Variation in Expression of Reference Genes across Life Stages of a Bee, Megachile rotundata
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of M. rotundata Bees
2.2. RNA Extraction
2.3. cDNA Synthesis
2.4. Primer Design
2.5. Quantitative Real-Time PCR
2.6. Data Analysis
3. Results
3.1. Transcript Abundance Profiles for Different Genes and Life Stages
3.2. Transcript Variation among Different Life Stages
3.3. Stability of Gene Expression in Diapausing and Non-Diapausing Bees
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Olmstead, A.L.; Wooten, D.B. Bee pollination and productivity growth: The case of alfalfa. Am. J. Agric. Econ. 1987, 69, 57–63. [Google Scholar] [CrossRef]
- Pitts-Singer, T.L.; Cane, J.H. The alfalfa leafcutting bee, Megachile rotundata: The world’s most intensively managed solitary bee. Ann. Rev. Entomol. 2011, 56, 221–237. [Google Scholar] [CrossRef] [PubMed]
- McManus, L.; Youssef, N.N. Life cycle of the chalkbrood fungus, Ascosphaera aggregata, in the alfalfa leafcutting bee, Megachile rotundata, and its associated symptomology. Mycolgia 1984, 76, 830–842. [Google Scholar] [CrossRef]
- Vandenberg, J.D.; Stephen, W.P. Etiology and symptomology of chalkbrood in the alfalfa leafcutting bee, Megachile rotundata. J. Invert. Pathol. 1982, 39, 133–137. [Google Scholar] [CrossRef]
- James, R.R. Temperature and chalkbrood development in the alfalfa leafcutting bee, Megachile rotundata. Apidologie 2005, 36, 15–23. [Google Scholar] [CrossRef]
- Xu, J.; James, R.R. Temperature stress affects the expression of immune response genes in the alfalfa leafcutting bee, Megachile rotundata. Insect Mol. Biol. 2012, 21, 269–280. [Google Scholar] [CrossRef]
- Yocum, G.D.; Kemp, W.P.; Bosch, J.; Knoblett, J.N. Temporal variation in overwintering gene expression and respiration in the solitary bee Megachile rotundata. J. Insect Physiol. 2005, 51, 621–629. [Google Scholar] [CrossRef]
- Xu, J.; James, R. Genes related to immunity, as expressed in the alfalfa leafcutting bee, Megachile rotundata, during pathogen challenge. Insect Mol. Biol. 2009, 18, 785–794. [Google Scholar] [CrossRef]
- Bar, T.; Kubista, M.; Tichopad, A. Validation of kinetics similarity in qPCR. Nucl. Acids Res. 2012, 40, 1395–1406. [Google Scholar] [CrossRef]
- Kozera, B.; Rapacz, M. Reference genes in real-time PCR. J. Appl. Genet. 2013, 54, 391–406. [Google Scholar] [CrossRef]
- Bustin, S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 2000, 25, 169–193. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.L.; Salem, T.Z.; Turney, C.M.; Cheng, X.W. Strategy of the use of 28S rRNA as a reference gene in real-time quantitative PCR analysis of gene transcription in insect cells infected by viruses. J. Virol. Methods 2010, 163, 210–215. [Google Scholar] [CrossRef]
- Lourenço, A.P.; Mackert, A.; dos Santos Cristino, A.; Simões, Z.L.P. Validation of reference genes for gene expression studies in the honey bee, Apis mellifera, by quantitative real-time RT-PCR. Apidologie 2008, 39, 372–385. [Google Scholar] [CrossRef]
