Development of Nuclear DNA Markers for Applications in Genetic Diversity Study of Oil Palm-Pollinating Weevil Populations
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Genomic DNA Extraction
2.2. RAD Tag Sequencing and Sequence Alignment
2.3. SNP Discovery and Genotyping
2.4. SSR Discovery and Genotyping
2.5. Genetic Diversity and Clustering Analysis
3. Results
3.1. SNP Discovery and Marker Informativeness
3.2. SSR Discovery and Marker Informativeness
3.3. Genetic Diversity Analysis
3.4. Genetic Distance Estimate and Clustering Analysis
4. Discussion
4.1. Nuclear DNA Marker Development and Informativeness
4.2. Applications of Weevil-Specific SNP and SSR in Genetic Diversity Assessment
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pamin, K.A. A hundred and fifty years of oil palm in Indonesia: From the Bogor Botanical Garden to the industry. In Proceedings of the International Oil Palm Conference ‘Commodity of the Past, Today and the Future’, Bali, Indonesia, 23–25 September 1998; pp. 3–23. [Google Scholar]
- Corley, R.H.; Tinker, P. Chapter 1. The Origin and Development of the Oil Palm Industry. In The Oil Palm, 4th ed.; Blackwell Science Ltd.: Oxford, UK, 2003; pp. 1–26. [Google Scholar]
- Parveez, G.K.A. Oil palm economic performance in Malaysia and R&D progress in 2020. J. Oil Palm Res. 2021, 33, 181–214. [Google Scholar] [CrossRef]
- Syed, R.A. Studies on oil palm pollination by insects. Bull. Entomol. Res. 1979, 69, 213–224. [Google Scholar] [CrossRef]
- Hardon, J. Assisted pollination in oil palm: A review. In Advances in Oil Palm Cultivation; Wastie, R.L., Earp, D.A., Eds.; Incorporated Society of Planters: Kuala Lumpur, Malaysia, 1973; pp. 184–195. [Google Scholar]
- Wahid, M.B. Developments of the Oil Palm Pollinator, Elaiedobius kamerunicus in Malaysia. Palm Oil Dev. 1984, 2, 1–3. [Google Scholar]
- Syed, R. Insect Pollination of Oil Palm: Feasibility of Introducing Elaeidobius Spp. into Malaysia. In Oil Palm in the Eighties. A Report of the Proceedings of the International Conference on Oil Palm in the Eighties; Kuala Lumpur (Malaysia) Inc. Society of Planters: Kuala Lumpur, Malaysia, 1982; pp. 263–289. [Google Scholar]
- Kang, S.; Zam, A. Quarantine aspects of the introduction into Malaysia of an oil palm insect pollinator. In Proceedings of the International Conference on Plant Protection in the Tropics, Kuala Lumpur, Malaysia, 1–4 March 1982; pp. 615–626. [Google Scholar]
- Tuo, Y.; Koua, H.K.; Hala, N. Biology of Elaeidobius kamerunicus and Elaeidobius plagiatus (Coleoptera: Curculionidae) main pollinators of oil palm in West Africa. Eur. J. Sci. Res. 2011, 49, 426–432. [Google Scholar]
- Siswanto; Soetopo, D. Population of oil palm pollinator insect (Elaeidobius kamerunicus Faust.) at PTP Nusantara VIII Cisalak Baru, Rangkasbitung-Banten. IOP Conf. Ser. Earth Environ. Sci. 2020, 418, 12045. [Google Scholar] [CrossRef]
- Corley, R.H.V.; Tinker, P.B. The Oil Palm, 5th ed.; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2015. [Google Scholar]
- Syed, R.A.; Law, I.H.; Corley, R.H. Insect pollination of oil palm: Introduction, establishment and pollinating efficiency of Elaeidobius kamerunicus in Malaysia. Planter 1982, 58, 547–561. [Google Scholar]
