolbachia: A centennial review. Cell Host Microbe. 2021, 29, 879–893. [Google Scholar] [CrossRef] [Scilit]
  5. Ghedin, E.; Wang, S.; Spiro, D.; Caler, E.; Zhao, Q.; Crabtree, J.; Allen, J.E.; Delcher, A.L.; Guiliano, D.B.; Miranda-Saavedra, D.; et al. Draft genome of the filarial nematode parasite Brugia malayi. Science 2007, 317, 1756–1760. [Google Scholar] [CrossRef] [Scilit]
  6. Hosokawa, T.; Koga, R.; Kikuchi, Y.; Meng, X.-Y.; Fukatsu, T. Wolbachia as a bacteriocyte- associated nutritional mutualist. Proc. Natl. Acad. Sci. USA 2010, 107, 769–774. [Google Scholar] [CrossRef] [Scilit]
  7. Nikoh, N.; Hosokawa, T.; Moriyama, M.; Oshima, K.; Hattori, M.; Fukatsu, T. Evolutionary origin of insect-Wolbachia nutritional mutualism. Proc. Natl. Acad. Sci. USA 2014, 111, 10257–10262. [Google Scholar] [CrossRef] [Scilit]
  8. Dedeine, F.; Vavre, F.; Fleury, F.; Loppin, B.; Hochberg, M.E.; Bouletreau, M. Removing symbiotic Wolbachia bacteria specifically inhibits oogenesis in a parasitic wasp. Proc. Natl. Acas. Sci. USA 2001, 98, 6247–6252. [Google Scholar] [CrossRef] [Scilit]
  9. Landmann, F.; Voronin, D.; Sullivan, W.; Taylor, M.J. Anti-filarial activity of antibiotic therapy is due to extensive apoptosis after Wolbachia depletion from filarial nematodes. PLoS Pathog. 2011, 7, e1002351. [Google Scholar] [CrossRef] [Scilit]
  10. Starr, D.J.; Cline, T.W. A host parasite interaction rescues Drosophila oogenesis defects. Nature 2002, 418, 76–79. [Google Scholar] [CrossRef] [Scilit]
  11. Guo, Y.; Hoffmann, A.A.; Xu, X.Q.; Zhang, X.; Huang, H.J.; Ju, J.F.; Gong, J.T.; Hong, X.Y. Wolbachia-induced apoptosis associated with increased fecundity in Laodelphax striatellus (Hemiptera: Delphacidae). Insect Mol. Biol. 2018, 27, 796–807. [Google Scholar] [CrossRef] [Scilit]
  12. Chrostek, E.; Marialva, M.S.; Esteves, S.S.; Weinert, L.A.; Martinez, J.; Jiggins, F.M.; Teixeira, L. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: A phenotypic and phylogenomic analysis. PLoS Genet. 2013, 9, e1003896. [Google Scholar] [CrossRef] [Scilit]
  13. Hedges, L.M.; Brownlie, J.C.; O’Neill, S.L.; Johnson, K.N. Wolbachia and virus protection in insects. Science 2008, 322, 702. [Google Scholar] [CrossRef] [Scilit]
  14. Martinez, J.; Longdon, B.; Bauer, S.; Chan, Y.S.; Miller, W.J.; Bourtzis, K.; Teixeira, L.; Jiggins, F.M. Symbionts Commonly Provide Broad Spectrum Resistance to Viruses in Insects: A Comparative Analysis of Wolbachia Strains. PLoS Pathog. 2014, 10, e1004369. [Google Scholar] [CrossRef] [Scilit]
  15. Teixeira, L.; Ferreira, Á.; Ashburner, M. The Bacterial Symbiont Wolbachia Induces Resistance to RNA Viral Infections in Drosophila melanogaster. PLoS Biol. 2008, 6, e1000002. [Google Scholar] [CrossRef] [Scilit]
  16. Pimentel, A.C.; Cesar, C.S.; Martins, M.; Cogni, R. The Antiviral Effects of the Symbiont Bacteria Wolbachia in Insects. Front Immunol. 2021, 11, 626329. [Google Scholar] [CrossRef] [Scilit]
  17. Heier, C.; Kühnlein, R.P. Triacylglycerol Metabolism in Drosophila melanogaster. Genetics 2018, 210, 1163–1184. [Google Scholar] [CrossRef] [Scilit]
  18. Kim, S.K.; Rulifson, E.J. Conserved mechanisms of glucose sensing and regulation by Drosophila corpora cardiaca cells. Nature 2004, 431, 316–320. [Google Scholar] [CrossRef] [Scilit]
  19. Elbein, A.D.; Pan, Y.T.; Pastuszak, I.; Carroll, D. New insights on trehalose: A multifunctional molecule. Glycobiology 2003, 13, 17–27. [Google Scholar] [CrossRef] [Scilit]
  20. Zheng, X.; Yang, Z.; Yue, Z.; Alvarez, J.D.; Sehgal, A. FOXO and insulin signaling regulate sensitivity of the circadian clock to oxidative stress. Proc. Natl. Acad. Sci. USA 2007, 104, 15899–15904. [Google Scholar] [CrossRef] [Scilit]
