Population Genetic Structure of the Bean Leaf Beetle Ootheca mutabilis (Coleoptera: Chrysomelidae) in Uganda
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Identification of Bean Leaf Beetles
2.3. DNA Isolation and Quantification
2.4. Genome Sequencing, Quality Check and Raw Read Assembly
2.5. Microsatellite Prediction, Primer Design and Blast Search of Microsatellite Sequences in GenBank
2.6. Microsatellite DNA Marker PCR Optimization, Polymorphism Testing, Primer Labelling and Fragment Analysis
2.7. Genotyping and Data Scoring
2.8. Population Genetic Structure and Differentiation Analysis
2.9. Isolation by Distance (IBD) Analysis
3. Results
3.1. Quality Check of NGS Sequences, De Novo Assembly, SSR Prediction and Primer Design
3.2. Microsatellite PCR Optimization and Polymorphism Testing
3.3. Fragment Analysis and Allele Scoring
3.4. Population Genetic Structure, Differentiation and Gene Flow
3.5. Isolation by Distance (IBD)
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Minja, M. Promotion of integrated pest management strategies of major insect pests of Phaseolus beans in hillside systems in eastern and southern Africa. In Crop Protection Programme; Final Technical Report; DFID; CIAT: Kigali, Rwanda, 2005. [Google Scholar]
- Adipala, E.; Omongo, C.A.; Sabiti, A.; Obuo, J.E.; Edema, R.; Bua, B.; Atyang, A.; Nsubuga, E.N.; Ogenga-latigo, M.W. Pests and diseases on cowpea in Uganda: Experiences from a diagnostic survey. Afr. Crop Sci. J. 1999, 7, 465–478. [Google Scholar] [CrossRef]
- Kyamanywa, S.; Mukibi, J.; Otim, M. Use of trap crops for management of bean leaf beetles (Ootheca spp.) in Apac district of Uganda. In African Crop Science Conference Proceedings; African Crop Science Society: Kampala, Uganda, 2001; Volume 5, pp. 167–170. [Google Scholar]
- Halerimana, C.; Kyamanywa, S.; Olaboro, S.; Paparu, P.; Nkalubo, S.T.; Colvin, J.; Cheke, R.A.; Wagner, T.; Seal, S.E.; Kriticos, D.J.; et al. Distribution and relative abundance of bean leaf beetles (Ootheca spp.) (Insecta: Coleoptera: Chrysomelidae) in Uganda. Insects 2021, 12, 1048. [Google Scholar] [CrossRef] [PubMed]
- Ampofo, J.K.O.; Massomo, S.M. Host effects on bean foliage beetle (Coleoptera: Chrysomelidae) emergence pattern in northern Tanzania. Bean Improv. Cooperative. Annu. Rep. 1999, 109, 110. [Google Scholar]
- Allen David, J.; Ampofo, J.K.O.; Wortmann Charles, S. Pests, Diseases, and Nutritional Disorders of the Common Bean in Africa: A Field Guide; CIAT Publication No. 260; Centro Internacional de Agricultura Tropical (CIAT): Wageningen, NE, USA; Technical Centre for Agricultural and Rural Cooperation (TCA): Cali, CO, USA, 1996; 132p. [Google Scholar]
- Sastry, K.S. Seed-Borne Plant Virus Diseases; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2013; ISBN 978-81-322-0813-6. (eBook). [Google Scholar]
- Halerimana, C. Distribution of bean leaf beetles and associated yield losses. Master’s Thesis, Makerere University, Kampala, Uganda, 2019. [Google Scholar]
- Kortenhaus, S.; Wagner, T. Revision of Ootheca Chevrolat, 1837 from tropical Africa–Redescriptions, descriptions of new species and identification key (Coleoptera: Chrysomelidae: Galerucinae). Zootaxa 2010, 2659, 1–52. [Google Scholar] [CrossRef]