- Mariau, D.; Genty, P. IRHO contribution to the study of oil palm insect pollinators in Africa, South America and Indonesia. Oléagineux 1988, 43, 233–240. [Google Scholar]
- Moslim, R.; Kamarudin, N. Comparative Traits of Pollinating Weevils and Factors Affecting Its Population in Malaysia. In Task Force Oil Palm Pollinating Weevil and Fruit Set; Malaysian Palm Oil Board: Bangi, Selangor, Malaysia, 2016. [Google Scholar]
- Donough, C.; Chew, K.; Law, I. Effect of fruit set on OER and KER-results from studies at pamol estates. Plant 1996, 72, 203–219. [Google Scholar]
- Rao, V.; Law, I. The problem of poor fruitset in parts of East Malaysia. Plant 1998, 74, 463–483. [Google Scholar]
- Ming, K.S. The Elaeidobius kamerunicus story. Plant 1999, 75, 143–150. [Google Scholar]
- Krantz, G.W.; Poinar, G.O. Mites, nematodes and the multimillion dollar weevil. J. Nat. Hist. 2004, 38, 135–141. [Google Scholar] [CrossRef]
- Nasir, D.M.; Mamat, N.-S.; Abdul Muneim, N.A.; Ong-Abdullah, M.; Abd Latip, N.F.B.; Su, S.; Hazmi, I.R.B. Morphometric Analysis of the Oil Palm Pollinating Weevil, Elaeidobius kamerunicus (Faust, 1878) (Coleoptera: Curculionidae) from Oil Palm Plantations in Malaysia. J. Entomol. Res. Soc. 2020, 22, 275–291. [Google Scholar] [CrossRef]
- Sukhodolskaya, R. Intraspecific Body Size Variation in Ground Beetles (Coleoptera, Carabidae) in Urban-Suburban-Rural-Natural Gradient. Acta Biol. Univ. Daugavp 2013, 13, 121–128. [Google Scholar]
- Haran, J.; Ndzana Abanda, R.F.X.; Benoit, L.; Bakoumé, C.; Beaudoin-Ollivier, L. Multilocus phylogeography of the world populations of Elaeidobius kamerunicus (Coleoptera, Curculionidae), pollinator of the palm Elaeis guineensis. Bull. Entomol. Res. 2020, 110, 654–662. [Google Scholar] [CrossRef]
- Ballard, J.W.O.; Whitlock, M.C. The incomplete natural history of mitochondria. Mol. Ecol. 2004, 13, 729–744. [Google Scholar] [CrossRef]
- Qin, Y.; Buahom, N.; Krosch, M.N.; Du, Y.; Wu, Y.; Malacrida, A.R. Genetic diversity and population structure in Bactrocera correcta (Diptera: Tephritidae) inferred from mtDNA cox1 and microsatellite markers. Sci. Rep. 2016, 6, 38476. [Google Scholar] [CrossRef]
- Yang, X.; Xu, Y.; Shah, T.; Li, H.; Han, Z.; Li, J.; Yan, J. Comparison of SSRs and SNPs in assessment of genetic relatedness in maize. Genetica 2011, 139, 1045–1054. [Google Scholar] [CrossRef]
- Zhang, J.; Yang, J.; Zhang, L.; Luo, J.; Zhao, H.; Zhang, J.; Wen, C. A new SNP genotyping technology Target SNP-seq and its application in genetic analysis of cucumber varieties. Sci. Rep. 2020, 10, 5623. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; Godzik, A. Cd-hit: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 2006, 22, 1658–1659. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Garrison, E.P.; Marth, G.T. Haplotype-based variant detection from short-read sequencing. arXiv 2012, arXiv:1207.3907. [Google Scholar]
- The NCBI C++ Toolkit; National Center for Biotechnology Information, U.S. National Library of Medicine: Bethesda, MD, USA, 2004.
