A Novel Variant of Deformed Wing Virus (DWV) from the Invasive Honeybee Apis florea (Apidae, Hymenoptera) and Its Ectoparasite Euvarroa sinhai (Acarina, Mesostigmata) in Taiwan
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
3. Results
3.1. Prevalence of DWV-A and DWV-B in Honeybees and Mites
3.2. Genome Sequence of DWV Variant in A. florea and E. sinhai
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wilfert, L.; Long, G.; Leggett, H.C.; Schmid-Hempel, P.; Butlin, R.; Martin, S.J.M.; Boots, M. Deformed wing virus is a recent global epidemic in honeybees driven by Varroa mites. Science 2016, 351, 594–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, S.J.; Brettell, L.E. Deformed wing virus in honeybees and other insects. Annu. Rev. Virol. 2019, 6, 49–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koziy, R.V.; Wood, S.C.; Kozii, I.V.; van Rensburg, C.J.; Moshynskyy, I.; Dvylyuk, I.; Simko, E. Deformed wing virus infection in honey bees (Apis mellifera L.). Vet. Pathol. 2019, 56, 636–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mureşan, C.I.; Buttstedt, A. pH-dependent stability of honey bee (Apis mellifera) major royal jelly proteins. Sci. Rep. 2019, 9, 9014. [Google Scholar] [CrossRef] [Scilit]
- Lauring, A.S.; Andino, R. Quasispecies theory and the behavior of RNA viruses. PLoS Pathog. 2010, 6, e1001005. [Google Scholar] [CrossRef] [Scilit]
- Vignuzzi, M.; Stone, J.K.; Arnold, J.J.; Cameron, C.E.; Andino, R. Quasispecies diversity determines pathogenesis through cooperative interactions in a viral population. Nature 2006, 439, 344–348. [Google Scholar] [CrossRef] [Scilit]
- Fujiyuki, T.; Takeuchi, H.; Ono, M.; Ohka, S.; Sasaki, T.; Nomoto, A.; Kubo, T. Novel insect Picorna-like virus identified in the brains of aggressive worker honeybees. J. Virol. 2004, 78, 1093–1100. [Google Scholar] [CrossRef] [Scilit]
- Lamp, B.; Url, A.; Seitz, K.; Eichhorn, J.; Riedel, C.; Sinn, L.J.; Indik, S.; Köglberger, H.; Rümenapf, T. Construction and rescue of a molecular clone of Deformed wing virus (DWV). PLoS ONE 2016, 11, e0164639. [Google Scholar] [CrossRef] [Scilit]
- Levin, S.; Sela, N.; Chejanovsky, N. Two novel viruses associated with the Apis mellifera pathogenic mite Varroa destructor. Sci. Rep. 2016, 6, 37710. [Google Scholar] [CrossRef] [Scilit]
- Levin, S.; Sela, N.; Erez, T.; Nestel, D.; Pettis, J.; Neumann, P.; Chejanovsky, N. New viruses from the ectoparasite mite Varroa destructor infesting Apis mellifera and Apis cerana. Viruses 2019, 11, 94. [Google Scholar] [CrossRef] [Scilit]
- Brettell, L.E.; Schroeder, D.C.; Martin, S.J. RNAseq analysis reveals virus diversity within hawaiian apiary insect communities. Viruses 2019, 11, 397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Souza, F.S.; Kevill, J.L.; Correia-Oliveira, M.E.; de Carvalho, C.A.L.; Martin, S.J. Occurrence of Deformed wing virus variants in the stingless bee Melipona subnitida and honey bee Apis mellifera populations in Brazil. J. Gen. Virol. 2019, 100, 289–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huwiler, M.; Papach, A.; Cristina, E.; Yañez, O.; Williams, G.R.; Neumann, P. Deformed wings of small hive beetle independent of virus infections and mites. J. Invertebr. Pathol. 2020, 172, 107365. [Google Scholar] [CrossRef] [Scilit]