- Crozier, R.H.; Oldroyd, B.P.; Tay, W.T.; Kaufmann, B.E.; Johnson, R.N.; Carew, M.E.; Jennings, K.M. Molecular advances in understanding social insect population structure. Electrophoresis 1997, 18, 1672–1675. [Google Scholar] [CrossRef] [PubMed]
- Moges, A.D.; Admassu, B.; Belew, D.; Yesuf, M.; Njuguna, J.; Kyalo, M.; Ghimire, S.R. Development of microsatellite markers and analysis of genetic diversity and population structure of Colletotrichum gloeosporioides from Ethiopia. PLoS ONE 2016, 11, e0151257. [Google Scholar] [CrossRef] [PubMed]
- Tay, W.T.; Crozier, R.H. Mating behaviour of Rhytidoponera sp. 12 ants inferred from microsatellite analysis. Mol. Ecol. 2001, 10, 167–173. [Google Scholar] [CrossRef]
- Tay, W.T.; Miettinen, M.; Kaitala, A. Do male golden egg bugs carry eggs they have fertilized? A microsatellite analysis. Behav. Ecol. 2003, 14, 481–485. [Google Scholar] [CrossRef][Green Version]
- Hammond, R.L.; Bourke, A.F.; Bruford, M.W. Mating frequency and mating system of the polygynous ant, Leptothorax acervorum. Mol. Ecol. 2001, 10, 2719–2728. [Google Scholar] [CrossRef]
- Renault, D. A Review of the phenotypic traits associated with insect dispersal polymorphism, and experimental designs for sorting out resident and disperser phenotypes. Insects 2020, 11, 214. [Google Scholar] [CrossRef]
- Lombaert, E.; Boll, R.; Lapchin, L. Dispersal strategies of phytophagous insects at a local scale: Adaptive potential of aphids in an agricultural environment. BMC Evol. Biol. 2006, 6, 75. [Google Scholar] [CrossRef] [PubMed]
- Roberts, J.M.K.; Anderson, D.; Tay, W.T. Multiple host shifts by the emerging honeybee parasite. Varroa Jacobsoni. Mol. Ecol. 2015, 24, 2379–2391. [Google Scholar] [CrossRef] [PubMed]
- Tay, W.T.; Behere, G.T.; Batterham, P.; Heckel, D.G. Generation of microsatellite repeat families by RTE retrotransposons in lepidopteran genomes. BMC Evol. Biol. 2010, 10, 144. [Google Scholar] [CrossRef] [PubMed]
- Gordon, K.; Tay, W.T.; Collinge, D.; Williams, A.; Batterham, P. Genetics and molecular biology of the major crop pest genus Helicoverpa. In Molecular Biology and Genetics of the Lepidoptera; Goldsmith, M.R., Marec, F., Eds.; CRC Press: Boca Raton, FL, USA, 2009; pp. 219–238. [Google Scholar]
- Sinama, M.; Dubut, V.; Costedoat, C.; Gilles, A.; Junker, M.; Malausa, T.; Jean-françois, M.; Nève, G.; Pech, N.; Schmitt, T.; et al. Challenges of microsatellite development in Lepidoptera: Euphydryas aurinia (Nymphalidae) as a case study. EJE 2011, 108, 261–266. [Google Scholar] [CrossRef]
- Zhang, D.X. Lepidopteran microsatellite DNA: Redundant but promising. Trends Ecol. Evol. 2004, 19, 507–509. [Google Scholar] [CrossRef]
- Mckeown, N.; Harvey, D.; Healey, A.; Skujina, I.; Cox, K.; Gange, A.C.; Shaw, P. Isolation and characterisation of the first microsatellite markers for the European stag beetle, Lucanus cervus (Coleoptera: Lucanidae). Eur. J. Entomol. 2018, 115, 620–623. [Google Scholar] [CrossRef]
- Drury, D.W.; Siniard, A.L.; Wade, M.J. Genetic differentiation among wild populations of Tribolium castaneum estimated using microsatellite markers. J. Hered. 2009, 100, 732–741. [Google Scholar] [CrossRef]