- Maroniche, G.A.; Sagadín, M.; Mongelli, V.C.; Truol, G.A.; del Vas, M. Reference gene selection for gene expression studies using RT-qPCR in virus-infected planthoppers. Virol. J. 2011, 8, 1–8. [Google Scholar] [CrossRef]
- Scharlaken, B.; de Graaf, D.C.; Goossens, K.; Brunain, M.; Peelman, L.J.; Jacobs, F.J. Reference gene selection for insect expression studies using quantitative real-time PCR: The head of honeybee, Apis mellifera, after a bacterial challenge. J. Insect Sci. 2008, 8, 33–43. [Google Scholar] [CrossRef]
- Lord, J.C.; Hartzer, K.; Toutges, M.; Oppert, B. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge. J. Microbiol. Methods 2010, 80, 219–221. [Google Scholar] [CrossRef]
- Shi, X.-Z.; Zhong, X.; Yu, X.-Q. Drosophila melanogaster NPC2 proteins bind bacterial cell wall components and may function in immune signal pathways. Insect Biochem. Mol. Biol. 2012, 42, 545–556. [Google Scholar] [CrossRef]
- Wang, G.H.; Xia, Q.Y.; Cheng, D.J.; Duan, J.; Zhao, P.; Chen, J.; Zhu, L. Reference genes identified in the silkworm Bombyx mori during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR. Insect Sci. 2008, 15, 405–413. [Google Scholar] [CrossRef]
- Yocum, G.D.; Rinehart, J.P.; Horvath, D.P.; Kemp, W.P.; Bosch, J.; Alroobi, R.; Salem, S. Key molecular processes of the diapause to post-diapause quiescence transition in the alfalfa leafcutting bee Megachile rotundata identified by comparative transcriptome analysis. Physiol. Entomol. 2015, 40, 103–112. [Google Scholar] [CrossRef]
- Kang, D.S.; Cotton, M.A.; Denlinger, D.L.; Sim, C. Comparative transcriptomics reveals key gene expression differences between diapausing and non-diapausing adults of Culex pipiens. PLoS ONE 2016, 11, e0154892. [Google Scholar] [CrossRef]
- Kankare, M.; Parker, D.J.; Merisalo, M.; Salminen, T.S.; Hoikkala, A. Transcriptional differences between diapausing and non-diapausing D. montana females reared under the same photoperiod and temperature. PLoS ONE 2016, 11, e0161852. [Google Scholar] [CrossRef] [PubMed]
- Kemp, W.P.; Bosch, J. Development and emergence of the alfalfa pollinator Megachile rotundata (Hymenoptera: Megachilidae). Ann. Entomol. Soc. Am. 2000, 93, 904–911. [Google Scholar] [CrossRef]
- Kabanova, S.; Kleinbongard, P.; Volkmer, J.; Andrée, B.; Kelm, M.; Jax, T.W. Gene expression analysis of human red blood cells. Int. J. Med. Sci. 2009, 6, 156–159. [Google Scholar] [CrossRef] [PubMed]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar]
- Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.; Karlen, Y.; Bakker, O.; van den Hoff, M.J.; Moorman, A.F. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, 1–12. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Shi, X.; Guo, W.; Wan, P.; Zhou, L.; Ren, X.; Ahmat, T.; Fu, K.; Li, G. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say). BMC Res. Notes 2013, 6, 1–10. [Google Scholar] [CrossRef]
- Mamidala, P.; Rajarapu, S.P.; Jones, S.C.; Mittapalli, O. Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius. J. Med. Entomol. 2011, 48, 947–951. [Google Scholar] [CrossRef]