- Lanzi, G.; de Miranda, J.R.; Boniotti, M.B.; Cameron, C.E.; Lavazza, A.; Capucci, L.; Camazine, S.M.; Rossi, C. Molecular and biological characterization of Deformed wing virus of honeybees (Apis mellifera L.). J. Virol. 2006, 80, 4998–5009. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Zhao, Y.; Hammond, J.; Hsu, H.T.; Evans, J.; Feldlaufer, M. Multiple virus infections in the honey bee and genome divergence of honey bee viruses. J. Invertebr. Pathol. 2004, 87, 84–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Evans, J.; Feldlaufer, M. Horizontal and vertical transmission of viruses in the honey bee, Apis mellifera. J. Invertebr. Pathol. 2006, 92, 152–159. [Google Scholar] [CrossRef] [Scilit]
- Mordecai, G.J.; Wilfert, L.; Martin, S.J.; Jones, I.M.; Schroeder, D.C. Diversity in a honey bee pathogen: First report of a third master variant of the deformed wing virus quasispecies. ISME J. 2016, 10, 1264–1273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zewdu, A.; Desalegn, B.; Amssalu, B.; Tolera, K.; Gebreamlak, B. Assessment of alien honeybee species (Apis florea) in North West and Northern Ethiopia. Greener J. Agric. Sci. 2016, 6, 093–101. [Google Scholar] [CrossRef] [Scilit]
- Silva, D.P.; Castro, A.C.F.; Vilela, B.; Ong, X.R.; Thomas, J.C.; Alqarni, A.S.; Engel, M.S.; Ascher, J.S. Colonizing the east and the west: Distribution and niche properties of a dwarf Asian honey bee invading Africa, the Middle East, the Malay Peninsula, and Taiwan. Apidologie 2020, 51, 75–87. [Google Scholar] [CrossRef] [Scilit]
- Hsu, P.S.; Wu, T.H.; Tian, J.X.; Sung, I.H. Origins and invasion characteristics of the recently introduced dwarf honeybee Apis florea Fabricius, 1787 (Hymenoptera, Apidae) in Taiwan. Bioinvasions Rec. 2022, 11, 124–135. [Google Scholar] [CrossRef] [Scilit]
- Delfinado, M.D.; Baker, E.W. Varroidae, a new family of mites on honey bees (Mesostigmata: Acarina). J. Wash. Acad. Sci. 1974, 64, 4–10. [Google Scholar]
- Koeniger, N.; Koeniger, G.; de Guzman, L.I.; Lekprayoon, C. Survival of Euvarroa sinhai Delfinado and Baker (Acari, Varroidae) on workers of Apis cerana Fabr, Apis florea Fabr and Apis mellifera L. in cages. Apidologie 1993, 24, 403–410. [Google Scholar] [CrossRef] [Scilit]
- Koeniger, N.; Koeniger, G.; Delfinado-Baker, M. Observations on mites of the Asian honeybee species (Apis cerana, Apis dorsata, Apis florea). Apidologie 1983, 14, 197–204. [Google Scholar] [CrossRef] [Scilit]
- Mossadegh, M.S. Geographical distribution, levels of infestation and population density of the mite Euvarroa sinhai Delfinado and Baker (Acarina: Mesostigmata) in Apis florea F Colonies in Iran. Apidologie 1991, 22, 127–134. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; He, S.Y.; Evans, J.D.; Pettis, J.S.; Yin, G.F.; Chen, Y.P. New evidence that Deformed wing virus and Black queen cell virus are multi-host pathogens. J. Invertebr. Pathol. 2012, 109, 156–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dainat, B.; Ken, T.; Berthoud, H.; Neumann, P. The ectoparasitic mite Tropilaelaps mercedesae (Acari, Laelapidae) as a vector of honeybee viruses. Insectes Soc. 2009, 56, 40–43. [Google Scholar] [CrossRef] [Scilit]
- Schöning, C.; Gisder, S.; Geiselhardt, S.; Kretschmann, I.; Bienefeld, K.; Hilker, M.; Genersch, E. Evidence for damage-dependent hygienic behaviour towards Varroa destructor-parasitised brood in the western honey bee, Apis mellifera. J. Exp. Biol. 2012, 215, 264–271. [Google Scholar] [CrossRef] [Scilit]