  21. Eremina, M.A.; Menshanov, P.N.; Shishkina, O.D.; Gruntenko, N.E. The transcription factor dfoxo controls the expression of insulin pathway genes and lipids content under heat stress in Drosophila melanogaster. Vavilovskii Zhurnal Genet Selektsii. 2021, 25, 465–471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Grönke, S.; Mildner, A.; Fellert, S.; Tennagels, N.; Petry, S.; Müller, G.; Jäckle, H.; Kühnlein, R.P. Brummer lipase is an evolutionary conserved fat storage regulator in Drosophila. Cell Metab. 2005, 1, 323–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Melnikow, E.; Xu, S.; Liu, J.; Bell, A.J.; Ghedin, E.; Unnasch, T.R.; Lustigman, S. A potential role for the interaction of Wolbachia surface proteins with the Brugia malayi glycolytic enzymes and cytoskeleton in maintenance of endosymbiosis. PLoS Negl. Trop. Dis. 2013, 7, e2151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Moreira, L.A.; Iturbe-Ormaetxe, I.; Jeffery, J.A.; Lu, G.; Pyke, A.T.; Hedges, L.M.; Rocha, B.C.; Hall-Mendelin, S.; Day, A.; Riegler, M.; et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell 2009, 139, 1268–1278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Ponton, F.; Wilson, K.; Holmes, A.; Raubenheimer, D.; Robinson, K.L.; Simpson, S.J. Macronutrients mediate the functional relationship between Drosophila and Wolbachia. Proc. Biol. Sci. 2015, 282, 20142029. [Google Scholar] [CrossRef] [Scilit]
  26. Gruntenko, N.E.; Ilinsky, Y.Y.; Adonyeva, N.V.; Burdina, E.V.; Bykov, R.A.; Menshanov, P.N.; Rauschenbach, I.Y. Various Wolbachia genotypes differently influence host Drosophila dopamine metabolism and survival under heat stress conditions. BMC Evol. Biol. 2017, 17, 252. [Google Scholar] [CrossRef] [Scilit]
  27. Burdina, E.V.; Bykov, R.A.; Menshanov, P.N.; Ilinsky, Y.Y.; Gruntenko, N.E. Unique Wolbachia strain wMelPlus increases heat stress resistance in Drosophila melanogaster. Arch. Insect Biochem. Physiol. 2021, 106, e21776. [Google Scholar] [CrossRef] [Scilit]
  28. Riegler, M.; Sidhu, M.; Miller, W.J.; O’Neill, S.L. Evidence for a global Wolbachia replacement in Drosophila melanogaster. Curr. Biol. 2005, 15, 1428–1433. [Google Scholar] [CrossRef] [Scilit]
  29. Bykov, R.A.; Yudina, M.A.; Gruntenko, N.E.; Zakharov, I.K.; Voloshina, M.A.; Melashchenko, E.S.; Danilova, M.V.; Mazunin, I.O.; Ilinsky, Y.Y. Prevalence and genetic diversity of Wolbachia endosymbiont and mtDNA in Palearctic populations of Drosophila melanogaster. BMC Evol. Biol. 2019, 19, 48. [Google Scholar] [CrossRef] [Scilit]
  30. Ilinsky, Y. Coevolution of Drosophila melanogaster mtDNA and Wolbachia genotypes. PLoS ONE 2013, 8, e54373. [Google Scholar] [CrossRef] [Scilit]
  31. Braig, H.R.; Zhou, W.; Dobson, S.L.; O’Neill, S.L. Cloning and Characterization of a Gene Encoding the Major Surface Protein of the Bacterial Endosymbiont Wolbachia pipientis. J. Bacteriol. 1998, 180, 2373–2378. [Google Scholar] [CrossRef] [Scilit]
  32. O’Neill, S.L.; Giordano, R.; Colbert, A.M.E.; Karr, T.L.; Robertson, H.M. 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc. Natl. Acad. Sci. USA 1992, 89, 2699–2702. [Google Scholar] [CrossRef] [Scilit]
  33. Mukherjee, S.; Mishra, M. Biochemical Estimation to Detect the Metabolic Pathways of Drosophila. In Fundamental Approaches to Screen Abnormalities in Drosophila Springer Protocols Handbooks; Mishra, M., Ed.; Springer: New York, NY, USA, 2020; pp. 135–149. ISBN 978-1-4939-9755-8. [Google Scholar]
