Next Article in Journal
Genetic Diversity in Invasive Populations of Argentine Stem Weevil Associated with Adaptation to Biocontrol
Previous Article in Journal
Impact of Sacbrood Virus on Larval Microbiome of Apis mellifera and Apis cerana
 
 
Due to planned maintenance work on our platforms, there might be short service disruptions on Saturday, December 3rd, between 15:00 and 16:00 (CET).
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Oral Ingestion of Bacterially Expressed dsRNA Can Silence Genes and Cause Mortality in a Highly Invasive, Tree-Killing Pest, the Emerald Ash Borer

1
Department of Entomology, University of Kentucky, Lexington, KY 40546-0091, USA
2
School of Life Sciences, University of Bedfordshire, Luton LU13JU, UK
*
Author to whom correspondence should be addressed.
Insects 2020, 11(7), 440; https://doi.org/10.3390/insects11070440
Received: 27 May 2020 / Revised: 9 July 2020 / Accepted: 11 July 2020 / Published: 14 July 2020

Abstract

:
RNA interference (RNAi) is a naturally occurring process inhibiting gene expression, and recent advances in our understanding of the mechanism have allowed its development as a tool against insect pests. A major challenge for deployment in the field is the development of convenient and efficient methods for production of double stranded RNA (dsRNA). We assessed the potential for deploying bacterially produced dsRNA as a bio-pesticide against an invasive forest pest, the emerald ash borer (EAB). EAB feeds on the cambial tissue of ash trees (Fraxinus spp.), causing rapid death. EAB has killed millions of trees in North America since its discovery in 2002, prompting the need for innovative management strategies. In our study, bacterial expression and synthesis of dsRNA were performed with E. coli strain HT115 using the L4440 expression vector. EAB-specific dsRNAs (shi and hsp) over-expressed in E. coli were toxic to neonate EAB after oral administration, successfully triggering gene silencing and subsequent mortality; however, a non-specific dsRNA control was not included. Our results suggest that ingestion of transformed E. coli expressing dsRNAs can induce an RNAi response in EAB. To our knowledge, this is the first example of an effective RNAi response induced by feeding dsRNA-expressing bacteria in a forest pest.

1. Introduction

RNA interference (RNAi) regulates gene expression at the post-transcriptional level by degrading specific messenger RNAs (mRNA), thus blocking translational efficiency [1]. RNAi using exogenous dsRNA is emerging as a novel means of pest suppression [2]. After introduction into cells, dsRNA is recognized by the RNase III enzyme dicer and processed into small interfering RNAs (siRNAs). These siRNAs then bind to the Argonaute protein and form an RNA-induced silencing complex (RISC), and the RISC complex binds to the complementary mRNA molecule, thus blocking gene expression [3].
Coleopteran insects are known to exhibit robust RNAi responses [2,4,5]. RNAi efficiency varies between insect species, insect life stages, target genes, and modes of dsRNA delivery [6]; dsRNA can be delivered in several ways, including by injection, orally, and through absorption [7]. While RNAi is emerging as an attractive option for insect pest control, convenient and efficient methods to produce and deliver dsRNA to target insects is challenging.
The emerald ash borer (EAB), Agrilus planipennis Fairmaire, is an exotic beetle that was accidentally introduced from China into North America in the mid- to late 1990s [8]. Adult beetles feed on ash, Fraxinus spp., and foliage and cause little damage, but larvae feed on cambial tissue beneath the bark, disrupting water and nutrient flow, and causing rapid tree death [9]. Ash species native to North America have very little resistance to the emerald ash borer [10]. EAB has killed millions of ash trees in North America since its introduction [11], and the invasion continues. Chemical suppression can be effective, but is expensive and unsustainable over large areas [12,13]. Classical biological control has been implemented, but it is slow-acting and expensive [14]. Thus, the EAB invasion in North America warrants explorations into innovative approaches for management [15].
In this study we evaluated the insecticidal potential of dsRNA-expressing bacteria delivered orally to neonate EAB larvae. dsRNA expressed in bacteria could provide dual benefits in terms of inexpensive production and efficient delivery.

2. Materials and Methods

2.1. Insect Rearing

EAB eggs were obtained from the United States Department of Agriculture, Animal and Plant Health Inspection Service, Plant Protection Quarantine (USDA APHIS PPQ) EAB Biocontrol Facility (Brighton, MI, USA). Immediately upon receipt the eggs were placed in Petri dishes (60 × 90 mm) with moistened filter paper and maintained at 23 °C and 75% relative humidity in a growth chamber. Newly hatched unfed larvae were used in bioassays.

