Blood Meal Sources of Anopheles spp. in Malaria Endemic Areas of Honduras
Abstract
1. Introduction
2. Materials and Methods
2.1. Mosquito Collection
2.2. Identification of Mosquito Species
2.3. DNA Extraction and Blood Meal Identification
2.4. Quantitative Interaction Network
2.5. Detection of Plasmodium spp. DNA
3. Results
3.1. Description of the Collection Sites
3.2. Blood Meal Identification
3.3. Number of Host Blood Meals
3.4. Parasite DNA Detection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- WHO. World Malaria Report 2019; World Health Organization: Geneva, Switzerland, 2019; p. 232. [Google Scholar]
- Herrera, S.; Ochoa-Orozco, S.A.; Gonzalez, I.J.; Peinado, L.; Quinones, M.L.; Arevalo-Herrera, M. Prospects for malaria elimination in Mesoamerica and Hispaniola. PLoS Negl. Trop. Dis. 2015, 9, e0003700. [Google Scholar] [CrossRef] [PubMed]
- WHO. Global Technical Strategy for Malaria 2016–2030; World Health Organization: Geneva, Switzerland, 2015. [Google Scholar]
- Big Data Institute University of Oxford. The Malaria Atlas Project. Available online: https://malariaatlas.org (accessed on 19 May 2020).
- Fuller, D.O.; Ahumada, M.L.; Quinones, M.L.; Herrera, S.; Beier, J.C. Near-present and future distribution of Anopheles albimanus in Mesoamerica and the Caribbean Basin modeled with climate and topographic data. Int. J. Health Geogr. 2012, 11, 13. [Google Scholar] [CrossRef] [PubMed]
- Gomez, G.F.; Marquez, E.J.; Gutierrez, L.A.; Conn, J.E.; Correa, M.M. Geometric morphometric analysis of Colombian Anopheles albimanus (Diptera: Culicidae) reveals significant effect of environmental factors on wing traits and presence of a metapopulation. Acta Trop. 2014, 135, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Loaiza, J.R.; Scott, M.E.; Bermingham, E.; Rovira, J.; Conn, J.E. Evidence for pleistocene population divergence and expansion of Anopheles albimanus in Southern Central America. Am. J. Trop. Med. Hyg. 2010, 82, 156–164. [Google Scholar] [CrossRef]
- Escobar, D.; Ascencio, K.; Ortiz, A.; Palma, A.; Fontecha, G. Distribution and phylogenetic diversity of Anopheles species in malaria endemic areas of Honduras in an elimination setting. Parasites Vectors 2020, 13, 333. [Google Scholar] [CrossRef]
- Lardeux, F.; Loayza, P.; Bouchite, B.; Chavez, T. Host choice and human blood index of Anopheles pseudopunctipennis in a village of the Andean valleys of Bolivia. Malar. J. 2007, 6, 8. [Google Scholar] [CrossRef]
- Gary, R.E., Jr.; Foster, W.A. Effects of available sugar on the reproductive fitness and vectorial capacity of the malaria vector Anopheles gambiae (Diptera: Culicidae). J. Med. Entomol. 2001, 38, 22–28. [Google Scholar] [CrossRef]
- Sougoufara, S.; Diedhiou, S.M.; Doucoure, S.; Diagne, N.; Sembene, P.M.; Harry, M.; Trape, J.F.; Sokhna, C.; Ndiath, M.O. Biting by Anopheles funestus in broad daylight after use of long-lasting insecticidal nets: A new challenge to malaria elimination. Malar. J. 2014, 13, 125. [Google Scholar] [CrossRef]
- Sinka, M.E.; Rubio-Palis, Y.; Manguin, S.; Patil, A.P.; Temperley, W.H.; Gething, P.W.; Van Boeckel, T.; Kabaria, C.W.; Harbach, R.E.; Hay, S.I. The dominant Anopheles vectors of human malaria in the Americas: Occurrence data, distribution maps and bionomic precis. Parasites Vectors 2010, 3, 72. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira, C.D.; Tadei, W.P.; Abdalla, F.C.; Paolucci Pimenta, P.F.; Marinotti, O. Multiple blood meals in Anopheles darlingi (Diptera: Culicidae). J. Vector Ecol. 2012, 37, 351–358. [Google Scholar] [CrossRef] [PubMed]