- Ekblom, R.; Galindo, J. Applications of next generation sequencing in molecular ecology of non-model organisms. Heredity 2011, 107, 1. [Google Scholar] [CrossRef]
- Weber, J.L.; Wong, C. Mutation of human short tandem repeats. Hum. Mol. Genet. 1993, 2, 1123–1128. [Google Scholar] [CrossRef]
- Hancock, J.M. Microsatellites and other simple sequences: Genomic context and mutational mechanisms. In Microsatellites Evolution, Applications; Goldstein, D.B., Schlötterer, C., Eds.; New York Oxford University Press: New York, NY, USA, 1999; pp. 1–9. [Google Scholar]
- Randi, E.; Pierpaoli, M.; Danilkin, A. Mitochondrial DNA polymorphism in populations of Siberian and European roe deer (Capreolus pygargus and C. capreolus). Heredity 1998, 80, 429–437. [Google Scholar] [CrossRef] [PubMed]
- Papura, D.; Burban, C.; van Helden, M.; Giresse, X.; Nusillard, B.; Guillemaud, T.; Kerdelhué, C. Microsatellite and Mitochondrial Data Provide Evidence for a Single Major Introduction for the Neartic Leafhopper Scaphoideus titanus in Europe. PLoS ONE 2012, 7, e36882. [Google Scholar] [CrossRef]
- Mugerwa, H.; Colvin, J.; Alicai, T.; Omongo, C.A.; Kabaalu, R.; Visendi, P.; Seal, S.E. Genetic diversity of whitefly (Bemisia spp.) on crop and uncultivated plants in Uganda: Implications for the control of this devastating pest species complex in Africa. J. Pest Sci. 2021, 94, 1307–1330. [Google Scholar] [CrossRef] [PubMed]
- Otim, M.H.; Adumo Aropet, S.; Opio, M.; Kanyesigye, D.; Nakelet Opolot, H.; Tay, W.T. Parasitoid distribution and parasitism of the fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) in different maize producing regions of Uganda. Insects 2021, 12, 121. [Google Scholar] [CrossRef] [PubMed]
- Otim, M.H.; Tay, W.T.; Walsh, T.K.; Kanyesigye, D.; Adumo, S.; Abongosi, J.; Ochen, S.; Sserumaga, J.; Alibu, S.; Abalo, G. Detection of sister-species in invasive populations of the fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) from Uganda. PLoS ONE 2018, 13, e0194571. [Google Scholar]
- Staden, R.; Beal, K.F.; Bonfield, J.K. The staden package, 1998. In Bioinformatics Methods and Protocols; Springer: Berlin/Heidelberg, Germany, 2000; pp. 115–130. [Google Scholar]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 15 February 2018).
- Kearse, M.; Moir, R.; Wilson, A.; Stones-havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
- Martins, W.S.; Lucas, D.C.S.; De Souza Neves, K.F.; Bertioli, D.J. WebSat A web software for microsatellite marker development. Bioinformation 2009, 3, 282. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar]
- Taubs, G. Sense from sequences: Stephen F. Altschul on bettering BLAST. Sci. Watch. 2000, 11, 3–4. [Google Scholar]
- Hulce, D.; Li, X.; Snyder-Leiby, T.; Liu, C.J. GeneMarker® genotyping software: Tools to increase the statistical power of DNA fragment analysis. J. Biomol. Tech. 2011, 22, S35. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
- Gutiérrez, J.P.; Royo, L.; Álvarez, I.; Goyache, F. MolKin v2. 0: A computer program for genetic analysis of populations using molecular coancestry information. J. Hered. 2005, 96, 718–721. [Google Scholar] [CrossRef] [PubMed]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-Delbarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [PubMed]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Res. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