  34. Eremina, M.A.; Gruntenko, N.E. Adaptation of the sulfophosphovanillin method of analysis of total lipids for various biological objects as exemplified by Drosophila melanogaster. Vavilovskii Zhurnal Genetiki i Selektsii = Vavilov J. Genet. Breed. 2020, 24, 441–445. [Google Scholar] [CrossRef] [Scilit]
  35. Musselman, L.P.; Fink, J.L.; Narzinski, K.; Ramachandran, P.V.; Hathiramani, S.S.; Cagan, R.L.; Baranski, T.J. A high-sugar diet produces obesity and insulin resistance in wild-type Drosophila. Dis. Model. Mech. 2011, 4, 842–849. [Google Scholar] [CrossRef] [Scilit]
  36. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
  37. Williams, M.J.; Wang, Y.; Klockars, A.; Lind, P.M.; Fredriksson, R.; Schiöth, H.B. Exposure to Bisphenol A Affects Lipid Metabolism in Drosophila melanogaster. Basic Clin. Pharmacol. Toxicol. 2014, 114, 414–420. [Google Scholar] [CrossRef] [Scilit]
  38. Trinh, I.; Boulianne, G.L. Modeling obesity and its associated disorders in Drosophila. Physiology 2013, 28, 117–124. [Google Scholar] [CrossRef] [Scilit]
  39. Wu, M.; Sun, L.V.; Vamathevan, J.; Riegler, M.; Deboy, R.; Brownlie, J.C.; McGraw, E.A.; Martin, W.; Esser, C.; Ahmadinejad, N.; et al. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: A streamlined genome overrun by mobile genetic elements. PLoS Biol. 2004, 2, E69. [Google Scholar] [CrossRef] [Scilit]
  40. Zhang, H.B.; Cao, Z.; Qiao, J.X.; Zhong, Z.Q.; Pan, C.C.; Liu, C.; Zhang, L.-M.; Wang, Y.-F. Metabolomics provide new insights into mechanisms of Wolbachia-induced paternal defects in Drosophila melanogaster. PLoS Pathog. 2021, 17, e1009859. [Google Scholar] [CrossRef] [Scilit]
  41. Da Rocha Fernandes, M.; Martins, R.; Pessoa Costa, E.; Casagrande Pacidônio, E.; Araujo de Abreu, L.; Moreira, L.A.; da Fonseca, R.N.; Logullo, C. The Modulation of the Symbiont/Host Interaction between Wolbachia pipientis and Aedes fluviatilis Embryos by Glycogen Metabolism. PLoS ONE 2014, 9, e98966. [Google Scholar] [CrossRef] [Scilit]
  42. Pasco, M.Y.; Léopold, P. High Sugar-Induced Insulin Resistance in Drosophila Relies on the Lipocalin Neural Lazarillo. PLoS ONE 2012, 7, e36583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Ugrankar, R.; Berglund, E.; Akdemir, F.; Tran, C.; Kim, M.S.; Noh, J.; Schneider, R.; Ebert, B.; Graff, J.M. Drosophila glucome screening identifies Ck1alpha as a regulator of mammalian glucose metabolism. Nat. Commun. 2015, 6, 7102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Yoshida, M.; Matsuda, H.; Kubo, H.; Nishimura, T. Molecular characterization of Tps1 and Treh genes in Drosophila and their role in body water homeostasis. Sci. Rep. 2016, 6, 30582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Matsuda, R.; Hosono, C.; Saigo, K.; Samakovlis, C. The Intersection of the Extrinsic Hedgehog and WNT/Wingless Signals with the Intrinsic Hox Code Underpins Branching Pattern and Tube Shape Diversity in the Drosophila Airways. PLoS Genet. 2015, 11, e1004929. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Broughton, S.; Alic, N.; Slack, C.; Bass, T.; Ikeya, T.; Vinti, G.; Tommasi, A.M.; Driege, Y.; Hafen, E.; Partridge, L. Reduction of DILP2 in Drosophila triages a metabolic phenotype from lifespan revealing redundancy and compensation among DILPs. PLoS ONE 2008, 3, e3721. [Google Scholar] [CrossRef] [Scilit]
  47. Zheng, X.; Lu, Y.; Zhang, P.; Zhang, X.; Cao, G.; Xue, R.; Gong, C. Effect of inhibiting the expression of insulin-like peptide gene BBX-B8 on development and reproduction of silkworm, Bombyx mori. Afr. J. Biotechnol. 2012, 11, 2548–2554. [Google Scholar] [CrossRef] [Scilit]