- Moreno, M.; Saavedra, M.P.; Bickersmith, S.A.; Prussing, C.; Michalski, A.; Tong Rios, C.; Vinetz, J.M.; Conn, J.E. Intensive trapping of blood-fed Anopheles darlingi in Amazonian Peru reveals unexpectedly high proportions of avian blood-meals. PLoS Negl. Trop. Dis. 2017, 11, e0005337. [Google Scholar] [CrossRef]
- Ekoko, W.E.; Awono-Ambene, P.; Bigoga, J.; Mandeng, S.; Piameu, M.; Nvondo, N.; Toto, J.C.; Nwane, P.; Patchoke, S.; Mbakop, L.R.; et al. Patterns of anopheline feeding/resting behaviour and Plasmodium infections in North Cameroon, 2011–2014: Implications for malaria control. Parasites Vectors 2019, 12, 297. [Google Scholar] [CrossRef]
- Saavedra, M.P.; Conn, J.E.; Alava, F.; Carrasco-Escobar, G.; Prussing, C.; Bickersmith, S.A.; Sangama, J.L.; Fernandez-Minope, C.; Guzman, M.; Tong, C.; et al. Higher risk of malaria transmission outdoors than indoors by Nyssorhynchus darlingi in riverine communities in the Peruvian Amazon. Parasites Vectors 2019, 12, 374. [Google Scholar] [CrossRef] [PubMed]
- Tandina, F.; Niare, S.; Almeras, L.; Davoust, B.; Doumbo, O.K.; Raoult, D.; Parola, P.; Laroche, M. Identification of mixed and successive blood meals of mosquitoes using MALDI-TOF MS protein profiling. Parasitology 2020, 147, 329–339. [Google Scholar] [CrossRef] [PubMed]
- The malERA Consultative Group on Vector Control. A research agenda for malaria eradication: Vector control. PLoS Med. 2011, 8. [Google Scholar] [CrossRef]
- Orsborne, J.; Furuya-Kanamori, L.; Jeffries, C.L.; Kristan, M.; Mohammed, A.R.; Afrane, Y.A.; O’Reilly, K.; Massad, E.; Drakeley, C.; Walker, T.; et al. Using the human blood index to investigate host biting plasticity: A systematic review and meta-regression of the three major African malaria vectors. Malar. J. 2018, 17, 479. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Malaria Surveillance, Monitoring & Evaluation: A Reference Manual; World Health Organization: Geneva, Switzerland, 2018; p. 105. [Google Scholar]
- Wilkerson, R.C.; Strickman, D.; Litwak, T.R. Illustrated key to the female anopheline mosquitoes of Central America and Mexico. J. Am. Mosq. Control Assoc. 1990, 6, 7–34. [Google Scholar]
- Pizarro, J.C.; Stevens, L. A new method for forensic DNA analysis of the blood meal in chagas disease vectors demonstrated using Triatoma infestans from Chuquisaca, Bolivia. PLoS ONE 2008, 3, e3585. [Google Scholar] [CrossRef]
- Saiki, R.K.; Scharf, S.; Faloona, F.; Mullis, K.B.; Horn, G.T.; Erlich, H.A.; Arnheim, N. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 1985, 230, 1350–1354. [Google Scholar] [CrossRef]
- Garrett-Jones, C. The human blood index of malaria vectors in relation to epidemiological assessment. Bull. World Health Organ. 1964, 30, 241–261. [Google Scholar]
- Zimmerman, R.H.; Galardo, A.K.; Lounibos, L.P.; Arruda, M.; Wirtz, R. Bloodmeal hosts of Anopheles species (Diptera: Culicidae) in a malaria-endemic area of the Brazilian Amazon. J. Med. Entomol. 2006, 43, 947–956. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2013. [Google Scholar]
- Fontecha, G.A.; Mendoza, M.; Banegas, E.; Poorak, M.; De Oliveira, A.M.; Mancero, T.; Udhayakumar, V.; Lucchi, N.W.; Mejia, R.E. Comparison of molecular tests for the diagnosis of malaria in Honduras. Malar. J. 2012, 11, 119. [Google Scholar] [CrossRef] [PubMed]