- Coelho, P.S.R.; Bryan, A.C.; Kumar, A.; Shadel, G.S.; Snyder, M. A novel mitochondrial protein, Tar1p, is encoded on the antisense strand of the nuclear 25SrDNA. Genes Dev. 2002, 16, 2755–2760. [Google Scholar] [CrossRef]
- de Boer, M.; de Boer, T.; Mariën, J.; Timmermans, M.J.; Nota, B.; van Straalen, N.M.; Ellers, J.; Roelofs, D. Reference genes for QRT-PCR tested under various stress conditions in Folsomia candida and Orchesella cincta (Insecta, Collembola). BMC Mol. Biol. 2009, 10, 1–11. [Google Scholar] [CrossRef]
- Paim, R.M.; Pereira, M.H.; Di Ponzio, R.; Rodrigues, J.O.; Guarneri, A.A.; Gontijo, N.F.; Araújo, R.N. Validation of reference genes for expression analysis in the salivary gland and the intestine of Rhodnius prolixus (Hemiptera, Reduviidae) under different experimental conditions by quantitative real-time PCR. BMC Res. Notes 2012, 5, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Ponton, F.; Chapuis, M.P.; Pernice, M.; Sword, G.A.; Simpson, S.J. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster. J. Insect. Physiol. 2011, 57, 840–850. [Google Scholar] [CrossRef] [PubMed]
- Rajarapu, S.P.; Mamidala, P.; Mittapalli, O. Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Sci. 2012, 19, 41–46. [Google Scholar] [CrossRef]
- Teng, X.; Zhang, Z.; He, G.; Yang, L.; Li, F. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in four lepidopteran insects. J. Insect Sci. 2012, 12, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Van Hiel, M.B.; Van Wielendaele, P.; Temmerman, L.; Van Soest, S.; Vuerinckx, K.; Huybrechts, R.; Broeck, J.V.; Simonet, G. Identification and validation of reference genes in brains of the desert locust Schistocerca gregaria under different developmental conditions. BMC Mol. Biol. 2009, 10, 56. [Google Scholar] [CrossRef] [PubMed]



| Gene | Genbank Accession Number | Primer Sequences Forward and Reverse (5′ to 3′) | Amplicon Length | Tm (°C) | % GC | Coding Protein |
|---|---|---|---|---|---|---|
| ACT | SRX040740 | CGGTTCGTGATAGGATTCATTGGTGGT | 64 | 60.4 | 48.1 | ß-actin |
| TGGGAAGACATGTGTCATGTATGGGA | 59.6 | 46.1 | ||||
| APN | GD241616 | TGCGCTGGACTGAGGAACGC | 72 | 62.8 | 65.0 | Aminopeptidase N |
| GGCAAGCCAAGAGCGCGAAC | 62.3 | 65.0 | ||||
| Cr-PII | GD241657 | TGGTCCGCAAGGTCGAAGCC | 103 | 62.7 | 65.0 | Cr-PII allergens |
| GCGGAAGCCGGTTGGTGGAA | 63.3 | 65.0 | ||||
| GAPDH | GD240938 | GTGCCGCCAAAGCTGTCGGT | 81 | 63.6 | 65.0 | Glyceraldehyde-3-phosphate dehydrogenase |
| GCTGGTTTGCCAAGTCTGACCGT | 62.1 | 56.5 | ||||
| GRX | GD240911 | ATTGGGCGACATGACCGGCG | 76 | 63.2 | 65.0 | Glutaredoxin (GRX) family |
| AGCTTCTTCTGCAGCTCGCCA | 61.6 | 57.1 | ||||
| NPC2 | GD241023 | CGCACTCGTCCTGGTAGCGT | 108 | 61.9 | 65.0 | Niemann-pick type C2 (Npc2) |
| CGTGCTTCGACATCGGTTCCCC | 60.7 | 61.9 | ||||
| PMIIM | GD241063 | ACGCGACCGTCCATGTCTGTG | 66 | 62.1 | 61.9 | Peritrophic matrix insect intestinal mucin |
| GTAAGCCGGTCCATCGGCCA | 62.3 | 65.0 | ||||
| RPL8 | GD240977 | GGAGCATCCTCACGGTGGTGG | 71 | 62.5 | 66.6 | Ribosomal protein L8 |
| TCCGGTACGACGAGCAGCAA | 61.1 | 60.0 | ||||
| RPL27A | GD240974 | GGGGACTGCGATCAAGATGTCAAC | 93 | 59.8 | 54.1 | Ribosomal protein L27A |
| GGTGGTGCAACCCACCAGCA | 63.4 | 65.0 | ||||