- Dupanloup, I.; Schneidera, S.; Excoffier, N.L. A simulated annealing approach to define the genetic structure of populations. Mol. Ecol. 2002, 11, 2571–2581. [Google Scholar] [CrossRef] [PubMed]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Earl, D.A.; Vonholdt, B.M. Structure Harvester: A website and program for visualizing Structure output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software Structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
- Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
- Leigh, J.W.; Bryant, D. POPART: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Mantel, N.; Haenszel, W. Statistical aspects of the analysis of data from retrospective studies of disease. J. Natl. Cancer Inst. 1959, 22, 719–748. [Google Scholar] [PubMed]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Resour. 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Shete, S.; Tiwari, H.; Elston, R.C. On estimating the heterozygosity and polymorphism information content value. Theor. Popul. Biol. 2000, 57, 265–271. [Google Scholar] [CrossRef] [PubMed]
- Nei, M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978, 23, 341–369. [Google Scholar] [CrossRef] [PubMed]
- De León, J.H.; Jones, W.A.; Morgan, D.J. Population genetic structure of Homalodisca coagulata (Homoptera: Cicadellidae), the vector of the bacterium Xylella fastidiosa causing Pierce’s disease in grapevines. Ann. Entomol. Soc. Am. 2004, 97, 809–818. [Google Scholar]
- Alam, M.Z.; Crump, A.R.; Haque, M.M.; Islam, M.S.; Hossain, E.; Hasan, S.B.; Hasan, S.B.; Hossain, M.S. Effects of Integrated Pest Management on Pest Damage and Yield Components in a Rice Agro-Ecosystem in the Barisal Region of Bangladesh. Front. Environ. Sci. 2016, 4, 22. [Google Scholar] [CrossRef]
- Tiroesele, B.; Skoda, S.R.; Hunt, T.E.; Lee, D.J.; Molina-ochoa, J.; Foster, J.E. Population structure, genetic variability, and gene flow of the bean leaf beetle, Cerotoma trifurcata, in the Midwestern United States. J. Insect Sci. 2014, 14, 62. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Krell, R.K.; Wilson, T.A.; Pedigo, L.P.; Rice, M.E. Characterization of bean leaf beetle (Coleoptera: Chrysomelidae) flight capacity. J. Kans. Entomol. Soc. 2003, 406–416. [Google Scholar]
- The influence of dispersal and diet breadth on patterns of genetic isolation by distance in phytophagous insects. Am. Nat. 1998, 152, 428–446. [CrossRef]
- von Mérey, G.E.; Veyrat, N.; D’Alessandro, M.; Turlings, T.C.J. Herbivore-induced maize leaf volatiles affect attraction and feeding behavior of Spodoptera littoralis caterpillars. Front. Plant Sci. 2013, 4, 209. [Google Scholar] [CrossRef]
- Elfekih, S.; Tay, W.T.; Polaszek, A.; Gordon, K.H.J.; Kunz, D.; Macfadyen, S.; De Barro, P.J. On species delimitation, hybridization and population structure of cassava whitefly in Africa. Sci. Rep. 2021, 11, 7923. [Google Scholar] [CrossRef]
- Lehmann, T.; Hawley, W.; Grebert, H.; Danga, M.; Atieli, F.; Collins, F. The rift valley complex as a barrier to gene flow for Anopheles gambiae in Kenya. J. Hered. 1999, 90, 613–621. [Google Scholar] [CrossRef]