- Njoroge, M.M.; Tirados, I.; Lindsay, S.W.; Vale, G.A.; Torr, S.J.; Fillinger, U. Exploring the potential of using cattle for malaria vector surveillance and control: A pilot study in western Kenya. Parasites Vectors 2017, 10, 18. [Google Scholar] [CrossRef] [PubMed]
- Loyola, E.G.; Gonzalez-Ceron, L.; Rodriguez, M.H.; Arredondo-Jimenez, J.I.; Bennett, S.; Bown, D.N. Anopheles albimanus (Diptera: Culicidae) host selection patterns in three ecological areas of the coastal plains of Chiapas, southern Mexico. J. Med. Entomol. 1993, 30, 518–523. [Google Scholar] [CrossRef]
- Floore, T.G.; Harrison, B.A.; Eldridge, B.F. The Anopheles (Anopheles) crucians subgroup in the United States (Diptera: Culicidae). Mosq. Syst. 1976, 8, 109. [Google Scholar]
- Montoya-Lerma, J.; Solarte, Y.A.; Giraldo-Calderon, G.I.; Quinones, M.L.; Ruiz-Lopez, F.; Wilkerson, R.C.; Gonzalez, R. Malaria vector species in Colombia: A review. Mem. Inst. Oswaldo Cruz. 2011, 106 (Suppl. S1), 223–238. [Google Scholar] [CrossRef] [PubMed]
- Orsborne, J.; Mohammed, A.R.; Jeffries, C.L.; Kristan, M.; Afrane, Y.A.; Walker, T.; Yakob, L. Evidence of extrinsic factors dominating intrinsic blood host preferences of major African malaria vectors. Sci. Rep. 2020, 10, 741. [Google Scholar] [CrossRef]
- Ogola, E.; Villinger, J.; Mabuka, D.; Omondi, D.; Orindi, B.; Mutunga, J.; Owino, V.; Masiga, D.K. Composition of Anopheles mosquitoes, their blood-meal hosts, and Plasmodium falciparum infection rates in three islands with disparate bed net coverage in Lake Victoria, Kenya. Malar. J. 2017, 16, 360. [Google Scholar]
- Ndo, C.; Kopya, E.; Donbou, M.A.; Njiokou, F.; Awono-Ambene, P.; Wondji, C. Elevated Plasmodium infection rates and high pyrethroid resistance in major malaria vectors in a forested area of Cameroon highlight challenges of malaria control. Parasites Vectors 2018, 11, 157. [Google Scholar] [CrossRef] [PubMed]
- Orsborne, J.; Furuya-Kanamori, L.; Jeffries, C.L.; Kristan, M.; Mohammed, A.R.; Afrane, Y.A.; O’Reilly, K.; Massad, E.; Drakeley, C.; Walker, T.; et al. Investigating the blood-host plasticity and dispersal of Anopheles coluzzii using a novel field-based methodology. Parasites Vectors 2019, 12, 143. [Google Scholar] [CrossRef]
- Massebo, F.; Balkew, M.; Gebre-Michael, T.; Lindtjorn, B. Zoophagic behaviour of anopheline mosquitoes in southwest Ethiopia: Opportunity for malaria vector control. Parasites Vectors 2015, 8, 645. [Google Scholar] [CrossRef] [PubMed]
- Awono-Ambene, P.H.; Etang, J.; Antonio-Nkondjio, C.; Ndo, C.; Eyisap, W.E.; Piameu, M.C.; Mandeng, E.S.; Mbakop, R.L.; Toto, J.C.; Patchoke, S.; et al. The bionomics of the malaria vector Anopheles rufipes Gough, 1910 and its susceptibility to deltamethrin insecticide in North Cameroon. Parasites Vectors 2018, 11, 253. [Google Scholar] [CrossRef] [PubMed]
- Thomas, S.; Ravishankaran, S.; Justin, N.A.; Asokan, A.; Mathai, M.T.; Valecha, N.; Montgomery, J.; Thomas, M.B.; Eapen, A. Resting and feeding preferences of Anopheles stephensi in an urban setting, perennial for malaria. Malar. J. 2017, 16, 111. [Google Scholar] [CrossRef]
- Russell, T.L.; Beebe, N.W.; Bugoro, H.; Apairamo, A.; Cooper, R.D.; Collins, F.H.; Lobo, N.F.; Burkot, T.R. Determinants of host feeding success by Anopheles farauti. Malar. J. 2016, 15, 152. [Google Scholar] [CrossRef] [PubMed]
- Ngom el, H.M.; Ndione, J.A.; Ba, Y.; Konate, L.; Faye, O.; Diallo, M.; Dia, I. Spatio-temporal analysis of host preferences and feeding patterns of malaria vectors in the sylvo-pastoral area of Senegal: Impact of landscape classes. Parasites Vectors 2013, 6, 332. [Google Scholar] [CrossRef] [PubMed]