| RPS5 | GD240987 | CGGTCGCGCTGGTACTGTCA | 64 | 62.1 | 65.0 | Ribosomal protein S5 |
| ATGCGGCTTCCCTAGCACCG | 62.6 | 65.0 | ||||
| RPS18 | GD240984 | ACGAATTGGCAAGATGTCGCTCGT | 91 | 61.2 | 50.0 | Ribosomal protein S18 |
| GCATAACGGCGACCAACACC | 59.3 | 60.0 | ||||
| TarRNA | GD241002 | GCGGTTAACGCCGCTGGGAA | 80 | 63.3 | 65.0 | Transcript antisense to ribosomal RNA |
| CTACGGGCCTGGCACCCTCT | 64.1 | 70.0 |
| Larval Stage | Prepupal Stage | Adult Stages | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Name | Mean Rank | BestKeeper | NormFinder | BestKeeper | NormFinder | BestKeeper | NormFinder | ||||||
| SD 1 | Rank | SV 2 | Rank | SD | Rank | SV | Rank | SD | Rank | SV | Rank | ||
| RPS18 | 1 | 1.12 | 4 | 0.03 | 2 | 0.54 | 4 | 0.05 | 2 | 0.94 | 4 | 0.03 | 5 |
| RPS5 | 2 | 1.04 | 3 | 0.05 | 5 | 0.52 | 3 | 0.07 | 10 | 0.83 | 2 | 0.02 | 1 |
| RPL27A | 3 | 1.35 | 5 | 0.02 | 1 | 0.44 | 2 | 0.06 | 5 | 1.06 | 6 | 0.04 | 6 |
| GRX | 4 | 1.80 | 11 | 0.04 | 4 | 0.74 | 7 | 0.02 | 1 | 0.92 | 3 | 0.03 | 3 |
| RPL8 | 5 | 0.98 | 1 | 0.05 | 6 | 0.62 | 5 | 0.06 | 7 | 1.14 | 8 | 0.03 | 4 |
| TarRNA | 6 | 1.01 | 2 | 0.10 | 12 | 0.20 | 1 | 0.05 | 3 | 1.00 | 5 | 0.09 | 10 |
| GAPDH | 7 | 1.39 | 6 | 0.04 | 3 | 0.66 | 6 | 0.07 | 9 | 1.09 | 7 | 0.04 | 7 |
| PMIIM | 8 | 1.75 | 10 | 0.07 | 9 | 2.36 | 9 | 0.06 | 6 | 0.56 | 1 | 0.06 | 9 |
| ACT | 9 | 1.54 | 9 | 0.07 | 8 | 1.19 | 8 | 0.06 | 4 | 1.24 | 9 | 0.05 | 8 |
| APN | 10 | 1.41 | 7 | 0.06 | 7 | 3.53 | 12 | 0.12 | 12 | 1.25 | 10 | 0.03 | 2 |
| NPC2 | 11 | 1.42 | 8 | 0.09 | 11 | 2.48 | 10 | 0.07 | 8 | 2.95 | 11 | 0.11 | 11 |
| Cr-PII | 12 | 2.30 | 12 | 0.08 | 10 | 3.36 | 11 | 0.11 | 11 | 3.66 | 12 | 0.15 | 12 |
| Average | BestKeeper | NormFinder | |||
|---|---|---|---|---|---|
| Gene | Rank | Rank | SD 1 | Rank | SV 2 |
| RPS18 | 1 | 4 | 1.22 | 2 | 0.06 |
| RPL8 | 2 | 2 | 1.14 | 5 | 0.07 |
| GAPDH | 3 | 7 | 1.74 | 1 | 0.05 |
| RPS5 | 4 | 3 | 1.17 | 6 | 0.07 |
| GRX | 4 | 6 | 1.55 | 3 | 0.06 |
| RPL27A | 4 | 5 | 1.48 | 4 | 0.06 |
| TarRNA | 5 | 1 | 1.00 | 10 | 0.14 |
| ACT | 6 | 8 | 1.53 | 8 | 0.08 |
| APN | 7 | 9 | 2.79 | 7 | 0.07 |
| PMIIM | 8 | 10 | 4.26 | 9 | 0.12 |
| NPC2 | 9 | 11 | 4.54 | 11 | 0.14 |
| Cr-PII | 10 | 12 | 5.00 | 12 | 0.18 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, J.; Welker, D.L.; James, R.R. Variation in Expression of Reference Genes across Life Stages of a Bee, Megachile rotundata. Insects 2021, 12, 36. https://doi.org/10.3390/insects12010036
Xu J, Welker DL, James RR. Variation in Expression of Reference Genes across Life Stages of a Bee, Megachile rotundata. Insects. 2021; 12(1):36. https://doi.org/10.3390/insects12010036
Chicago/Turabian StyleXu, Junhuan, Dennis L. Welker, and Rosalind R. James. 2021. "Variation in Expression of Reference Genes across Life Stages of a Bee, Megachile rotundata" Insects 12, no. 1: 36. https://doi.org/10.3390/insects12010036
APA StyleXu, J., Welker, D. L., & James, R. R. (2021). Variation in Expression of Reference Genes across Life Stages of a Bee, Megachile rotundata. Insects, 12(1), 36. https://doi.org/10.3390/insects12010036