- Sezonlin, M.; Dupas, S.; Le Rü, B.; Le Gall, P.; Moyal, P.; Calatayud, P.A.; Giffard, I.; Faure, N.; Silvain, J.F. Phylogeography and population genetics of the maize stalk borer Busseola fusca (Lepidoptera, Noctuidae) in sub-Saharan Africa. Mol. Ecol. 2006, 15, 407–420. [Google Scholar] [CrossRef] [PubMed]
- Anderson, C.; Tay, W.T.; Mcgaughran, A.; Gordon, K.; Walsh, T.K. Population structure and gene flow in the global pest, Helicoverpa armigera. Mol. Ecol. 2016, 25, 5296–5311. [Google Scholar] [CrossRef]
- Behere, G.T.; Tay, W.T.; Russell, D.A.; Heckel, D.G.; Appleton, B.R.; Kranthi, K.R.; Batterham, P. Mitochondrial DNA analysis of field populations of Helicoverpa armigera (Lepidoptera: Noctuidae) and of its relationship to H. zea. BMC Evol. Biol. 2007, 7, 117. [Google Scholar] [CrossRef] [PubMed]
- Behere, G.; Tay, W.; Russell, D.; Batterham, P. Molecular markers to discriminate among four pest species of Helicoverpa (Lepidoptera: Noctuidae). Bull. Entomol. Res. 2008, 98, 599. [Google Scholar] [CrossRef] [PubMed]
- Elfekih, S.; Tay, W.T.; Gordon, K.; Court, L.N.; De Barro, P.J. Standardized molecular diagnostic tool for the identification of cryptic species within the Bemisia tabaci complex. Pest Manag. Sci. 2018, 74, 170–173. [Google Scholar] [CrossRef]
- Tay, W.T.; Beckett, S.J.; De Barro, P.J. Phosphine resistance in Australian Cryptolestes species (Coleoptera: Laemophloeidae): Perspectives from mitochondrial DNA cytochrome oxidase I analysis. Pest Manag. Sci. 2016, 72, 1250–1259. [Google Scholar] [CrossRef]









| District | Latitude | Longitude | Collectors | Samples Collected |
|---|---|---|---|---|
| Dokolo | 2.01148 | 33.1367 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 58 |
| Lira | 2.50196 | 32.91012 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 41 |
| Oyam | 2.3559 | 32.60652 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 30 |
| Apac | 1.88446 | 32.37174 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 35 |
| Amuru | 2.81492 | 31.98196 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 45 |
| Gulu | 2.96032 | 32.41548 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 36 |
| Nwoya | 2.62473 | 32.14631 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 42 |
| Bulisa | 1.76197 | 31.43002 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 45 |
| Hoima | 1.50097 | 31.33689 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 20 |
| Nakasongola | 1.46927 | 32.2695 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 25 |
| Amuria | 2.0574 | 33.50213 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 37 |
| Soroti | 5.37120 | 21.94900 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 22 |
| Adjumani | 3.25633 | 33.7836 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 30 |
| Zombo | 2.51592 | 31.00431 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 20 |
| Koboko | 3.38206 | 31.06935 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 21 |
| Moyo | 3.70361 | 31.67643 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 24 |
| Arua | 3.15309 | 31.01043 | Charles. H, Dalton. K, Sam. O, Sekandi. W | 23 |