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.R.; Bender, D.; Maller, J.; Sklar, P.; de Bakker, P.I.W.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef] [PubMed]
- Melville, J.; Haines, M.L.; Boysen, K.; Hodkinson, L.; Kilian, A.; Smith Date, K.L.; Potvin, D.A.; Parris, K.M. Identifying hybridization and admixture using SNPs: Application of the DArTseq platform in phylogeographic research on vertebrates. R. Soc. Open Sci. 2017, 4, 161061. [Google Scholar] [CrossRef] [PubMed]
- Metz, S.; Cabrera, J.M.; Rueda, E.; Giri, F.; Amavet, P. FullSSR: Microsatellite Finder and Primer Designer. Adv. Bioinform. 2016, 2016, 6040124. [Google Scholar] [CrossRef]
- Schuelke, M. An economic method for the fluorescent labeling of PCR fragments A poor man ’ s approach to genotyping for research and high-throughput diagnostics. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef] [PubMed]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Wright, S. The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution 1965, 19, 395–420. [Google Scholar] [CrossRef]
- Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinform. Appl. Notes 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [Green Version]
- Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef]
- Page, R.D.M. Tree View: An application to display phylogenetic trees on personal computers. Bioinformatics 1996, 12, 357–358. [Google Scholar] [CrossRef]
- Jombart, T. adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics 2008, 24, 1403–1405. [Google Scholar] [CrossRef]
- Goudet, J. HIERFSTAT, a package for R to compute and test hierarchical F-statistics. Mol. Ecol. Notes 2005, 4, 184–186. [Google Scholar] [CrossRef]
- Paradis, E. Pegas: An R Package for Population Genetics with an Integrated-Modular Approach. Bioinformatics 2010, 26, 419–420. [Google Scholar] [CrossRef] [PubMed]
- Kamvar, Z.N.; López-Uribe, M.M.; Coughlan, S.; Grünwald, N.J.; Lapp, H.; Manel, S. Developing educational resources for population genetics in R: An open and collaborative approach. Mol. Ecol. Resour. 2017, 17, 120–128. [Google Scholar] [CrossRef] [PubMed]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
- Brookfield, J.F. A simple new method for estimating null allele frequency from heterozygote deficiency. Mol. Ecol. 1996, 5, 453–455. [Google Scholar] [CrossRef] [PubMed]
- Chapuis, M.-P.; Estoup, A. Microsatellite Null Alleles and Estimation of Population Differentiation. Mol. Biol. Evol. 2007, 24, 621–631. [Google Scholar] [CrossRef] [PubMed]
- Peterson, B.K.; Weber, J.N.; Kay, E.H.; Fisher, H.S.; Hoekstra, H.E. Double Digest RADseq: An Inexpensive Method for De Novo SNP Discovery and Genotyping in Model and Non-Model Species. PLoS ONE 2012, 7, e37135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miller, M.R.; Dunham, J.P.; Amores, A.; Cresko, W.A.; Johnson, E.A. Rapid and cost-effective polymorphism identification and genotyping using restriction site associated DNA (RAD) markers. Genome Res. 2007, 17, 240–248. [Google Scholar] [CrossRef] [PubMed]
- Baird, N.A.; Etter, P.D.; Atwood, T.S.; Currey, M.C.; Shiver, A.L.; Lewis, Z.A.; Selker, E.U.; Cresko, W.A.; Johnson, E.A. Rapid SNP discovery and genetic mapping using sequenced RAD markers. PLoS ONE 2008, 3, e3376. [Google Scholar] [CrossRef]