- di Prisco, G.; Annoscia, D.; Margiotta, M.; Ferrara, R.; Varricchio, P.; Zanni, V.; Caprio, E.; Nazzi, F.; Pennacchio, F. A mutualistic symbiosis between a parasitic mite and a pathogenic virus undermines honey bee immunity and health. Proc. Natl. Acad. Sci. USA 2016, 113, 3203–3208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gómez-moracho, T.; Heeb, P.; Lihoreau, M. Effects of parasites and pathogens on bee cognition. Ecol. Entomol. 2017, 42, 51–64. [Google Scholar] [CrossRef] [Scilit]
- Ngor, L.; Palmer-Young, E.C.; Burciaga Nevarez, R.; Russell, K.A.; Leger, L.; Giacomini, S.J.; Pinilla-Gallego, M.S.; Irwin, R.E.; McFrederick, Q.S. Cross-infectivity of honey and bumble bee-associated parasites across three bee families. Parasitology 2020, 147, 1290–1304. [Google Scholar] [CrossRef] [Scilit]
- Seeley, T.D.; Smith, M.L. Crowding honeybee colonies in apiaries can increase their vulnerability to the deadly ectoparasite Varroa destructor. Apidologie 2015, 46, 716–727. [Google Scholar] [CrossRef] [Scilit]
- Wu, M.C.; Lu, T.H.; Lu, K.H. PCR-RFLP of mitochondrial DNA reveals two origins of Apis mellifera in Taiwan. Saudi J. Biol. Sci. 2017, 24, 1069–1074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chomczynski, P.; Wilfinger, W.; Kennedy, A.; Rymaszewski, M.; Mackey, K. RNAzol® RT: A new single-step method for isolation of RNA. Nat. Methods 2010, 7, 4–5. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y. The influence of RNA integrity on the detection of honey bee viruses: Molecular assessment of different sample storage methods. J. Apic. Res. 2007, 81–87. [Google Scholar] [CrossRef] [Scilit]
- Zioni, N.; Soroker, V.; Chejanovsky, N. Replication of Varroa destructor virus 1 (VDV-1) and a Varroa destructor virus 1-Deformed wing virus recombinant (VDV-1-DWV) in the head of the honey bee. Virology 2011, 417, 106–112. [Google Scholar] [CrossRef] [Scilit]
- Ye, J.; McGinnis, S.; Madden, T.L. BLAST: Improvements for better sequence analysis. Nucleic Acids Res. 2006, 34, 6–9. [Google Scholar] [CrossRef] [Scilit]
- Al-Abbadi, A.A.; Hassawi, D.S.; Abu-Mallouh, S.A.; Al-Mazra’awi, M.S. Novel detection of Israel acute paralysis virus and Kashmir bee virus from honeybees Apis mellifera L. (Hymenoptera: Apidae) of Jordan using reverse transcriptase PCR technique. Appl. Entomol. Zool. 2010, 45, 183–190. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Reddy, K.E.; Noh, J.H.; Choe, S.E.; Kweon, C.H.; Yoo, M.S.; Doan, H.T.T.; Ramya, M.; Yoon, B.S.; Nguyen, L.T.K.; Nguyen, T.T.D.; et al. Analysis of the complete genome sequence and capsid region of black queen cell viruses from infected honeybees (Apis mellifera) in Korea. Virus Genes 2013, 47, 126–132. [Google Scholar] [CrossRef] [Scilit]
- de Miranda, J.R.; Brettell, L.E.; Chejanovsky, N.; Childers, A.K.; Dalmon, A.; Deboutte, W.; de Graaf, D.C.; Doublet, V.; Gebremedhn, H.; Genersch, E.; et al. Cold case: The disappearance of Egypt bee virus, a fourth distinct master strain of Deformed wing virus linked to honeybee mortality in 1970′s Egypt. Virol. J. 2022, 19, 12. [Google Scholar] [CrossRef] [Scilit]
