A Comparison of RNA Interference via Injection and Feeding in Honey Bees
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. siRNA Preparation and Injection
2.3. RNA Preparation and qRT-PCR Assay
2.4. Effects of Different Modes of siRNA Delivery on the Survival of Honey Bees
2.5. Data Analysis and Statistics
3. Results
3.1. The Effects of RNA Interference Methods on the Survival of Honey Bees
3.2. The Effects of ALDH7A1 RNAi Knockdown on mRNA Levels
3.3. The Effects of 4CL RNAi Knockdown on mRNA Levels
3.4. The Effects of HSP70 RNAi Knockdown on mRNA Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Matzke, M.; Primig, M.; Trnovsky, J.; Matzke, A. Reversible methylation and inactivation of marker genes in sequentially transformed tobacco plants. EMBO J. 1989, 8, 643–649. [Google Scholar] [CrossRef] [PubMed]
- Bellés, X. Beyond Drosophila: RNAi in vivo and functional genomics in insects. Annu. Rev. Entomol. 2010, 55, 111–128. [Google Scholar] [CrossRef]
- Huvenne, H.; Smagghe, G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: A review. J. Insect Physiol. 2010, 56, 227–235. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Pitts, R.J.; Bohbot, J.D.; Jones, P.L.; Wang, G.; Zwiebel, L.J. Distinct olfactory signaling mechanisms in the malaria vector mosquito Anopheles gambiae. PLoS Biol. 2010, 8, e1000467. [Google Scholar] [CrossRef]
- Ament, S.A.; Corona, M.; Pollock, H.S.; Robinson, G.E. Insulin signaling is involved in the regulation of worker division of labor in honey bee colonies. Proc. Natl. Acad. Sci. USA 2008, 105, 4226–4231. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Azevedo, S.V.; Hartfelder, K.; Amdam, G.V. Insulin-like peptides (AmILP1 and AmILP2) differentially affect female caste development in the honey bee (Apis mellifera L.). J. Exp. Biol. 2013, 216, 4347–4357. [Google Scholar] [CrossRef] [PubMed]
- Beye, M.; Hasselmann, M.; Fondrk, M.K.; Page, R.E., Jr.; Omholt, S.W. The gene csd is the primary signal for sexual development in the honeybee and encodes an SR-type protein. Cell 2003, 114, 419–429. [Google Scholar] [CrossRef]
- Kohno, H.; Kubo, T. mKast is dispensable for normal development and sexual maturation of the male European honeybee. Sci. Rep. 2018, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Paoli, P.P.; Wakeling, L.A.; Wright, G.A.; Ford, D. The dietary proportion of essential amino acids and Sir2 influence lifespan in the honeybee. Age 2014, 36, 1239–1247. [Google Scholar] [CrossRef]
- Seehuus, S.-C.; Norberg, K.; Gimsa, U.; Krekling, T.; Amdam, G.V. Reproductive protein protects functionally sterile honey bee workers from oxidative stress. Proc. Natl. Acad. Sci. USA 2006, 103, 962–967. [Google Scholar] [CrossRef] [PubMed]
- Antonio, D.S.M.; Guidugli-Lazzarini, K.R.; Do Nascimento, A.M.; Simões, Z.L.P.; Hartfelder, K. RNAi-mediated silencing of vitellogenin gene function turns honeybee (Apis mellifera) workers into extremely precocious foragers. Sci. Nat. 2008, 95, 953–961. [Google Scholar] [CrossRef] [PubMed]
- Awata, H.; Wakuda, R.; Ishimaru, Y.; Matsuoka, Y.; Terao, K.; Katata, S.; Matsumoto, Y.; Hamanaka, Y.; Noji, S.; Mito, T. Roles of OA1 octopamine receptor and Dop1 dopamine receptor in mediating appetitive and aversive reinforcement revealed by RNAi studies. Sci. Rep. 2016, 6, 29696. [Google Scholar] [CrossRef] [PubMed]
- Cristino, A.S.; Barchuk, A.R.; Freitas, F.C.; Narayanan, R.K.; Biergans, S.D.; Zhao, Z.; Simoes, Z.L.; Reinhard, J.; Claudianos, C. Neuroligin-associated microRNA-932 targets actin and regulates memory in the honeybee. Nat. Commun. 2014, 5, 5529. [Google Scholar] [CrossRef] [PubMed]
- Scott, J.G.; Michel, K.; Bartholomay, L.C.; Siegfried, B.D.; Hunter, W.B.; Smagghe, G.; Zhu, K.Y.; Douglas, A.E. Towards the elements of successful insect RNAi. J. Insect Physiol. 2013, 59, 1212–1221. [Google Scholar] [CrossRef]
- Yang, D.; Xu, X.; Zhao, H.; Yang, S.; Wang, X.; Zhao, D.; Diao, Q.; Hou, C. Diverse factors affecting efficiency of RNAi in honey bee viruses. Front. Genet. 2018, 9, 384. [Google Scholar] [CrossRef]
- Whangbo, J.S.; Hunter, C.P. Environmental RNA interference. Trends Genet. 2008, 24, 297–305. [Google Scholar] [CrossRef] [PubMed]
- Wynant, N.; Duressa, T.F.; Santos, D.; Van Duppen, J.; Proost, P.; Huybrechts, R.; Broeck, J.V. Lipophorins can adhere to dsRNA, bacteria and fungi present in the hemolymph of the desert locust: A role as general scavenger for pathogens in the open body cavity. J. Insect Physiol. 2014, 64, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Evans, J.D.; Huang, Q.; Rodríguez-García, C.; Liu, J.; Hamilton, M.; Grozinger, C.M.; Webster, T.C.; Su, S.; Chen, Y.P. Silencing the honey bee (Apis mellifera) naked cuticle gene (nkd) improves host immune function and reduces Nosema ceranae infections. Appl. Environ. Microbiol. 2016, 82, 6779–6787. [Google Scholar] [CrossRef] [PubMed]
- Maori, E.; Paldi, N.; Shafir, S.; Kalev, H.; Tsur, E.; Glick, E.; Sela, I. IAPV, a bee-affecting virus associated with colony collapse disorder can be silenced by dsRNA ingestion. Insect Mol. Biol. 2009, 18, 55–60. [Google Scholar] [CrossRef]
- Guo, X.; Wang, Y.; Sinakevitch, I.; Lei, H.; Smith, B.H. Comparison of RNAi knockdown effect of tyramine receptor 1 induced by dsRNA and siRNA in brains of the honey bee, Apis mellifera. J. Insect Physiol. 2018, 111, 47–52. [Google Scholar] [CrossRef] [PubMed]
- Shukla, S.; Sumaria, C.S.; Pradeepkumar, P. Exploring chemical modifications for siRNA therapeutics: A structural and functional outlook. Chemmedchem 2010, 5, 328–349. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, M.; Asanuma, S.; Fujiyuki, T.; Kiya, T.; Sasaki, T.; Endo, D.; Morioka, M.; Kubo, T. Differential gene expression in the mandibular glands of queen and worker honeybees, Apis mellifera L.: Implications for caste-selective aldehyde and fatty acid metabolism. Insect Biochem. Mol. Biol. 2009, 39, 661–667. [Google Scholar] [CrossRef]
- Fong, W.-P.; Cheng, C.; Tang, W.-K. Antiquitin, a relatively unexplored member in the superfamily of aldehyde dehydrogenases with diversified physiological functions. Cell. Mol. Life Sci. 2006, 63, 2881–2885. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.-K.; Cheng, C.H.; Fong, W.-P. First purification of the antiquitin protein and demonstration of its enzymatic activity. FEBS Lett. 2002, 516, 183–186. [Google Scholar] [CrossRef]
- Demozay, D.; Rocchi, S.; Mas, J.-C.; Grillo, S.; Pirola, L.; Chavey, C.; Van Obberghen, E. Fatty aldehyde dehydrogenase: Potential role in oxidative stress protection and regulation of its gene expression by insulin. J. Biol. Chem. 2004, 279, 6261–6270. [Google Scholar] [CrossRef]
- Pena, I.A.; Roussel, Y.; Daniel, K.; Mongeon, K.; Johnstone, D.; Weinschutz Mendes, H.; Bosma, M.; Saxena, V.; Lepage, N.; Chakraborty, P. Pyridoxine-dependent epilepsy in zebrafish caused by Aldh7a1 deficiency. Genetics 2017, 207, 1501–1518. [Google Scholar] [CrossRef]
- Mao, W.; Schuler, M.A.; Berenbaum, M.R. A dietary phytochemical alters caste-associated gene expression in honey bees. Sci. Adv. 2015, 1, e1500795. [Google Scholar] [CrossRef]
- Islam, M.T.; Lee, B.-R.; Lee, H.; Jung, W.-J.; Bae, D.-W.; Kim, T.-H. p-Coumaric acid induces jasmonic acid-mediated phenolic accumulation and resistance to black rot disease in Brassica napus. Physiol. Mol. Plant Pathol. 2019, 106, 270–275. [Google Scholar] [CrossRef]
- Stuible, H.-P.; Büttner, D.; Ehlting, J.; Hahlbrock, K.; Kombrink, E. Mutational analysis of 4-coumarate: CoA ligase identifies functionally important amino acids and verifies its close relationship to other adenylate-forming enzymes. FEBS Lett. 2000, 467, 117–122. [Google Scholar] [CrossRef]
- Cukovica, D.; Ehlting, J.; Ziffle, J.A.V.; Douglas, C.J. Structure and evolution of 4-coumarate: Coenzyme A ligase (4CL) gene families. Biol. Chem. 2001, 382, 645–654. [Google Scholar] [CrossRef]
- Mosser, D.D.; Caron, A.W.; Bourget, L.; Denis-Larose, C.; Massie, B. Role of the human heat shock protein hsp70 in protection against stress-induced apoptosis. Mol. Cell. Biol. 1997, 17, 5317–5327. [Google Scholar] [CrossRef] [PubMed]
- Williams, J.B.; Roberts, S.P.; Elekonich, M.M. Age and natural metabolically-intensive behavior affect oxidative stress and antioxidant mechanisms. Exp. Gerontol. 2008, 43, 538–549. [Google Scholar] [CrossRef] [PubMed]
- Morammazi, S.; Shokrollahi, B. The pattern of HSP70 gene expression, flight activity and temperature in Apis mellifera meda Colonies. J. Therm. Biol. 2020, 91, 102647. [Google Scholar] [CrossRef] [PubMed]
- Reitmayer, C.M.; Ryalls, J.M.; Farthing, E.; Jackson, C.W.; Girling, R.D.; Newman, T.A. Acute exposure to diesel exhaust induces central nervous system stress and altered learning and memory in honey bees. Sci. Rep. 2019, 9, 5793. [Google Scholar] [CrossRef] [PubMed]
- Roberts, S.P.; Elekonich, M.M. Muscle biochemistry and the ontogeny of flight capacity during behavioral development in the honey bee, Apis mellifera. J. Exp. Biol. 2005, 208, 4193–4198. [Google Scholar] [CrossRef] [PubMed]
- Nunes, F.M.F.; Simões, Z.L.P. A non-invasive method for silencing gene transcription in honeybees maintained under natural conditions. Insect Biochem. Mol. Biol. 2009, 39, 157–160. [Google Scholar] [CrossRef]
- Mittal, V. Improving the efficiency of RNA interference in mammals. Nat. Rev. Genet. 2004, 5, 355–365. [Google Scholar] [CrossRef]
- Krautz-Peterson, G.; Radwanska, M.; Ndegwa, D.; Shoemaker, C.B.; Skelly, P.J. Optimizing gene suppression in schistosomes using RNA interference. Mol. Biochem. Parasitol. 2007, 153, 194–202. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhu, F.; Liu, Y.; Zheng, M.; Wang, Y.; Zhang, D.; Anraku, Y.; Zou, Y.; Li, J.; Wu, H. Blood-brain barrier–penetrating siRNA nanomedicine for Alzheimer’s disease therapy. Sci. Adv. 2020, 6, eabc7031. [Google Scholar] [CrossRef]
- Pardridge, W.M. shRNA and siRNA delivery to the brain. Adv. Drug Deliv. Rev. 2007, 59, 141–152. [Google Scholar] [CrossRef]
- Kohno, H.; Kubo, T. Genetics in the honey bee: Achievements and prospects toward the functional analysis of molecular and neural mechanisms underlying social behaviors. Insects 2019, 10, 348. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Martínez, F.C.; Guerra, J.; Posadas, I.; Ceña, V. Barriers to non-viral vector-mediated gene delivery in the nervous system. Pharm. Res. 2011, 28, 1843–1858. [Google Scholar] [CrossRef]
- Huang, R.; Ma, H.; Guo, Y.; Liu, S.; Kuang, Y.; Shao, K.; Li, J.; Liu, Y.; Han, L.; Huang, S. Angiopep-conjugated nanoparticles for targeted long-term gene therapy of Parkinson’s disease. Pharm. Res. 2013, 30, 2549–2559. [Google Scholar] [CrossRef]
- Yin, Y.; Hu, B.; Yuan, X.; Cai, L.; Gao, H.; Yang, Q. Nanogel: A versatile nano-delivery system for biomedical applications. Pharmaceutics 2020, 12, 290. [Google Scholar] [CrossRef]
- Jaubert-Possamai, S.; Le Trionnaire, G.; Bonhomme, J.; Christophides, G.K.; Rispe, C.; Tagu, D. Gene knockdown by RNAi in the pea aphid Acyrthosiphon pisum. BMC Biotechnol. 2007, 7, 63. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.S.; Chun, J.; Schwartz, A.; Nelson, S.; Paskewitz, S.M. Induction of mosquito hemolymph proteins in response to immune challenge and wounding. Dev. Comp. Immunol. 1999, 23, 553–562. [Google Scholar] [CrossRef]
- Yu, N.; Christiaens, O.; Liu, J.; Niu, J.; Cappelle, K.; Caccia, S.; Huvenne, H.; Smagghe, G. Delivery of dsRNA for RNAi in insects: An overview and future directions. Insect Sci. 2013, 20, 4–14. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zhang, D.; Yao, Q.; Zhang, J.; Dong, X.; Tian, H.; Chen, J.; Zhang, W. Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens. Insect Mol. Biol. 2010, 19, 777–786. [Google Scholar] [CrossRef] [PubMed]
- Tian, H.; Peng, H.; Yao, Q.; Chen, H.; Xie, Q.; Tang, B.; Zhang, W. Developmental control of a lepidopteran pest Spodoptera exigua by ingestion of bacteria expressing dsRNA of a non-midgut gene. PLoS ONE 2009, 4, e6225. [Google Scholar] [CrossRef]
- Araujo, R.; Santos, A.; Pinto, F.; Gontijo, N.; Lehane, M.; Pereira, M. RNA interference of the salivary gland nitrophorin 2 in the triatomine bug Rhodnius prolixus (Hemiptera: Reduviidae) by dsRNA ingestion or injection. Insect Biochem. Mol. Biol. 2006, 36, 683–693. [Google Scholar] [CrossRef]
- Rajagopal, R.; Sivakumar, S.; Agrawal, N.; Malhotra, P.; Bhatnagar, R.K. Silencing of Midgut Aminopeptidase N of Spodoptera litura by Double-stranded RNA Establishes Its Role asBacillus thuringiensis Toxin Receptor. J. Biol. Chem. 2002, 277, 46849–46851. [Google Scholar] [CrossRef] [PubMed]
- Hunter, C.P. Genetics: A touch of elegance with RNAi. Curr. Biol. 1999, 9, R440–R442. [Google Scholar] [CrossRef][Green Version]
Genes | Forward Primer | Reverse Primer | Length |
---|---|---|---|
ALDH7A1 | GATGGGTCCTCTTGGTTCAG | TATAGTGGCACGTCGCATGT | 157 |
HSP70 | GATTCGCAAAGGCAAGCTAC | CCGCTGTTGACTTCACTTCA | 217 |
4CL | CAAGTGGACCTTTCGTGGTT | TCTTGTGCGTCAACATGACA | 198 |
GAPDH | GCTGGTTTCATCGATGGTTT | ACGATTTCGACCACCGTAAC | 180 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Li, Z.; Wang, Z.-L.; Zhang, L.-Z.; Zeng, Z.-J. A Comparison of RNA Interference via Injection and Feeding in Honey Bees. Insects 2022, 13, 928. https://doi.org/10.3390/insects13100928
Zhang Y, Li Z, Wang Z-L, Zhang L-Z, Zeng Z-J. A Comparison of RNA Interference via Injection and Feeding in Honey Bees. Insects. 2022; 13(10):928. https://doi.org/10.3390/insects13100928
Chicago/Turabian StyleZhang, Yong, Zhen Li, Zi-Long Wang, Li-Zhen Zhang, and Zhi-Jiang Zeng. 2022. "A Comparison of RNA Interference via Injection and Feeding in Honey Bees" Insects 13, no. 10: 928. https://doi.org/10.3390/insects13100928
APA StyleZhang, Y., Li, Z., Wang, Z.-L., Zhang, L.-Z., & Zeng, Z.-J. (2022). A Comparison of RNA Interference via Injection and Feeding in Honey Bees. Insects, 13(10), 928. https://doi.org/10.3390/insects13100928