- Ogden, R.; Gharbi, K.; Mugue, N.; Martinsohn, J.; Senn, H.; Davey, J.W.; Pourkazemi, M.; McEwing, R.; Eland, C.; Vidotto, M.; et al. Sturgeon conservation genomics: SNP discovery and validation using RAD sequencing. Mol. Ecol. 2013, 22, 3112–3123. [Google Scholar] [CrossRef]
- Pavinato, V.A.C.; Margarido, G.R.A.; Wijeratne, A.J.; Wijeratne, S.; Meulia, T.; Souza, A.P.; Michel, A.P.; Zucchi, M.I. Restriction site associated DNA (RAD) for de novo sequencing and marker discovery in sugarcane borer, Diatraea saccharalis Fab. (Lepidoptera: Crambidae). Mol. Ecol. Resour. 2017, 17, 454–465. [Google Scholar] [CrossRef]
- Guichoux, E.; Lagache, L.; Wagner, S.; Chaumeil, P.; Léger, P.; Lepais, O.; Lepoittevin, C.; Malausa, T.; Revardel, E.; Salin, F.; et al. Current trends in microsatellite genotyping. Mol. Ecol. Resour. 2011, 11, 591–611. [Google Scholar] [CrossRef]
- Chen, W.; Hou, L.; Zhang, Z.; Pang, X.; Li, Y. Genetic Diversity, Population Structure, and Linkage Disequilibrium of a Core Collection of Ziziphus jujuba Assessed with Genome-wide SNPs Developed by Genotyping-by-sequencing and SSR Markers. Front. Plant Sci. 2017, 8, 575. [Google Scholar] [CrossRef]
- Cui, M.; Wu, Y.; Javal, M.; Giguère, I.; Roux, G.; Andres, J.A.; Keena, M.; Shi, J.; Wang, B.; Braswell, E.; et al. Genome-scale phylogeography resolves the native population structure of the Asian longhorned beetle, Anoplophora glabripennis (Motschulsky). Evol. Appl. 2022, 15, 934–953. [Google Scholar] [CrossRef] [PubMed]
- Andrews, K.R.; Good, J.M.; Miller, M.R.; Luikart, G.; Paul, A.; Sciences, W.; Avenue, O.S.; Station, L.B.; Group, W.G.; Studies, E. Harnessing the power of RADseq for ecological and evolutionary genomics. Nat. Rev. Genet. 2016, 17, 81–92. [Google Scholar] [CrossRef]
- Qin, H.; Yang, G.; Provan, J.; Liu, J.; Gao, L. Using MiddRAD-seq data to develop polymorphic microsatellite markers for an endangered yew species. Plant Divers. 2017, 39, 294–299. [Google Scholar] [CrossRef]
- Chen, Z.; Wang, G.; Li, M.; Peng, Z.; Ali, H.; Xu, L.; Gurr, G.M.; Hou, Y. Development of Single Nucleotide Polymorphism (SNP) Markers for Analysis of Population Structure and Invasion Pathway in the Coconut Leaf Beetle Brontispa longissima (Gestro) Using Restriction Site-Associated DNA (RAD) Genotyping in Southern China. Insects 2020, 11, 230. [Google Scholar] [CrossRef] [Green Version]
- Ong, A.-L.; Teh, C.-K.; Mayes, S.; Massawe, F.; Appleton, D.R.; Kulaveerasingam, H. An Improved Oil Palm Genome Assembly as a Valuable Resource for Crop Improvement and Comparative Genomics in the Arecoideae Subfamily. Plants 2020, 9, 1476. [Google Scholar] [CrossRef]
- Hildebrand, C.E.; Torney, D.C.; Wagner, R.P. Informativeness of Polymorphic DNA Markers. Los Alamos Sci. 1992, 20, 100–102. [Google Scholar]
- Rosenberg, N.A.; Li, L.M.; Ward, R.; Pritchard, J.K. Informativeness of genetic markers for inference of ancestry. Am. J. Hum. Genet. 2003, 73, 1402–1422. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Chen, L.; Wang, S.; Oh, C.; Zhao, H. Comparison of single-nucleotide polymorphisms and microsatellites in inference of population structure. BMC Genet. 2005, 6 (Suppl. 1), S26. [Google Scholar] [CrossRef]