2.2. Target Gene Selection, Total RNA Extraction, cDNA Synthesis, PCR Amplification, and Construction of Recombinant L4440 Vector

To assess the insecticidal activity of bacterially-expressed dsRNA, candidate genes shibire (shi) and heat shock protein-70kDA (hsp) were chosen due to their effectiveness in RNAi-induced EAB mortality by in vitro produced dsRNA [15]. Total RNA was extracted from EAB larvae using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions; RNA concentration and purity were evaluated using a Nano Drop 1000 (Thermo Fisher, USA). cDNA was synthesized from 1 µg of total RNA using a M-MLV reverse transcriptase kit (Thermo Fisher, USA). Target sequences of shi and hsp were amplified using gene-specific primers with restriction enzymes (Table 1). PCR conditions were as follows: 94 °C for 5 min, followed by 35 cycles of initial denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s and extension at 67 °C for 1 min, and finishing with extension at 67 °C for 8 min.
The L4440 plasmid (Addgene plasmid 1654) comprising two T7 promoters in an inverted position flanking multiple cloning sites was used to clone target genes. Restriction (Xba I and XmaI) digested amplicons were ligated into the Xba I and XmaI digested L4440 vector, respectively. The recombinant vectors were validated by colony PCR [16] and restriction digestion (Xba I and XmaI).

2.3. Bacterial Transformation and Expression of dsRNA

The RNase III-deficient E. coli strain HT115 (DE3), obtained through the CGC at the University of Minnesota, was grown in Luria broth (LB) medium with ampicillin (100 µg/mL) and tetracycline (10 µg/mL). The recombinant L4440 vector was transformed into E. coli HT115 (DE3) competent cells. Single bacterial colonies were cultured in LB broth maintained on a shaker incubator at 37 °C (225 rpm) overnight. Cultured broth was then transferred to 50 mL fresh broth medium containing 100 µg/mL ampicillin and cultured at 37 °C until colony growth reached the late exponential phase, with OD600 = 0.4–0.6. Expression of T7 RNA polymerase was induced by adding a final concentration of 0.5 mM of isopropyl-β-D-1-thiogalactopyranoside (IPTG). Bacteria with dsSHI and dsHSP were then incubated at 37 °C, 30 °C, and 25 °C for up to 4 h to evaluate dsRNA expression. Based on this optimization, further experiments were conducted at 37 °C for dsSHI and 30 °C for dsHSP. Total bacterial RNA was extracted with Trizol reagent and the presence of synthesized dsRNA was confirmed by electrophoresis using a 1% agarose gel.

2.4. Biological Activity of Recombinant Bacteria Expressing dsRNA

Laboratory-reared EAB eggs were placed in petri dishes with moistened filter paper and maintained at 24 ± 1 °C in an incubator (Figure 1). Newly hatched neonates were used in all bioassays. To determine the biological activity of the recombinant bacteria expressing dsRNA, neonate EAB larvae were fed using a modified droplet feeding bioassay [5], where 1 ml of bacterial culture was centrifuged at 3000 rpm for 15 min and the pellet was dissolved in 100 μL of 1% sucrose solution with green tracking dye (Kroger, Co., USA). For each assay, 3μL of bacterial suspension were fed to individual neonate larvae using the droplet assay. Cellular density of the bacterial culture was determined by considering that an optical density of 1 at 600 nm corresponds to 108 bacterial cells/mL [17]. As the control, HT115 (DE3) bacteria were used as a treatment [18]. Neonate EAB larvae were fed dsRNA-expressing bacteria for five consecutive days. On day 6, larvae were fed with 1% sucrose lacking dsRNAs for two days. Assays were maintained in an incubator at 26 ± 1 °C, under a 14:10 (L:D) photoperiod. Mortality was measured on day 5 (the last day of dsRNA feeding) and on day 7 (the final day of bioassays). Each treatment was replicated three times, and for each replication, 10–15 larvae were used. Mortality (%) was calculated and the mean values of the experimental replicates were analyzed using a one-way ANOVA, with Tukey’s post-hoc t-test to evaluate differences.

2.5. Molecular Validation of Gene Silencing

Following ingestion of dsRNA-expressing bacteria, total RNA was isolated from 5–6 EAB larvae at two time intervals (72 h and 120 h) using Trizol reagent. Total RNA was treated with DNase I to degrade any genomic contamination. cDNA was synthesized using a M-MLV Reverse Transcriptase Kit (Thermo Fisher, USA), and was used as a template for gene expression studies. The expression analysis of the target gene was performed using SYBR™ Green Master Mix (Applied Biosystems, USA). qPCR reactions were performed using StepOnePlus Real-Time PCR system (Life Technologies, USA). All reactions were carried out in triplicate with a final volume of 10 μL. A melting curve was generated at the end of each reaction to confirm single product (target) amplification. In order to eliminate undesirable amplification from input recombinant plasmids and/or dsRNAs, primers for qPCR were designed to detect target mRNAs by amplifying only sequences that lay outside of the insert interfering sequences. The TEF1α gene (Table 1) was used as the reference gene ([19]; Supplemental Material), and the 2−ΔΔCt method [20] was used to calculate expressions of the target gene relative to the control. A two-tailed t-test was used for statistical analysis to compare the means of a single variable.