- Valles, S.M.; Chen, Y.; Firth, A.E.; Guérin, D.M.A.; Hashimoto, Y.; Herrero, S.; de Miranda, J.R.; Ryabov, E. ICTV virus taxonomy profile: Iflaviridae. J. Gen. Virol. 2017, 98, 527–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baker, A.C.; Schroeder, D.C. The use of RNA-dependent RNA polymerase for the taxonomic assignment of Picorna-like viruses (order Picornavirales) infecting Apis mellifera L. populations. Virol. J. 2008, 5, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Culley, A.I.; Lang, A.S.; Suttle, C.A. High diversity of unknown Picorna-like viruses in the sea. Nature 2003, 424, 1054–1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koonin, E.V.; Wolf, Y.I.; Nagasaki, K.; Dolja, V.V. The big bang of Picorna-like virus evolution antedates the radiation of eukaryotic supergroups. Nat. Rev. Microbiol. 2008, 6, 925–939. [Google Scholar] [CrossRef] [Scilit]
- Fujiyuki, T.; Ohka, S.; Takeuchi, H.; Ono, M.; Nomoto, A.; Kubo, T. Prevalence and phylogeny of Kakugo virus, a novel insect Picorna-like virus that infects the honeybee (Apis mellifera L.), under various colony conditions. J. Virol. 2006, 80, 11528–11538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kavinseksan, B.; Wongsiri, S. Grooming behavior of Apis dorsata Fabricius, Thai commercial, and Primorsky honey bees (Apis mellifera Linnaeus) to the bee mite Euvarroa sinhai Delfinado & Baker. J. Asia Pac. Entomol. 2016, 19, 359–363. [Google Scholar] [CrossRef] [Scilit]
- Martin, S.J.; Highfield, A.C.; Brettell, L.; Villalobos, E.M.; Budge, G.E.; Powell, M.; Nikaido, S.; Schroeder, D.C. Global honey bee viral landscape altered by a parasitic mite. Science 2012, 336, 1304–1306. [Google Scholar] [CrossRef] [Scilit]
- Chantawannakul, P.; de Guzman, L.I.; Li, J.; Williams, G.R. Parasites, pathogens, and pests of honeybees in Asia. Apidologie 2016, 47, 301–324. [Google Scholar] [CrossRef] [Scilit]
- Moritz, R.F.A.; Haddad, N.; Bataieneh, A.; Shalmon, B.; Hefetz, A. Invasion of the dwarf honeybee Apis florea into the Near East. Biol. Invasions 2010, 12, 1093–1099. [Google Scholar] [CrossRef] [Scilit]
- El-Niweiri, M.A.A.; Moritz, R.F.A.; Lattorff, M.G.H. The invasion of the dwarf honeybee, Apis florea, along the River Nile in Sudan. Insects 2019, 10, 405. [Google Scholar] [CrossRef] [Scilit]
- Abou-Shaara, H.; Mahfouz, H.; Owayss, A. Species distribution modeling of potential invasion of dwarf honey bee, Apis florea Fab., to Africa and Europe after occurrence in Egypt in view of climatic changes. J. Plant Prot. Pathol. 2021, 12, 609–614. [Google Scholar] [CrossRef] [Scilit]
- Manley, R.; Temperton, B.; Doyle, T.; Gates, D.; Hedges, S.; Boots, M.; Wilfert, L. Knock-on community impacts of a novel vector: Spillover of emerging DWV-B from Varroa-infested honeybees to wild bumblebees. Ecol. Lett. 2019, 22, 1306–1315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gisder, S.; Aumeier, P.; Genersch, E. Deformed wing virus: Replication and viral load in mites (Varroa destructor). J. Gen. Virol. 2009, 90, 463–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Möckel, N.; Gisder, S.; Genersch, E. Horizontal transmission of Deformed wing virus: Pathological consequences in adult bees (Apis mellifera) depend on the transmission route. J. Gen. Virol. 2011, 92, 370–377. [Google Scholar] [CrossRef] [Scilit]
- Khongphinitbunjong, K.; Neumann, P.; Chantawannakul, P.; Williams, G.R. The ectoparasitic mite Tropilaelaps mercedesae reduces western honey bee, Apis mellifera, longevity and emergence weight, and promotes Deformed wing virus infections. J. Invertebr. Pathol. 2016, 137, 38–42. [Google Scholar] [CrossRef] [Scilit]
- Ryabov, E.V.; Wood, G.R.; Fannon, J.M.; Moore, J.D.; Bull, J.C.; Chandler, D.; Mead, A.; Burroughs, N.; Evans, D.J. A virulent strain of Deformed wing virus (DWV) of honeybees (Apis mellifera) prevails after Varroa destructor-mediated, or in vitro, transmission. PLoS Pathog. 2014, 10, e1004230. [Google Scholar] [CrossRef] [Scilit]