- Zimmerman, R.H. Ecology of malaria vectors in the Americas and future direction. Mem. Inst. Oswaldo Cruz. 1992, 87 (Suppl. S3), 371–383. [Google Scholar] [CrossRef] [PubMed]
- Barbosa, L.M.C.; Souto, R.N.P.; Dos Anjos Ferreira, R.M.; Scarpassa, V.M. Behavioral patterns, parity rate and natural infection analysis in anopheline species involved in the transmission of malaria in the northeastern Brazilian Amazon region. Acta Trop. 2016, 164, 216–225. [Google Scholar] [CrossRef]
- Das, S.; Muleba, M.; Stevenson, J.C.; Pringle, J.C.; Norris, D.E. Beyond the entomological inoculation rate: Characterizing multiple blood feeding behavior and Plasmodium falciparum multiplicity of infection in Anopheles mosquitoes in northern Zambia. Parasites Vectors 2017, 10, 45. [Google Scholar] [CrossRef]
- Logue, K.; Keven, J.B.; Cannon, M.V.; Reimer, L.; Siba, P.; Walker, E.D.; Zimmerman, P.A.; Serre, D. Unbiased Characterization of Anopheles Mosquito Blood Meals by Targeted High-Throughput Sequencing. PLoS Negl. Trop. Dis. 2016, 10. [Google Scholar] [CrossRef]
- Ndenga, B.A.; Mulaya, N.L.; Musaki, S.K.; Shiroko, J.N.; Dongus, S.; Fillinger, U. Malaria vectors and their blood-meal sources in an area of high bed net ownership in the western Kenya highlands. Malar. J. 2016, 15, 76. [Google Scholar] [CrossRef]
- Massebo, F.; Balkew, M.; Gebre-Michael, T.; Lindtjorn, B. Blood meal origins and insecticide susceptibility of Anopheles arabiensis from Chano in South-West Ethiopia. Parasites Vectors 2013, 6, 44. [Google Scholar] [CrossRef]
- Diatta, M.; Spiegel, A.; Lochouarn, L.; Fontenille, D. Similar feeding preferences of Anopheles gambiae and A. arabiensis in Senegal. Trans. R. Soc. Trop. Med. Hyg. 1998, 92, 270–272. [Google Scholar] [CrossRef]
- Roy, A.; Ansari, M.A.; Sharma, V.P. Feeding behavior patterns of anophelines from Uttar Pradesh and Gujarat states of India. J. Am. Mosq. Control Assoc. 1991, 7, 11–15. [Google Scholar] [PubMed]
- Tandina, F.; Laroche, M.; Davoust, B.; Doumbo, O.K.; Parola, P. Blood meal identification in the cryptic species Anopheles gambiae and Anopheles coluzzii using MALDI-TOF MS. Parasite 2018, 25, 40. [Google Scholar] [CrossRef]
- Scott, T.W.; Takken, W. Feeding strategies of anthropophilic mosquitoes result in increased risk of pathogen transmission. Trends Parasitol. 2012, 28, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Fornadel, C.M.; Norris, D.E. Increased endophily by the malaria vector Anopheles arabiensis in southern Zambia and identification of digested blood meals. Am. J. Trop. Med. Hyg. 2008, 79, 876–880. [Google Scholar] [CrossRef]
- Martinez-de la Puente, J.; Ruiz, S.; Soriguer, R.; Figuerola, J. Effect of blood meal digestion and DNA extraction protocol on the success of blood meal source determination in the malaria vector Anopheles atroparvus. Malar. J. 2013, 12, 109. [Google Scholar] [CrossRef]
- Tedrow, R.E.; Ratovonjato, J.; Walker, E.D.; Ratsimbasoa, A.C.; Zimmerman, P.A. A novel assay for simultaneous assessment of mammalian host blood, mosquito species, and Plasmodium spp. in the medically important Anopheles mosquitoes of Madagascar. Am. J. Trop. Med. Hyg. 2019, 100, 544–551. [Google Scholar] [CrossRef]
- Getachew, D.; Gebre-Michael, T.; Balkew, M.; Tekie, H. Species composition, blood meal hosts and Plasmodium infection rates of Anopheles mosquitoes in Ghibe River Basin, southwestern Ethiopia. Parasites Vectors 2019, 12, 257. [Google Scholar] [CrossRef]