3. Results

3.1. Bacterial Transformation and Expression of dsRNA

Bacteria were prepared with the recombinant vector containing fragments of the shi and hsp genes (Figure 2a). Using colony PCR, we confirmed that 100% of the recombinant bacterial colonies tested contained the insert: dsSHI (483 bp) and dsHSP (468 bp) (Figure 2b), and the IPTG-induced bacteria expressed dsRNA specific to EAB (shi (483 bp) and hsp (468 bp)). Expression of dsSHI was at 37 °C for 4 h and dsHSP was at 30 °C for 4 h (Figure 2c,d). The two genes were successfully synthesized in the bacteria.

3.2. Biological Activity of dsRNA Expressing E. Coli Against EAB

Ingestion of dsRNA-expressing bacteria targeting shi and hsp caused 69.44% and 46.66% mortality, respectively, of neonate larvae at day 7 (Figure 3 and Figure 4). Larvae ingesting dsSHI and dsHSP experienced greater mortality than control larvae ingesting bacteria that lacked the dsRNA, and dsSHI-ingested larvae appeared to grow more slowly based on larval length (Figure 5).

3.3. Molecular Validation of Gene Silencing

Our qPCR analysis showed that bacteria containing dsSHI resulted in a 24.92% reduction in gene expression at 72 h; expression did not differ from controls. However, at 120 h post-exposure there was a 74.14% reduction in the transcript level, which differed significantly from controls (untransformed bacteria) (Figure 6a). Silencing hsp caused 48.67% and 96.94% reductions in the transcript level relative to controls at 72 h and 120 h, respectively (Figure 6b), following exposure to bacterially-expressed dsRNA.

4. Discussion

This is the first time an effective RNAi response in the tree-killing EAB using oral ingestion of dsRNA-expressing bacteria has been demonstrated. We transformed HT115 E. coli to express dsSHI and dsHSP specific to EAB, which caused gene knockdown and showed biocidal activity that resulted in significant mortality of neonate EAB larvae. Use of bacterially-expressed dsRNA to trigger RNAi was first demonstrated experimentally in Caenorhabditis elegans [21], and bacterially-expressed dsRNA has subsequently been used against numerous insect pests. In the coleopteran Leptinotarsa decemlineata, ingestion of bacterially-expressed dsRNA led to effective suppression of five target genes, causing decreases in body weight and significant mortality of treated beetles [22]. In our work the engineered E. coli strain HT115 (DE3), lacking dsRNA-specific RNase III produced EAB-specific dsRNAs and effectively triggered the RNAi pathway upon ingestion by EAB larvae. These features make HT115 (DE3) a promising strain for preparing dsRNA in vivo, providing a less costly and potentially more efficient alternative to in vitro synthesis of dsRNA. However, bacterial dsRNA production can have limitations; recombinant bacterial production of dsRNA is reportedly less effective in causing mortality in Spodoptera exigua (Order: Lepidoptera) than is in vitro synthesized dsRNA [23], perhaps due to a lower expression of target gene(s) in bacteria. These direct comparisons have yet to be made experimentally in EAB.
Selection of target gene(s) and target regions within gene(s) is crucial for successful gene silencing. Second-generation sequencing can provide information on target gene selection and screening [4,24], with the goal of selecting genes and/or target regions within genes with increasing RNAi efficiency in the target pest, while having no measurable off-target effects. Here we used two target genes, shibire (shi), and heat shock protein-70kDa protein (hsp), which play essential biological functions and are efficacious in EAB [15], and demonstrate their potential for use in bacterially-expressed RNAi-based EAB management. The heat shock-70kDA protein gene (hsp) functions in protein folding and protects cells from stress [25], while the shibire gene (shi) is involved in production of microtubule bundles, endocytosis and other vesicular trafficking processes [26]. The loss in function of either of these target genes in EAB neonates ingesting transformed bacteria causes significant larval mortality (shi: ~69% and hsp: ~46%) as well as an apparent suppression of larval growth (shi). Ingestion of bacteria producing dsRNAs, specifically double stranded integrin (dsINT), has also been shown to reduce growth of the lepidoptera, S. exigua [23].
We have demonstrated that, when ingested, bacteria transformed to produce EAB-specific dsRNA can silence target genes and kill neonate EAB, which creates additional potential for its use as a biopesticide. Recombinant bacteria with EAB-specific dsRNA could be sprayed on foliage to be ingested by feeding beetles or on ash stems to be ingested by newly hatched neonates. Naked dsRNAs applied topically or through root drenching can be assimilated into and moved through ash plant tissues [27], suggesting crude extract of bacterially-expressed dsRNA may also be able to be translocated through the plant via soil drench, trunk sprays or injection [28]. Recombinant bacteria producing EAB-specific dsRNAs also make the genetic transformation of ash trees with dsRNA-expressing constructs a more plausible goal [29].