  48. Iwami, M. Bombyxin: An Insect Brain Peptide That Belongs to the Insulin Family. Zoolog. Sci. 2000, 17, 1035–1044. [Google Scholar] [CrossRef] [Scilit]
  49. Satake, M.; MacKenzie, L.; Yasumoto, T. Identification of Protoceratium reticulatum as the biogenetic origin of yessotoxin. Nat. Toxins 1997, 5, 164–167. [Google Scholar] [CrossRef] [Scilit]
  50. Grönke, S.; Clarke, D.F.; Broughton, S.; Andrews, T.D.; Partridge, L. Molecular evolution and functional characterization of Drosophila insulin-like peptides. PLoS Genet. 2010, 6, e1000857. [Google Scholar] [CrossRef] [Scilit]
  51. Haselton, A.T.; Fridell, Y.W. Adult Drosophila melanogaster as a model for the study of glucose homeostasis. Aging 2010, 2, 523–526. [Google Scholar] [CrossRef] [Scilit]
  52. Caragata, E.P.; Pais, F.S.; Baton, L.A.; Silva, J.B.; Sorgine, M.H.; Moreira, L.A. The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection. BMC Genomics 2017, 18, 6. [Google Scholar] [CrossRef] [Scilit]
  53. Rancès, E.; Ye, Y.H.; Woolfit, M.; McGraw, E.A.; O’Neill, S.L. The relative importance of innate immune priming in Wolbachia-mediated dengue interference. PLoS Pathog. 2012, 8, e1002548. [Google Scholar] [CrossRef] [Scilit]
  54. Turley, A.P.; Moreira, L.A.; O’Neill, S.L.; McGraw, E.A. Wolbachia infection reduces blood-feeding success in the dengue fever mosquito, Aedes aegypti. PLoS Negl. Trop. Dis. 2009, 3, e516. [Google Scholar] [CrossRef] [Scilit]
  55. He, Z.; Zhang, H.B.; Li, S.T.; Yu, W.J.; Biwot, J.; Yu, X.Q.; Peng, Y.; Wang, Y.-F. Effects of Wolbachia infection on the postmating response in Drosophila melanogaster. Behav. Ecol. Sociobiol. 2018, 72, 146. [Google Scholar] [CrossRef] [Scilit]
  56. Ilinsky, Y.Y.; Zakharov, I.K. Cytoplasmic incompatibility in Drosophila melanogaster is caused by different Wolbachia genotypes. Russ. J. Genet. Appl. Res. 2011, 1, 458. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Total lipid content (a) and weight (b) in wild type Bi90 D. melanogaster females infected with wMel, wMel4, wMelPlus, wMelCS2, wMelCS45, wMelCS112 and wMelCS128 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01, * p < 0.05). A total of 8–14 measurements were made for each group.
Figure 1. Total lipid content (a) and weight (b) in wild type Bi90 D. melanogaster females infected with wMel, wMel4, wMelPlus, wMelCS2, wMelCS45, wMelCS112 and wMelCS128 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01, * p < 0.05). A total of 8–14 measurements were made for each group.
Insects 14 00357 g001
Figure 2. TAG content in wild type line Bi90 females infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01). Each experiment was performed with three biological replicates.
Figure 2. TAG content in wild type line Bi90 females infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01). Each experiment was performed with three biological replicates.
Insects 14 00357 g002
Figure 3. Glucose (a) and trehalose (b) content in females of D. melanogaster wild type Bi90 line infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01). Each experiment was performed with three biological replicates.
Figure 3. Glucose (a) and trehalose (b) content in females of D. melanogaster wild type Bi90 line infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01). Each experiment was performed with three biological replicates.
Insects 14 00357 g003
Figure 4. tps1 (a), treh (b), bmm (c) and dInR (d) gene expression intensity in wild type Bi90 D. melanogaster females infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001). Each experiment was performed with three biological replicates.