- Duan, C.; Li, D.; Sun, S.; Wang, X.; Zhu, Z. Rapid Development of Microsatellite Markers for Callosobruchus chinensis Using Illumina Paired-End Sequencing. PLoS ONE 2014, 9, e95458. [Google Scholar] [CrossRef]
- Hodel, R.G.J.; Chen, S.; Payton, A.C.; McDaniel, S.F.; Soltis, P.; Soltis, D.E. Adding loci improves phylogeographic resolution in red mangroves despite increased missing data: Comparing microsatellites and RAD-Seq and investigating loci filtering. Sci. Rep. 2017, 7, 17598. [Google Scholar] [CrossRef] [PubMed]
- Latip, N.F.A.; Ghani, I.A.; Hazmi, I.R.; Cik Mohd Rizuan Zainal Abidin, D.S. Morphometric Comparison of the Oil Palm Pollinator Elaeidobius kamerunicus Faust (Coleoptera: Curculionidae) from Malaysia, Indonesia, and Liberia. Coleopt. Bull. 2019, 73, 746–756. [Google Scholar] [CrossRef]
- Nurul Fatihah, A.L.; Muhamad Fahmi, M.H.; Luqman, H.A.; Syarifah Nadiah, S.M.D.; Teo, T.M.; Izfa Riza, H.; Idris, A.B. Effects of Rainfall, Number of Male Inflorescences and Spikelets on the Population Abundance of Elaeidobius kamerunicus (Coleoptera: Curculionidae). Sains Malays. 2019, 48, 15–21. [Google Scholar] [CrossRef]
- Pompanon, F.; Bonin, A.; Bellemain, E.; Taberlet, P. Genotyping errors: Causes, consequences and solutions. Nat. Rev. Genet. 2005, 6, 847–859. [Google Scholar] [CrossRef]
- Callen, D.F.; Thompson, A.D.; Shen, Y.; Phillips, H.A.; Richards, R.I.; Mulley, J.C.; Sutherland, G.R. Incidence and origin of “null” alleles in the (AC)n microsatellite markers. Am. J. Hum. Genet. 1993, 52, 922–927. [Google Scholar]
- Chybicki, I.J.; Oleksa, A.; Burczyk, J. Increased inbreeding and strong kinship structure in Taxus baccata estimated from both AFLP and SSR data. Heredity 2011, 107, 589–600. [Google Scholar] [CrossRef]
- Kelly, A.C.; Mateus-Pinilla, N.E.; Douglas, M.; Douglas, M.; Shelton, P.; Novakofski, J. Microsatellites behaving badly: Empirical evaluation of genotyping errors and subsequent impacts on population studies. Genet. Mol. Res. 2011, 10, 2534–2553. [Google Scholar] [CrossRef]
- Wu, X.; Wang, L.; Zhang, D.; Wen, Y. Microsatellite null alleles affected population genetic analyses: A case study of Maire yew (Taxus chinensis var. mairei). J. For. Res. 2019, 24, 230–234. [Google Scholar] [CrossRef]
- Song, W.; Cao, L.-J.; Wang, Y.-Z.; Li, B.-Y.; Wei, S.-J. Novel microsatellite markers for the oriental fruit moth Grapholita molesta (Lepidoptera: Tortricidae) and effects of null alleles on population genetics analyses. Bull. Entomol. Res. 2017, 107, 349–358. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Qin, M.; Yang, L.; Song, Z.; Luo, L.; Bao, H.; Ma, Z.; Zhou, Z.; Xu, J. A genome-wide analysis of simple sequence repeats in Apis cerana and its development as polymorphism markers. Gene 2017, 599, 53–59. [Google Scholar] [CrossRef]
- Wang, M.; Barkley, N.; Jenkins, T. Microsatellite Markers in Plants and Insects. Part I: Applications of Biotechnology. Genes Genomes Genom. 2009, 3, 54–67. [Google Scholar]
- Ding, S.; Wang, S.; He, K.; Jiang, M.; Li, F. Large-scale analysis reveals that the genome features of simple sequence repeats are generally conserved at the family level in insects. BMC Genom. 2017, 18, 848. [Google Scholar] [CrossRef]