- Vezenegho, S.B.; Chiphwanya, J.; Hunt, R.H.; Coetzee, M.; Bass, C.; Koekemoer, L.L. Characterization of the Anopheles funestus group, including Anopheles funestus-like, from Northern Malawi. Trans. R. Soc. Trop. Med. Hyg. 2013, 107, 753–762. [Google Scholar] [CrossRef]
- Tedrow, R.E.; Rakotomanga, T.; Nepomichene, T.; Howes, R.E.; Ratovonjato, J.; Ratsimbasoa, A.C.; Svenson, G.J.; Zimmerman, P.A. Anopheles mosquito surveillance in Madagascar reveals multiple blood feeding behavior and Plasmodium infection. PLoS Negl. Trop. Dis. 2019, 13. [Google Scholar] [CrossRef] [PubMed]
- Degefa, T.; Yewhalaw, D.; Zhou, G.; Lee, M.C.; Atieli, H.; Githeko, A.K.; Yan, G. Indoor and outdoor malaria vector surveillance in western Kenya: Implications for better understanding of residual transmission. Malar. J. 2017, 16, 443. [Google Scholar] [CrossRef] [PubMed]
Host | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | Annealing T° (°C) | Product Size (bp) |
---|---|---|---|---|
Human | acacaactgtgtttcactagc | gaaacccaagagtcttctct | 60 | 210 |
Dog | agggcgcgatcctggagac | agacacaggcagagggagaa | 58 | 83 |
Bovine | tttcttgttatagcccaccacac | tttctctaaaggtggttggtcag | 60 | 98 |
Chicken | ctgggttgaaaaggaccacagt | gtgacgcactgaacaggttg | 58 | 169 |
Pig | gactaggaaccatgaggttgcg | agcctacaccacagccacag | 60 | 134 |
Sus scrufa | Bos taurus | Gallus gallus | Homo sapiens | Canis familiaris | HBI (%) | |
---|---|---|---|---|---|---|
An. albimanus | 30 | 43 | 54 | 27 | 15 | 25.2 |
An. darlingi | - | 15 | 17 | 11 | 11 | 55 |
An. crucians | 2 | 1 | - | - | 1 | - |
An. neivai | - | 4 | 1 | - | - | - |
An. pseudopunctipennis | - | - | - | 1 | - | 25 |
An. punctimacula | - | 2 | - | - | - | - |
An. vestitipennis | 4 | 2 | - | 1 | 2 | 4.4 |
Total | 36 | 67 | 72 | 40 | 29 | 22.1 |
n | Single (n = 1) | % | Mixed (n = 2) | % | Mixed (n = 3) | % | Mixed (n = 4) | % | Unknown | % | |
---|---|---|---|---|---|---|---|---|---|---|---|
An. albimanus | 107 | 27 | 25.2 | 42 | 39.3 | 20 | 18.7 | 1 | 0.9 | 17 | 15.9 |
An. darlingi | 20 | 3 | 15.0 | 5 | 25.0 | 3 | 15.0 | 8 | 40.0 | 1 | 5.0 |
An. crucians | 20 | 4 | 20.0 | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 | 16 | 80.0 |
An. neivai | 5 | 3 | 60.0 | 1 | 20.0 | 0 | 0.0 | 0 | 0.0 | 1 | 20.0 |
An. pseudopunctipennis | 4 | 1 | 25.0 | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 | 3 | 75.0 |
An. punctimacula | 2 | 2 | 100.0 | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 |
An. vestitipennis | 23 | 5 | 21.7 | 2 | 8.7 | 0 | 0.0 | 0 | 0.0 | 16 | 69.6 |
Total | 181 | 45 | 50 | 23 | 9 | 54 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Escobar, D.; Ascencio, K.; Ortiz, A.; Palma, A.; Sánchez, A.; Fontecha, G. Blood Meal Sources of Anopheles spp. in Malaria Endemic Areas of Honduras. Insects 2020, 11, 450. https://doi.org/10.3390/insects11070450
Escobar D, Ascencio K, Ortiz A, Palma A, Sánchez A, Fontecha G. Blood Meal Sources of Anopheles spp. in Malaria Endemic Areas of Honduras. Insects. 2020; 11(7):450. https://doi.org/10.3390/insects11070450
Chicago/Turabian StyleEscobar, Denis, Krisnaya Ascencio, Andrés Ortiz, Adalid Palma, Ana Sánchez, and Gustavo Fontecha. 2020. "Blood Meal Sources of Anopheles spp. in Malaria Endemic Areas of Honduras" Insects 11, no. 7: 450. https://doi.org/10.3390/insects11070450
APA StyleEscobar, D., Ascencio, K., Ortiz, A., Palma, A., Sánchez, A., & Fontecha, G. (2020). Blood Meal Sources of Anopheles spp. in Malaria Endemic Areas of Honduras. Insects, 11(7), 450. https://doi.org/10.3390/insects11070450