- Reddy, K.E.; Thu, H.T.; Yoo, M.S.; Ramya, M.; Reddy, B.A.; Kim Lien, N.T.; Phuong Trang, N.T.; Thuy Duong, B.T.; Lee, H.J.; Kang, S.W.; et al. Comparative genomic analysis for genetic variation in Sacbrood virus of Apis cerana and Apis mellifera honeybees from different regions of Vietnam. J. Insect Sci. 2017, 17, 101. [Google Scholar] [CrossRef] [Scilit]



| Primer Pairs | Sequence (5′-3′) | Amplicon Size (nt) | Nucleotide Position * |
|---|---|---|---|
| DWV-F4 DWV-R4 | CATTGGTATGCTCCGTTGACTG CTCTTGCGCCATGGTCCAC | 2330 | 6866–9199 |
| DWV-C4-1 | CCTGGTAGTAAGTGGCG | ||
| DWV-F7 DWV-R7 | GCGATTTATGCCTTCCATAGCG CTCWGGYTTTGCCTGCACCG | 1780 | 1–1777 |
| DWV-F8 DWV-R8 | CATATAGACCATGGTGGGTGCG CGCATCTTTGCTGCCTGAGC | 1550 | 3144–4698 |
| DWV-F9 DWV-R9 | GCGCTGCATCTAGTTATGC GCACGATAGGAGAATGGACC | 1380 | 4416–5795 |
| DWV-F9-2 DWV-R9-2 | GTGATGCTGTGTCTACTGG GGAGTACGACTCGCACG | 1340 | 4270–5637 |
| DWV-F12 DWV-R12 | CCAGGACCTGATGGCGAG GCTATGCCACACTCCAGC | 1640 | 1493–3433 |
| DWV-F12-2 DWV-R12-2 | AKCTAATCCGGTGCAGGC GTACTAGGAGCATCAGTCG | 1460 | 1747–3211 |
| DWV-F13 DWV-R13 | TATCTTGGAATACTAGTGCTGG TATCTTGGAATACTAGTGCTGG | 1470 | 8614–10,079 |
| DWV-F7-3 DWV-R11-3 | CTACGGTACGTTACGTTCG GGACCAGTAGCACTCATC | 1560 | 875–2433 |
| Oligo(dT)18 | d (TTT TTT TTT TTT TTT TTT) |
| Accession Number | Host Species | Geographic Origin |
|---|---|---|
| AJ489744.2 | Apis mellifera | Italy (IT) |
| AY292384.1 | Apis mellifera | Italy (IT) |
| MT415949.1 | Apis mellifera | United Kingdom (GB) |
| GU109335.1 | Apis mellifera | United Kingdom (GB) |
| MG831201.1 | Apis mellifera | United States (US) |
| MH069503.1 | Apis mellifera | United States (US) |
| MF623172.1 | Apis mellifera | New Zealand (NZ) |
| MN538208.1 | Apis mellifera | New Zealand (NZ) |
| MH267695.1 | Apis mellifera | Sweden (SE) |
| MN746311.1 | Apis mellifera | Sweden (SE) |
| KX373899.2 | Apis mellifera | France (FR) |
| AB070959.1 | Apis mellifera | Japan (JP) |
| JX878304.1 | Apis mellifera | South Korea (KR) |
| MF770715.1 | Apis mellifera | China (CN) |
| KX783225.1 | Apis mellifera | Belgium (BE) |
| CEND01000001.1 | Apis mellifera | United Kingdom (GB) |
| MH165180.1 | Apis cerana | China (CN) |
| KY909333.1 | Vespa crabro | Italy (IT) |
| MT747986.1 | Vespa velutina | Italy (IT) |
| AY251269.2 | Varroa destructor | Netherlands (NL) |
| NC_006494.1 | Varroa destructor | Netherlands (NL) |
| MW222481.1 | Medauroidea extradentata | United States (US) |
| Sample Source | Sample Size (Af/Am) | Location | A. florea (Af) * | A. mellifera (Am) * | ||||
|---|---|---|---|---|---|---|---|---|
| DWV-A | DWV-B | DWV-A | DWV-B | |||||
| DWV | KV | DWV | KV | |||||
| OPEN SPACE | ||||||||
| 5/3 | Qianzhen | negative | positive | negative | negative | negative | negative | |
| 5/3 | Qianzhen | positive | positive | negative | negative | negative | negative | |
| 6/2 | Qianzhen | negative | positive | negative | negative | negative | negative | |
| 5/0 | Qianzhen | negative | positive | negative | ||||
| 5/2 | Gushan | negative | positive | negative | negative | positive | negative | |
| 5/0 | Gushan | negative | positive | negative | ||||
| 4/4 | Fengshan | negative | positive | negative | negative | positive | negative | |
| 5/4 | Fengshan | negative | positive | negative | negative | positive | negative | |