- Liu, Y.-D.; Zhang, B.; Hou, M. Thirteen microsatellite loci for Laodelphax striatellus and cross amplification in related taxa. Entomol. Sci. 2014, 17. [Google Scholar] [CrossRef]
- Waits, E.R.; Stolz, U.W.E. Polymorphic microsatellite loci from northern and Mexican corn rootworms (Insecta: Coleoptera: Chrysomelidae) and cross-amplification with other Diabrotica spp. Mol. Ecol. Resour. 2008, 8, 707–709. [Google Scholar] [CrossRef]
- Billotte, N.; Risterucci, A.M.; Barcelos, E.; Noyer, J.L.; Amblard, P.; Baurens, F.C. Development, characterisation, and across-taxa utility of oil palm (Elaeis guineensis Jacq.) microsatellite markers. Genome 2001, 44, 413–425. [Google Scholar] [CrossRef]
- Alvarez-Fernandez, A.; Bernal, M.J.; Fradejas, I.; Martin Ramírez, A.; Md Yusuf, N.A.; Lanza, M.; Hisam, S.; Pérez de Ayala, A.; Rubio, J.M. KASP: A genotyping method to rapid identification of resistance in Plasmodium falciparum. Malar. J. 2021, 20, 16. [Google Scholar] [CrossRef]
No. | Population | Pop. Code | Estate | Latitude | Longitude | Sample Size |
---|---|---|---|---|---|---|
Native Population | ||||||
1 | Cameroon | CAM | Buea | 5.2916532 | 9.4208524 | 15 |
2 | Ghana | GHN | Kusi | 6.1104472 | −0.2673795 | 15 |
Introduced population | ||||||
3 | South Riau, Indonesia | SR | Bhumireksa Nusasejati | 0.1172028 | 103.6054083 | 15 |
4 | North Riau, Indonesia | NR | Menggala | 2.8770875 | 103.7287832 | 15 |
5 | Central West Kalimantan, Indonesia | CWK | Sekunyir | −2.4329821 | 112.000172 | 15 |
6 | South Kalimantan, Indonesia | SK | Angsana | 3.6063617 | 115.5897206 | 15 |
7 | North Peninsular Malaysia | NPM | Sungai Dingin | 5.3678468 | 100.7063803 | 15 |
8 | Central Peninsular Malaysia | CPM | West | 3.4032204 | 101.4013073 | 15 |
9 | South Peninsular Malaysia | SPM | Yong Peng | 2.0160711 | 102.9960109 | 15 |
10 | South Sarawak, East Malaysia | SS | Sessang | 1.8433571 | 111.2101607 | 15 |
11 | North Sarawak, East Malaysia | NS | Bayu | 3.3757040 | 113.4109915 | 15 |
12 | Sabah, East Malaysia | SBH | Tiger | 4.4069250 | 117.8172309 | 15 |
Total | 180 |
No. | SSR Marker | Primer Sequence (5′-3′) | Repeat Motif | Size Range (bp) | Ta (°C) | MAF | NA | NG | PIC | NAF |
---|---|---|---|---|---|---|---|---|---|---|
1 | SDPek_R0022 | F: GCCTATAATAGACCGTTTGG; R: GTGAAGAACATTGTAACATCTC | (AAC)6 | 124–136 | 56 | 0.4306 | 6.00 | 15.00 | 0.6651 | 0.0341 |
2 | SDPek_R0032 | F: CGCTCTCCTCCTCATTATCA; R: TCTCTTGCATCTAGGTAACG | (AG)6 | 168–174 | 54 | 0.7306 | 5.00 | 8.00 | 0.3937 | 0.2875 |
3 | SDPek_R0064 | F:GTCACCAATAAGTTCCAAAGC; R: GTGGTGTTGGTGAACCTGAT | (CTGCA)4 | 185–200 | 56 | 0.8389 | 4.00 | 7.00 | 0.2540 | 0.1495 |
4 | SDPek_R0079 | F: TATTTGGATGTATTTCGGTTTG; R: GCGAGTATTTGTAGCGATC | (T)10 | 146–150 | 54 | 0.3939 | 9.00 | 17.00 | 0.6695 | 0.2875 |
5 | SDPek_R0082 | F: TCTCAAGGTGGCTCTCAT; R: CACATCTATCCGCACTACA | (T)13 | 117–130 | 56 | 0.2961 | 13.00 | 27.00 | 0.8024 | 0.2917 |
6 | SDPek_R0139 | F: CTCCAGTTATAGTACCACAATG; R: CGACTCGGCTCTTGTATT | (AG)6 | 131–139 | 54 | 0.5389 | 5.00 | 11.00 | 0.5401 | 0.0970 |
7 | SDPek_R0142 | F: CCTAAATAAGGACCACCCTA; R: CGACCTGTTAGCCTCTAC | (AT)5 | 132–140 | 54 | 0.5559 | 4.00 | 6.00 | 0.4294 | 0.0390 |
8 | SDPek_R0147 | F: TTGGTTCTATCGAGTAATGC; R: GCAATTTACCTCCAATGACA | (ATG)5 | 144–156 | 54 | 0.7944 | 4.00 | 8.00 | 0.3131 | 0.3361 |