| Population Code | Agro-Ecological Zone | Number of O. mutabilis Samples Analyzed | Districts | |
|---|---|---|---|---|
| O. mutabilis | O. proteus | |||
| A | Northern moist farmlands | 5 | 0 | Dokolo |
| 5 | 0 | Lira | ||
| 6 | 0 | Oyam | ||
| 5 | 0 | Apac | ||
| 8 | 0 | Amuru | ||
| 4 | 0 | Gulu | ||
| 7 | 0 | Nwoya | ||
| B | Western mid-altitude farmlands | 10 | 0 | Bulisa |
| 1 | 9 | Hoima | ||
| C | Central wooden savannah | 4 | 3 | Nakasongola |
| 0 | 0 | Lwengo | ||
| D | Southern and Eastern Lake Kyoga basin | 9 | 0 | Amuria |
| 4 | 0 | Soroti | ||
| E | North-western farmlands | 5 | 0 | Adjumani |
| 3 | 0 | Zombo | ||
| 4 | 0 | Koboko | ||
| 3 | 0 | Moyo | ||
| 4 | 0 | Arua | ||
| Locus Name | Motif | Size (bp) | Primer Sequence 5′ 3′ | GenBank Accession Number | NA | Tm (°C) | Fluorescent Label |
|---|---|---|---|---|---|---|---|
| BLB2_om1 | (GAT)2(CAA)11 | 343–365 | F: TCAACTACCACCATCACAAACC R: CAATGTGGAGCAACTACGTCAT | MT074093 | 9 | 58 | 5′6-FAM |
| BLB2_om17 | (CTT)10 | 368–396 | F: CCAATCCGCTTCTCTATATCCA R: GGAGCAATGTTATGCCTGATTT | MT074094 | 16 | 57 | 5′6-FAM |
| BLB2_om32 | (GACG)6 | 160–195 | F: CATATAGCGAAAACCCGAAATC R:AGAAGTACAAGTATGGCCCGAA | MT074096 | 21 | 58 | 5′6-FAM |
| BLB2_om33 | (ACA)5.(ACG).(ACA)16 | 256–288 | F: ATTGAAAGTTGTATCGGTCGCT R: CTTGACATGAAAACGAGATCCA | MT074095 | 4 | 58 | 5′HEX |
| BLB2_om66 | (AGT)2(AGC)7 | 337–345 | F: CTATGGTCGTTTTCTCCGACAT R: GACGTTTCTTCTCGGTTGTAGC | MT074097 | 8 | 60 | 5′HEX |
| Locus Name | He | PIC |
|---|---|---|
| BLB_om1 | 0.75 | 75.0% |
| BLB_om17 | 0.65 | 58.8% |
| BLB_om32 | 0.80 | 78.5% |
| BLB_om33 | 0.84 | 83.1% |
| BLB_om66 | 0.59 | 50.1% |
| Average | 0.73 | 69.1% |
| Population Code | Ho | He | PIC |
|---|---|---|---|
| A | 0.82 | 0.72 | 56.97% |
| B | 0.80 | 0.68 | 51.48% |
| C | 0.75 | 0.66 | 47.42% |
| D | 0.84 | 0.73 | 57.72% |
| E | 0.78 | 0.70 | 54.36% |
| Average | 0.80 | 0.70 | 53.59% |
| Population | Number of Sequences | Number of Segregating Sites | h | Hd | K | π |
|---|---|---|---|---|---|---|
| Dokolo | 5 | 1 | 2 | 0.4 | 0.4 | 0 |
| Lira | 5 | 3 | 4 | 0.9 | 1.2 | 0 |
| Oyam | 6 | 2 | 3 | 0.6 | 0.67 | 0 |
| Apac | 5 | 1 | 2 | 0.4 | 0.4 | 0 |
| Amuru | 8 | 6 | 4 | 0.64 | 1.68 | 0 |
| Gulu | 4 | 1 | 2 | 0.5 | 0.5 | 0 |
| Nwoya | 7 | 4 | 3 | 0.52 | 1.14 | 0 |
| Bulisa | 10 | 4 | 4 | 0.53 | 0.96 | 0 |
| Nakasongola | 4 | 2 | 2 | 0.5 | 1 | 0 |
| Amuria | 9 | 2 | 3 | 0.56 | 0.61 | 0 |
| Soroti | 4 | 1 | 2 | 0.5 | 0.5 | 0 |
| Adjumani | 5 | 0 | 1 | 0 | 0 | 0 |
| Zombo | 3 | 1 | 2 | 0.67 | 0.67 | 0 |
| Koboko | 4 | 2 | 3 | 0.83 | 1 | 0 |
| Moyo | 3 | 2 | 2 | 0.67 | 1.33 | 0 |
| Arua | 4 | 2 | 2 | 0.5 | 1 | 0 |
| (a1) | ||||
|---|---|---|---|---|
| Source of Variation | Sum of Squares | Variance Components | Percentage Variation (%) | |
| Among populations | 27.24 | 0.00122 Va | 0.07 | |
| Within populations | 264.05 | 1.780 Vb | 99.93 | |
| Total | 291.29 | 1.790 | 100 | |
| (a2) | ||||
| Source of Variation | Sum of Squares | Variance Components | Fixation Indices | |
| Among groups | 10.08 | 0.03722 Va | FST = 0.00582, p = 0.00880 | |
| Among populations within groups | 17.16 | −0.027 Vb | FSC = −0.01523, p = 0.42326 | |
| Within populations | 264.05 | 1.785 Vc | FCT = 0.02073, p = 0.00587 | |
| Total | 291.29 | 1.795 | ||