| 8/0 | Fengshan | negative | positive | negative | ||||
| 8/1 | Qijin | negative | positive | negative | negative | negative | negative | |
| 14/2 | Qijin | negative | positive | negative | positive | negative | negative | |
| 4/4 | Gangshan | negative | positive | negative | negative | positive | negative | |
| 4/3 | Lingya | negative | positive | negative | negative | negative | negative | |
| NEST | ||||||||
| 4/0 | Xiaogang | positive | positive | negative | ||||
| 6/0 | Xiaogang | negative | positive | negative | ||||
| 4/0 | Qianzhen | positive | positive | negative | ||||
| 4/0 | Qianzhen | positive | positive | negative | ||||
| 4/0 | Qianzhen | positive | positive | negative | ||||
| 5/0 | Gushan | negative | positive | negative | ||||
| 7/0 | Gushan | negative | positive | negative | ||||
| 6/0 | Lingya | negative | positive | negative | ||||
| 6/0 | Lingya | negative | positive | negative | ||||
| 8/0 | Lingya | positive | positive | negative | ||||
| 8/0 | Fengshan | negative | positive | negative | ||||
| 6/0 | Qijin | negative | positive | negative | ||||
| Sample Source | Species | Sample Size | DWV-A (DWV/KV) * (%) | |
|---|---|---|---|---|
| DWV Positive | KV Positive | |||
| Nest | A. florea | 72 | 11 (15.3%) | 68 (94.4%) |
| Open Space | A. florea | 78 | 1 (1.3%) | 54 (69.2%) |
| Open Space | A. mellifera | 28 | 1 (3.6%) | 9 (32.1%) |
| Nest | E. sinhai | 5 | 0 | 5 (100%) |
| Nest | V. destructor | 7 | 0 | 7 (100%) |
| AF01 (AF01T243) | Sequence Identity (%) | |||
|---|---|---|---|---|
| ES01 (ES01TFS11) | DWV-A (AJ489744.2) | DWV-B (AY251269.2) | DWV-C (CEND01000001.1) | |
| Nucleotide sequence | ||||
| 3′ UTR | 99.9 | 95.6 | 89.9 | 86.9 |
| 5′ UTR | 99.7 | 94.0 | 82.6 | 82.8 |
| Entire polyprotein | 98.2 | 89.0 | 83.0 | 79.1 |
| Leader protein | 99.5 | 82.0 | 74.8 | 65.2 |
| Capsid protein | 99.8 | 86.9 | 82.6 | 79.3 |
| Helicase | 93.5 | 94.1 | 87.5 | 82.1 |
| 3C + RdRp | 99.9 | 89.2 | 84.5 | 82.0 |
| Amino acid sequence | ||||
| Entire polyprotein | 99.4 | 95.2 | 93.6 | 88.6 |
| Leader protein | 99.5 | 84.4 | 78.7 | 66.8 |
| Capsid protein | 99.9 | 96.0 | 95.4 | 89.7 |
| Helicase | 98.9 | 98.1 | 97.5 | 93.9 |
| 3C + RdRp | 100 | 97.6 | 96.8 | 93.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, J.-X.; Tsai, W.-S.; Sung, I.-H. A Novel Variant of Deformed Wing Virus (DWV) from the Invasive Honeybee Apis florea (Apidae, Hymenoptera) and Its Ectoparasite Euvarroa sinhai (Acarina, Mesostigmata) in Taiwan. Insects 2023, 14, 103. https://doi.org/10.3390/insects14020103
Tian J-X, Tsai W-S, Sung I-H. A Novel Variant of Deformed Wing Virus (DWV) from the Invasive Honeybee Apis florea (Apidae, Hymenoptera) and Its Ectoparasite Euvarroa sinhai (Acarina, Mesostigmata) in Taiwan. Insects. 2023; 14(2):103. https://doi.org/10.3390/insects14020103
Chicago/Turabian StyleTian, Jin-Xuan, Wen-Shi Tsai, and I-Hsin Sung. 2023. "A Novel Variant of Deformed Wing Virus (DWV) from the Invasive Honeybee Apis florea (Apidae, Hymenoptera) and Its Ectoparasite Euvarroa sinhai (Acarina, Mesostigmata) in Taiwan" Insects 14, no. 2: 103. https://doi.org/10.3390/insects14020103
APA StyleTian, J.-X., Tsai, W.-S., & Sung, I.-H. (2023). A Novel Variant of Deformed Wing Virus (DWV) from the Invasive Honeybee Apis florea (Apidae, Hymenoptera) and Its Ectoparasite Euvarroa sinhai (Acarina, Mesostigmata) in Taiwan. Insects, 14(2), 103. https://doi.org/10.3390/insects14020103