Mean | 0.5724 | 6.25 | 12.38 | 0.5084 | 0.1903 | |||||
Standard deviation | 0.1982 | 3.2 | 7.09 | 0.1928 | 0.1243 |
Pop. Code | N | SNP | SSR | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MAF | Mean NA | He | Ho | PIC | Fis | MAF | Mean NA | He | Ho | PIC | Fis | Adjusted Fis | ||
SR | 15 | 0.7849 | 1.8000 | 0.2795 | 0.3125 | 0.2226 | −0.0837 | 0.6833 | 3.2500 | 0.4236 | 0.2500 | 0.3747 | 0.4381 | 0.0110 |
NS | 15 | 0.7748 | 1.8409 | 0.2904 | 0.3181 | 0.2312 | −0.0608 | 0.6000 | 3.5000 | 0.4878 | 0.3083 | 0.4454 | 0.3973 | 0.0501 |
CAM | 15 | 0.8222 | 1.6500 | 0.2282 | 0.2417 | 0.1810 | −0.0244 | 0.6542 | 3.0000 | 0.4497 | 0.2583 | 0.3945 | 0.4534 | −0.0246 |
CWK | 15 | 0.7764 | 1.8455 | 0.2908 | 0.3339 | 0.2316 | −0.1146 | 0.5625 | 3.3750 | 0.5283 | 0.3417 | 0.4732 | 0.3831 | −0.0030 |
GHN | 15 | 0.9199 | 1.3318 | 0.1035 | 0.0992 | 0.0833 | 0.0330 | 0.7542 | 3.1250 | 0.3375 | 0.1500 | 0.3131 | 0.5789 | 0.1042 |
NR | 15 | 0.7860 | 1.8364 | 0.2799 | 0.3073 | 0.2236 | −0.0637 | 0.6417 | 3.2500 | 0.4508 | 0.2833 | 0.3931 | 0.4009 | 0.1470 |
NPM | 15 | 0.7804 | 1.8409 | 0.2886 | 0.3222 | 0.2306 | −0.0822 | 0.5500 | 3.8750 | 0.5525 | 0.2417 | 0.5037 | 0.5857 | 0.0667 |
SK | 15 | 0.7759 | 1.8364 | 0.2908 | 0.3179 | 0.2313 | −0.0588 | 0.6625 | 3.5000 | 0.4431 | 0.3083 | 0.4049 | 0.3350 | 0.1154 |
SS | 15 | 0.7947 | 1.7955 | 0.2684 | 0.3031 | 0.2147 | −0.0955 | 0.6423 | 3.3750 | 0.4551 | 0.3363 | 0.3988 | 0.2931 | 0.1173 |
SBH | 15 | 0.7845 | 1.8409 | 0.2803 | 0.3055 | 0.2241 | −0.0553 | 0.5250 | 3.8750 | 0.5650 | 0.2583 | 0.5142 | 0.5667 | −0.0024 |
CPM | 15 | 0.7742 | 1.8409 | 0.2950 | 0.3319 | 0.2352 | −0.0911 | 0.6958 | 3.3750 | 0.4242 | 0.2583 | 0.3808 | 0.4198 | 0.0392 |
SPM | 15 | 0.7947 | 1.7864 | 0.2673 | 0.3034 | 0.2131 | −0.1008 | 0.6723 | 3.1250 | 0.4308 | 0.3036 | 0.3812 | 0.3269 | 0.0623 |
Mean | 0.7974 | 1.7690 | 0.2636 | 0.2914 | 0.2102 | −0.0665 | 0.6370 | 3.3854 | 0.4624 | 0.2748 | 0.4148 | 0.4316 | 0.0569 | |
Standard Dev | 0.0409 | 0.1535 | 0.0535 | 0.0649 | 0.0425 | 0.0397 | 0.0665 | 0.2742 | 0.0632 | 0.0518 | 0.0585 | 0.0992 | 0.0554 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mohd Rodzik, F.F.; Sudirman, N.A.; Teh, C.-K.; Ong, A.-L.; Heng, H.-Y.; Yaakop, S.; Mohd-Assaad, N.; Ong-Abdullah, M.; Ata, N.; Amit, S.; et al. Development of Nuclear DNA Markers for Applications in Genetic Diversity Study of Oil Palm-Pollinating Weevil Populations. Insects 2023, 14, 157. https://doi.org/10.3390/insects14020157
Mohd Rodzik FF, Sudirman NA, Teh C-K, Ong A-L, Heng H-Y, Yaakop S, Mohd-Assaad N, Ong-Abdullah M, Ata N, Amit S, et al. Development of Nuclear DNA Markers for Applications in Genetic Diversity Study of Oil Palm-Pollinating Weevil Populations. Insects. 2023; 14(2):157. https://doi.org/10.3390/insects14020157
Chicago/Turabian StyleMohd Rodzik, Fairuz Farhana, Nurshazwani Amalina Sudirman, Chee-Keng Teh, Ai-Ling Ong, Huey-Ying Heng, Salmah Yaakop, Norfarhan Mohd-Assaad, Meilina Ong-Abdullah, Nabeel Ata, Samsudin Amit, and et al. 2023. "Development of Nuclear DNA Markers for Applications in Genetic Diversity Study of Oil Palm-Pollinating Weevil Populations" Insects 14, no. 2: 157. https://doi.org/10.3390/insects14020157