Figure 4. tps1 (a), treh (b), bmm (c) and dInR (d) gene expression intensity in wild type Bi90 D. melanogaster females infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001). Each experiment was performed with three biological replicates.
Insects 14 00357 g004
Figure 5. Analysis of food consumption in wild type line Bi90 females infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01). A total of 11–12 measurements were made for each group.
Figure 5. Analysis of food consumption in wild type line Bi90 females infected with wMel, wMelPlus and wMelCS42 Wolbachia strains compared to that in uninfected Bi90T control line. The asterisk indicates significant differences (*** p < 0.001, ** p < 0.01). A total of 11–12 measurements were made for each group.
Insects 14 00357 g005
Figure 6. The daily survival rate in females of uninfected wild type line Bi90 and Bi90 line infected with wMelPlus Wolbachia strain placed on pure sugar medium on the 7th day after eclosion. The asterisk indicates significant differences (p < 0.05). Each group under study includes 50 females (10 vials, 5 females per vial).
Figure 6. The daily survival rate in females of uninfected wild type line Bi90 and Bi90 line infected with wMelPlus Wolbachia strain placed on pure sugar medium on the 7th day after eclosion. The asterisk indicates significant differences (p < 0.05). Each group under study includes 50 females (10 vials, 5 females per vial).
Insects 14 00357 g006
Figure 7. Scheme of Wolbachia effect on the regulation of carbohydrate and lipid metabolism in Drosophila, where TAG—triglycerides, DAG—diglycerides, FA—fatty acids, tps1—gene coding for Trehalose-6-phosphate synthase 1, the enzyme synthesizing trehalose from glucose, treh—gene coding for trehalase, the enzyme of trehalose degradation, bmm—gene regulating TAG metabolism.
Figure 7. Scheme of Wolbachia effect on the regulation of carbohydrate and lipid metabolism in Drosophila, where TAG—triglycerides, DAG—diglycerides, FA—fatty acids, tps1—gene coding for Trehalose-6-phosphate synthase 1, the enzyme synthesizing trehalose from glucose, treh—gene coding for trehalase, the enzyme of trehalose degradation, bmm—gene regulating TAG metabolism.
Insects 14 00357 g007
Table 1. Drosophila lines used in the study.
Table 1. Drosophila lines used in the study.
Drosophila LineWolbachia InfectionLine-Donor of CytoplasmOrigin of Donor Line
Bi90T---Bi90, tetracycline treatedKyrgyzstan, 2004
Bi90wMelwMelBi90Kyrgyzstan, 2004
Bi90wMelPluswMelPlusw153Uzbekistan, 1989
Bi90wMelCS128wMelCS1-128Australia, 1986
Bi90wMelCS45wMelCS45Sankt-Peterburg, Russia, 1995
Bi90wMelCS112wMelCS3-112Bloomington, USA, 2010
Bi90wMelCS2wMelCS293220Biysk, Altai, Russia, 1993
Bi90wMel4wMel4w304Sinai Peninsula, Egypt, 2010
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Karpova, E.K.; Bobrovskikh, M.A.; Deryuzhenko, M.A.; Shishkina, O.D.; Gruntenko, N.E. Wolbachia Effect on Drosophila melanogaster Lipid and Carbohydrate Metabolism. Insects 2023, 14, 357. https://doi.org/10.3390/insects14040357

AMA Style

Karpova EK, Bobrovskikh MA, Deryuzhenko MA, Shishkina OD, Gruntenko NE. Wolbachia Effect on Drosophila melanogaster Lipid and Carbohydrate Metabolism. Insects. 2023; 14(4):357. https://doi.org/10.3390/insects14040357

Chicago/Turabian Style

Karpova, Evgenia K., Margarita A. Bobrovskikh, Maksim A. Deryuzhenko, Olga D. Shishkina, and Nataly E. Gruntenko. 2023. "Wolbachia Effect on Drosophila melanogaster Lipid and Carbohydrate Metabolism" Insects 14, no. 4: 357. https://doi.org/10.3390/insects14040357

APA Style

Karpova, E. K., Bobrovskikh, M. A., Deryuzhenko, M. A., Shishkina, O. D., & Gruntenko, N. E. (2023). Wolbachia Effect on Drosophila melanogaster Lipid and Carbohydrate Metabolism. Insects, 14(4), 357. https://doi.org/10.3390/insects14040357

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop