Selection and Validation of Reference Genes for Gene Expression Analysis in Tuta absoluta Meyrick (Lepidoptera: Gelechiidae)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. Biotic Factors
2.3. Abiotic Stresses
2.4. Total RNA Extraction and Reverse Transcription
2.5. Candidate Reference Genes and Primer Design
2.6. RT-qPCR Analysis
2.7. Stability of Gene Expression
2.8. Validation of Selected Reference Genes
3. Results
3.1. Total RNA Quality and Amplification Efficiencies
3.2. Expression Profiles of Nine Candidate Reference Genes
3.3. Stability of the Reference Genes under Different Experimental Conditions
3.3.1. Biotic Factors
3.3.2. Abiotic Stresses
3.4. Validation of Reference Genes with EcR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Sun, K.Q.; Zhang, Y.J.; D’Alessandro, A.; Nemkov, T.; Song, A.; Wu, H.Y.; Liu, H.; Adebiyi, V.; Huang, A.J.; Wen, Y.E.; et al. Sphingosine-1-phosphate promotes erythrocyte glycolysis and oxygen release for adaptation to high-altitude hypoxia. Nat. Commun. 2016, 7, 12086. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.L.; Ling, H.; Wu, Q.B.; Xu, L.P.; Que, Y.X. The choice of reference genes for assessing gene expression in sugarcane under salinity and drought stresses. Sci. Rep. 2014, 4, 7042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, X.Q.; Guo, W.C.; Wan, P.J.; Zhou, L.T.; Ren, X.L.; Ahmat, T.; Fu, K.Y.; Li, G.Q. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say). BMC Res. Notes 2013, 6, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, Y.N.; Fu, H.T.; Qiao, H.; Sun, S.M.; Zhang, W.Y.; Jin, S.B.; Jiang, S.F.; Gong, Y.S.; Xiong, Y.W.; Wu, Y. Validation and evaluation of reference genes for quantitative real-time PCR in Macrobrachium Nipponense. Int. J. Mol. Sci. 2018, 19, 2258. [Google Scholar] [CrossRef] [Green Version]
- Bagnall, N.H.; Kotze, A.C. Evaluation of reference genes for real-time PCR quantification of gene expression in the Australian sheep blowfly, Lucilia cuprina. Med. Vet. Entomol. 2010, 24, 176–181. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubist, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Derveaux, S.; Vandesompele, J.; Hellemans, J. How to do successful gene expression analysis using real-time PCR. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef]
- Koramutla, M.K.; Aminedi, R.; Bhattacharya, R. Comprehensive evaluation of candidate reference genes for qRT-PCR studies of gene expression in mustard aphid, Lipaphis erysimi (Kalt). Sci. Rep. 2016, 6, 25883. [Google Scholar] [CrossRef]
- Nakamura, A.M.; Chahad-Ehlers, S.; Lima, A.L.A.; Taniguti, C.H.; Sobrinho, I.; Torres, F.R.; Torres, F.R. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua. Sci. Rep. 2015, 6, 17480. [Google Scholar] [CrossRef]
- Nolan, T.; Hands, R.; Bustin, S. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef]
- Kang, Z.W.; Liu, F.H.; Tian, H.G.; Zhang, M.; Guo, S.S.; Liu, T.X. Evaluation of the reference genes for expression analysis using quantitative real-time polymerase chain reaction in the green peach aphid, Myzus persicae. Insect Sci. 2017, 24, 222–234. [Google Scholar] [CrossRef]
- Liu, G.; Qiu, X.; Li, C.; Zhang, Y.; Zhan, Z.; Han, R. Evaluation of reference genes for reverse transcription quantitative PCR studies of physiological responses in the Ghost Moth, Thitarodes armoricanus (Lepidoptera, Hepialidae). PLoS ONE 2016, 11, e0159060. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Meng, Q.Q.; Zhu, X.; Sun, S.W.; Liu, A.Q.; Gao, S.F.; Gou, Y.F. Identification and evaluation of reference genes for normalization of gene expression in developmental stages, sexes, and tissues of Diaphania caesalis (Lepidoptera, Pyralidae). J. Insect Sci. 2020, 6, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Lu, M.X.; Tang, X.T.; Du, Y.Z. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae). PLoS ONE 2015, 10, e0115979. [Google Scholar] [CrossRef]
- Han, P.; Bayram, Y.; Shaltiel-Harpaz, L.; Sohrabi, F.; Saji, A.; Esenali, U.T.; Jalilov, A.; Shashank, P.R.; Wang, S.; Zhang, G.F.; et al. Tuta absoluta continues to disperse in Asia: Damage, ongoing management and future challenges. J. Pest Sci. 2019, 92, 1317–1327. [Google Scholar] [CrossRef]
- Zhang, G.F.; Ma, D.Y.; Wang, Y.S.; Gao, Y.H.; Liu, W.X.; Zhang, R.; Fu, W.J.; Xian, X.Q.; Wang, J.; Kuang, M.; et al. First report of the south American tomato leafminer, Tuta absoluta (Meyrick), in China. J. Integr. Agric. 2020, 19, 1912–1917. [Google Scholar] [CrossRef]
- Biondi, A.; Guedes, R.N.C.; Wan, F.H.; Desneux, N. Ecology, worldwide spread, and management of the invasive South American tomato pinworm, Tuta absoluta: Past, present, and future. Annu. Rev. Entomol. 2018, 63, 239–258. [Google Scholar] [CrossRef]
- Scharlaken, B.; Graaf, D.C.; Goossens, K.; Brunain, M.; Peelman, L.; Jacobs, F.J. Reference gene selection for insect expression studies using quantitative real-time pcr: The head of the honeybee, Apis mellifera, after a bacterial challenge. J. Insect Sci. 2008, 1, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Szabo, A.; Perou, C.M.; Karaca, M.; Perreard, L.; Bernard, P.S. Statistical modeling for selecting housekeeper genes. Genome Biol. 2008, 9, 405. [Google Scholar] [CrossRef] [Green Version]
- Shelton, A.M.; Robertson, J.L.; Tang, J.D.; Perez, C.; Eigenbrode, S.D.; Preisler, H.K.; Wilsey, W.T.; Cooley, R.J. Resistance of diamondback moth (Lepidoptera: Yponomeutidae) to Bacillus thuringiensis subspecies in the field. J. Econ. Entomol. 1993, 86, 697–705. [Google Scholar] [CrossRef] [Green Version]
- Liang, P.; Gao, X.W.; Zheng, B.Z. Genetic basis of resistance and studies on cross-resistance in a population of diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae). Pest Manag. Sci. 2003, 59, 1232–1236. [Google Scholar] [CrossRef]
- Konuş, M. Analysing resistance of different Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) strains to abamectin insecticide. Turk. J. Biochem. 2014, 39, 291–297. [Google Scholar] [CrossRef]
- Rastall, K.; Kondo, V.; Strazanac, J.S.; Butler, L. Lethal effects of biological insecticide applications on nontarget lepidopterans in two appalachian forests. Environ. Entomol. 2003, 32, 1364–1369. [Google Scholar] [CrossRef] [Green Version]
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nijhof, A.M.; Balk, J.A.; Postigo, M.; Jongejan, F. Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86. BMC Mol. Biol. 2009, 10, 112. [Google Scholar] [CrossRef] [Green Version]
- Majerowicz, D.; Alves-Bezerra, M.; Logullo, R.; Fonseca-De-Souza, A.L.; Meyer-Fernandes, J.R.; Braz, G.R.C.; Gondim, K.C. Looking for reference genes for real-time quantitative PCR experiments in Rhodnius prolixus (Hemiptera: Reduviidae). Insect Mol. Biol. 2011, 20, 713–722. [Google Scholar] [CrossRef] [PubMed]
- Ibanez, F.; Tamborindeguy, C. Selection of reference genes for expression analysis in the potato psyllid, Bactericera Cockerelli. Insect Mol. Biol. 2016, 25, 227–238. [Google Scholar] [CrossRef]
- Zhu, X.; Yuan, M.; Shakeel, M.; Zhang, Y.J.; Wang, S.L.; Wang, X.; Zhanm, S.; Kang, T.K.; Li, J.H. Selection and evaluation of reference genes for expression analysis using qRT-PCR in the beet armyworm Spodoptera exigua (Hübner) (Lepidoptera: Noctuidae). PLoS ONE 2014, 9, e84730. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.H.; Yuan, M.; Gao, X.W.; Kang, T.H.; Zhan, S.; Wan, H.; Li, J.H. Identification and validation of reference genes for gene expression analysis using quantitative PCR in Spodoptera litura (Lepidoptera: Noctuidae). PLoS ONE 2013, 8, e68059. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, W.; Xie, W.; Zhang, Z.; Wang, S.L.; Wu, Q.J.; Liu, Y.; Zhou, X.M.; Zhou, X.G.; Zhang, Y.J. Exploring valid reference genes for quantitative real-time PCR analysis in Plutella xylostella (Lepidoptera: Plutellidae). Int. J. Biol. Sci. 2013, 9, 792–802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chandra, G.S.; Asokan, R.; Manamohan, M.; Krishna, K.N.K.; Sita, T. Evaluation of reference genes for quantitative real-time PCR normalization in cotton bollworm Helicoverpa armigera. Mol. Biol. 2014, 48, 813–822. [Google Scholar] [CrossRef]
- An, X.K.; Hou, M.L.; Liu, Y.D. Reference gene selection and evaluation for gene expression studies using qRT-PCR in the white-backed planthopper, Sogatella furcifera (Hemiptera: Delphacidae). J. Econ. Entomol. 2016, 2, 879. [Google Scholar] [CrossRef]
- Ponton, F.; Chapuis, M.P.; Pernice, M.; Sword, G.A.; Simpson, S.J. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster. J. Insect Physiol. 2011, 57, 840–850. [Google Scholar] [CrossRef] [PubMed]
- Shang, F.; Wei, D.D.; Jiang, X.Z.; Wei, D.; Shen, G.M.; Feng, Y.C.; Li, T.; Wang, J.J. Reference gene validation for quantitative PCR under various biotic and abiotic stress conditions in Toxoptera citricida (Hemiptera, Aphidiae). J. Econ. Entomol. 2015, 108, 2040–2047. [Google Scholar] [CrossRef]
- Rajarapu, S.P.; Mamidala, P.; Mittapalli, O. Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Sci. 2012, 19, 41–46. [Google Scholar] [CrossRef]
- Collins, C.; Patel, M.V.; Colvin, J.; Bailey, D.; Seal, S. Identification and evaluation of suitable reference genes for gene expression studies in the whitefly Bemisia tabaci (Asia I) by reverse transcription quantitative real-time pcr. J. Insect Sci. 2014, 14, 1–25. [Google Scholar] [CrossRef]
- Xu, Q.Y.; Deng, P.; Zhang, Q.; Li, A.; Fu, K.Y.; Guo, W.C.; Li, G.Q. Ecdysone receptor isoforms play distinct roles in larval-pupal-adult transition in Leptinotarsa Decemlineata. Insect Sci. 2020, 27, 487–499. [Google Scholar] [CrossRef]
- Henrich, V.C.; Brown, N.E. Insect nuclear receptors: A developmental and comparative perspective. Insect Biochem. Molec. 1995, 25, 881–897. [Google Scholar] [CrossRef]
- Kamimura, M.; Takahashi, M.; Tomita, S.; Fujiwara, H.; Kiuchi, M. Expression of ecdysone receptor isoforms and trehalase in the anterior silk gland of Bombyx mori during an extra larval molt and precocious pupation induced by 20-hydroxyecdysone administration. Arch. Insect Biochem. 2010, 41, 79–88. [Google Scholar] [CrossRef]
- Siaussat, D.; Bozzolan, F.; Queguiner, I.; Porcheron, P.; Debernard, S. Cell cycle profiles of EcR, USP, HR3 and B cyclin mRNAs associated to 20E-induced G2 arrest of Plodia interpunctella imaginal wing cells. Insect Mol. Biol. 2010, 14, 151–161. [Google Scholar] [CrossRef] [PubMed]
Gene Symbol | Gene Name | Accession Number | (Putative) Function |
---|---|---|---|
EF1α | Elongation factor 1 α | MZ054826 | Mediates recruitment of aminoacyl-transfer RNA to ribosome |
AK | Arginine kinase | MZ054821 | Key enzyme for cellular energy metabolism |
SOD | Superoxide dismutase | MZ054825 | Highly specific superoxide dismutase activity |
ACT | β-actin | MZ054824 | Cell motility, structure and integrity |
GAPDH | Glyceraldehyde-3- Phosphate dehydrogenase | MZ054823 | Glycolytic enzyme |
RPL7A | Ribosomal protein L7A | MZ054828 | Structural constituent of ribosome |
RPL10 | Ribosomal protein L10 | MZ054827 | Structural constituent of ribosome |
RPL28 | Ribosomal protein L28 | MZ054829 | Structural constituent of ribosome |
RPS11 | Ribosomal protein S11 | MZ054830 | Structural constituent of ribosome |
Gene | Primer Sequence (5′–3′) | Product Size (bp) | E (%) | R2 |
---|---|---|---|---|
EF1α | F: CCTGGGCACAGAGATTTCAT R: GATCAGCTGCTTGACACCAA | 171 | 98.3 | 0.997 |
AK | F: GCCCAGTACAAGGAGATGGA R: ACCACACGAGGAAGGTCTTG | 238 | 99.3 | 0.998 |
SOD | F: GGGCCTCATTTCATTGCTTA R: CTTCGCCACTGCTTATAGCC | 190 | 109.1 | 0.996 |
ACT | F: GCGACATCAAGGAGAAGCTC R: CAAGCTTCCATACCCAGGAA | 187 | 97.2 | 0.991 |
GAPDH | F: GCGTCAACCTTGAAGCCTAC R: TTACCAGAGGGACCGTCAAC | 181 | 102 | 0.993 |
RPL7A | F: TCAACCAGTTCACCCAGACA R: CACGAGCTGAGCCTTCTTCT | 227 | 100.8 | 0.995 |
RPL10 | F: CTTCATCCCTTCCACGTCAT R: TGAAACCCCACTTCTTGGAC | 250 | 95.6 | 0.998 |
RPL28 | F: TCAGACGTGCTGAACACACA R: GCCAGTCTTGGACAACCATT | 185 | 92.9 | 0.995 |
RPS11 | F: AAGACCTGCCGATATGCAAC R: TAGCCGTAGTCTGAGCAGCA | 156 | 98.4 | 0.994 |
Biotic Conditions | Rank | geNorm | Normfinder | BestKeeper | ΔCt | ||||
---|---|---|---|---|---|---|---|---|---|
Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | ||
Developmental stage | 1 | GAPDH | 1.654 | RPS11 | 0.110 | RPL28 | 0.785 | RPL28 | 0.889 |
2 | EF1α | 1.669 | GAPDH | 0.189 | RPS11 | 1.001 | RPL10 | 0.916 | |
3 | RPS11 | 1.776 | RPL28 | 0.240 | GAPDH | 1.129 | ACT | 0.944 | |
4 | RPL28 | 1.781 | EF1α | 0.576 | EF1α | 1.422 | EF1α | 0.976 | |
5 | ACT | 1.875 | ACT | 0.901 | ACT | 1.526 | RPS11 | 0.979 | |
6 | RPL10 | 2.078 | RPL10 | 1.131 | AK | 1.643 | AK | 0.987 | |
7 | RPL7A | 2.354 | RPL7A | 1.424 | RPL10 | 2.016 | RPL7A | 1.025 | |
8 | AK | 3.187 | AK | 1.845 | RPL7A | 2.386 | GAPDH | 1.031 | |
9 | SOD | 4.567 | SOD | 2.110 | SOD | 2.797 | SOD | 1.359 | |
Tissues | 1 | RPL28 | 1.343 | RPL28 | 0.235 | RPL28 | 0.779 | RPL28 | 0.825 |
2 | RPL10 | 1.348 | RPL10 | 0.385 | GAPDH | 1.023 | RPL10 | 0.912 | |
3 | RPL7A | 1.364 | RPL7A | 0.435 | RPL7A | 1.033 | ACT | 0.924 | |
4 | GAPDH | 1.668 | GAPDH | 0.772 | RPL10 | 1.121 | RPS11 | 0.955 | |
5 | ACT | 1.697 | ACT | 0.829 | EF1α | 1.206 | EF1α | 0.961 | |
6 | EF1α | 1.823 | EF1α | 1.013 | SOD | 1.250 | AK | 0.982 | |
7 | AK | 1.990 | AK | 1.106 | Actin | 1.503 | RPL7A | 1.013 | |
8 | RPS11 | 2.184 | RPS11 | 1.287 | AK | 1.656 | GAPDH | 1.032 | |
9 | SOD | 2.205 | SOD | 1.297 | RPS11 | 1.909 | SOD | 1.264 | |
20E | 1 | EF1α | 0.651 | EF1α | 0.161 | GAPDH | 0.440 | RPL28 | 0.946 |
2 | RPL28 | 0.710 | RPL28 | 0.235 | RPL28 | 0.496 | RPL10 | 0.969 | |
3 | RPL7A | 0.741 | AK | 0.280 | AK | 0.510 | ACT | 0.973 | |
4 | AK | 0.753 | RPL7A | 0.342 | EF1α | 0.628 | RPS11 | 0.991 | |
5 | RPS11 | 0.852 | SOD | 0.473 | RPS11 | 0.923 | EF1α | 0.995 | |
6 | SOD | 0.900 | RPS11 | 0.493 | SOD | 1.234 | AK | 0.995 | |
7 | RPL10 | 0.906 | RPL10 | 0.502 | RPL7A | 1.316 | RPL7A | 1.003 | |
8 | GAPDH | 0.989 | GAPDH | 0.630 | ACT | 1.378 | GAPDH | 1.020 | |
9 | ACT | 0.989 | ACT | 0.630 | RPL10 | 1.419 | SOD | 1.097 | |
Insecticide | 1 | EF1α | 1.303 | EF1α | 0.391 | ACT | 0.440 | RPL28 | 0.819 |
2 | RPL7A | 1.350 | RPL7A | 0.559 | RPL7A | 0.496 | RPS11 | 0.959 | |
3 | RPS11 | 1.474 | AK | 0.675 | EF1α | 0.510 | RPL10 | 0.968 | |
4 | AK | 1.490 | RPS11 | 0.734 | RPL10 | 0.628 | ACT | 0.987 | |
5 | GAPDH | 1.545 | SOD | 0.795 | SOD | 0.923 | EF1α | 0.988 | |
6 | ACT | 1.558 | ACT | 0.844 | AK | 1.234 | AK | 0.990 | |
7 | SOD | 1.569 | GAPDH | 0.877 | RPS11 | 1.316 | RPL7A | 1.005 | |
8 | RPL28 | 1.728 | RPL28 | 1.054 | GAPDH | 1.378 | GAPDH | 1.057 | |
9 | RPL10 | 1.755 | RPL10 | 1.057 | RPL28 | 1.419 | SOD | 1.106 |
Insecticides | N a | Slope ± SE b | LD50 (95% CL) c mg/L | χ2 d |
---|---|---|---|---|
Abamectin | 300 | 2.167 ± 0.242 | 23.838 (20.021–28.819) | 0.981 |
Spinosad | 300 | 0.880 ± 0.089 | 779.915 (504.427–1227.212) | 0.348 |
Chlorantraniliprole | 300 | 1.824 ± 0.211 | 0.259 (0.187–0.366) | 1.990 |
Indoxacarb | 300 | 0.976 ± 0.131 | 336.704 (188.020–642.933) | 1.739 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, X.; Zhang, Y.; Xu, K.; Wang, Y.; Yang, W. Selection and Validation of Reference Genes for Gene Expression Analysis in Tuta absoluta Meyrick (Lepidoptera: Gelechiidae). Insects 2021, 12, 589. https://doi.org/10.3390/insects12070589
Yan X, Zhang Y, Xu K, Wang Y, Yang W. Selection and Validation of Reference Genes for Gene Expression Analysis in Tuta absoluta Meyrick (Lepidoptera: Gelechiidae). Insects. 2021; 12(7):589. https://doi.org/10.3390/insects12070589
Chicago/Turabian StyleYan, Xin, Yibo Zhang, Kangkang Xu, Yawei Wang, and Wenjia Yang. 2021. "Selection and Validation of Reference Genes for Gene Expression Analysis in Tuta absoluta Meyrick (Lepidoptera: Gelechiidae)" Insects 12, no. 7: 589. https://doi.org/10.3390/insects12070589