| (b1) | ||||
| Source of Variation | d.f | Sum of Squares | Variance Components | |
| Among populations | 15 | 5.83 | −0.00671 Va | |
| Within populations | 70 | 264.05 | 0.42450 Vb | |
| Total | 85 | 291.29 | 0.418 | |
| (b2) | ||||
| Source of Variation | d.f | Sum of Squares | Variance Components | Fixation Indices |
| Among groups | 4 | 1.71 | 0.00448 Va | FST = −0.01333, p = 0.73900 |
| Among populations within groups | 11 | 4.12 | −0.01007 Vb | FSC = −0.02429, p = 0.76051 |
| Within populations | 70 | 29.72 | 0.42450 Vc | FCT = 0.01070, p = 0.30108 |
| Total | 85 | 35.55 | 0.419 | |
| (a1) | ||||
|---|---|---|---|---|
| Source of Variation | d.f | Sum of Squares | Variance Components | |
| Among groups | 1 | 57,895.35 | 4273.04972 Va | |
| Among populations within groups | 14 | 143,369.46 | 387.00479 Vb | |
| Within populations | 156 | 935,627.3 | 5997.61091 Vc | |
| Total | 171 | 1,136,892.11 | 10,657.67 | |
| FCT = 0.40094, p = 0.05767 | ||||
| (a2) | ||||
| Source of Variation | d.f | Sum of Squares | Variance Components | |
| Among groups | 1 | 0.9284.904 | 0.04245 Va | |
| Among populations within groups | 14 | 4.9 | −0.01442 Vb | |
| Within populations | 70 | 29.72 | 0.42450 Vc | |
| Total | 85 | 35.55 | 0.45 | |
| FCT = 0.09381, p = 0.05474 | ||||
| (a3) | ||||
| Source of Variation | Sum of Squares | Variance Components | Percentage Variation (%) | |
| Among populations | 27.24 | 0.00122 Va | 0.07 | |
| Within populations | 264.05 | 1.78482 Vb | 99.93 | |
| Total | 291.29 | 1.79 | 100 | |
| FST = 0.00069 | ||||
| (a4) | ||||
| Source of Variation | d.f. | Sum of Squares | Variance Components | Percentage Variation (%) |
| Among populations | 15 | 5.83 | −0.00671 Va | −1.61 |
| Within populations | 70 | 29.72 | 0.42450 Vb | 101.61 |
| Total | 85 | 35.55 | 0.42 | 100 |
| FST = −0.01605 | ||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kanyesigye, D.; Alibu, V.P.; Tay, W.T.; Nalela, P.; Paparu, P.; Olaboro, S.; Nkalubo, S.T.; Kayondo, I.S.; Silva, G.; Seal, S.E.; et al. Population Genetic Structure of the Bean Leaf Beetle Ootheca mutabilis (Coleoptera: Chrysomelidae) in Uganda. Insects 2022, 13, 543. https://doi.org/10.3390/insects13060543
Kanyesigye D, Alibu VP, Tay WT, Nalela P, Paparu P, Olaboro S, Nkalubo ST, Kayondo IS, Silva G, Seal SE, et al. Population Genetic Structure of the Bean Leaf Beetle Ootheca mutabilis (Coleoptera: Chrysomelidae) in Uganda. Insects. 2022; 13(6):543. https://doi.org/10.3390/insects13060543
Chicago/Turabian StyleKanyesigye, Dalton, Vincent Pius Alibu, Wee Tek Tay, Polycarp Nalela, Pamela Paparu, Samuel Olaboro, Stanley Tamusange Nkalubo, Ismail Siraj Kayondo, Gonçalo Silva, Susan E. Seal, and et al. 2022. "Population Genetic Structure of the Bean Leaf Beetle Ootheca mutabilis (Coleoptera: Chrysomelidae) in Uganda" Insects 13, no. 6: 543. https://doi.org/10.3390/insects13060543
APA StyleKanyesigye, D., Alibu, V. P., Tay, W. T., Nalela, P., Paparu, P., Olaboro, S., Nkalubo, S. T., Kayondo, I. S., Silva, G., Seal, S. E., & Otim, M. H. (2022). Population Genetic Structure of the Bean Leaf Beetle Ootheca mutabilis (Coleoptera: Chrysomelidae) in Uganda. Insects, 13(6), 543. https://doi.org/10.3390/insects13060543