5. Conclusions

We showed that EAB fed with dsRNA-expressing bacteria results in downregulation of selected genes, demonstrating the potential for application of bacterially-expressed dsRNA for controlling EAB; however, in the current experiment a non-specific dsRNA control was not included. Although optimization of bacterial dsRNA production and expression is needed, our observations suggest that RNA interference mediated by bacterial dsRNA could be a convenient and cost-effective approach for managing this invasive pest.
The specificity of these EAB-specific dsRNAs is an essential step towards moving this approach to the deployment phase; these evaluations are under way. Additionally, management of resistance in the pest population is essential. Western corn root worm, Diabrotica virgifera, has shown field-level resistance to DvSnf7 dsRNA [30], necessitating development and selection of new targets. This process is relatively simple, however, and involves screening for and switching to other appropriate dsRNAs, thereby managing for the potential development of resistance. dsRNAs can be designed for a different region in the same target gene or new genes much more quickly and efficiently than developing a more expensive chemical insecticide [22]. There are clearly knowledge gaps that must be addressed before this technology can be deployed in the EAB–ash system. Potential off-target effects in EAB, mutation of RNAi core machinery genes, mutation of target genes, and enhanced dsRNA degradation, not to mention potential effects on non-target organisms, must be more fully understood before deployment of bacterially-expressed dsRNA in EAB management can become practical.
RNAi is an emerging pest management tool with tremendous potential to protect plants against insect pests. Its application continues to expand into crop and vegetable production [2,6,24,31,32], and horticultural [32,33] and forest systems [5,34,35], and there are numerous native and non-native tree pests that might be appropriate candidates. If RNAi technology can be deployed aggressively along the invasion front to prevent widespread and catastrophic tree losses, this could reduce management costs, freeing up resources for other aspects of integrated forest management [34,35,36,37,38]. In some situations, EAB can be managed with chemical insecticides [13,39] and biological control has shown considerable potential [12,13,14]. However, the need for a rapid-acting, effective, and environmentally friendly approach, such as RNAi, remains high.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-4450/11/7/440/s1, Data is freely available at UKnowledge (provisional no. MS#1004) (https://uknowledge.uky.edu/cgi/preview.cgi?article=1004&context=entomology_data_.

Author Contributions

R.S.L. and L.K.R. conceived the experiments, R.S.L. conducted the experiments, and R.S.L. and L.K.R. analyzed the results and prepared the manuscript. All authors have read and agreed to the published version of this manuscript.

Funding

This work was supported by the University of Kentucky, the USDA Forest Service Forest Health Research and Education Center, and the Kentucky Agricultural Experiment Station under McIntire–Stennis 2351197000 (LKRK), and is published with the approval of the director.

Acknowledgement

The L4440 plasmid was obtained through Addgene. HT115 (D3) was provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391, 806–811. [Google Scholar] [CrossRef]
  2. Baum, J.A.; Thierry, B.; William, C.; Gregory, R.H.; Pascale, F.; Oliver, I.; Scott, J.; Robert, J. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 2007, 25, 1322–1326. [Google Scholar] [CrossRef]
  3. Jinek, M.; Doudna, J.A. A three-dimensional view of the molecular machinery of RNA interference. Nature 2009, 457, 405–412. [Google Scholar] [CrossRef]
  4. Knorr, E.; Fishilevich, E.; Tenbusch, L.; Meghan, L.; Rangasamy, M.; Billion, A.; Sarah, E.; Gandhra, P.; Arora, K.; Narva, K.E. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests. Sci. Rep. 2018, 8, 2061. [Google Scholar] [CrossRef] [PubMed]
  5. Rodrigues, T.B.; Duan, J.J.; Palli, S.R.; Rieske, L.K. Identification of highly effective target genes for RNAi-mediated control of emerald ash borer, Agrilus planipennis. Sci. Rep. 2018, 8, 5020. [Google Scholar] [CrossRef] [PubMed][Green Version]
  6. Terenius, O.; Paoanicolaou, A.; Garbutt, J.S.; Elefttherianos, I.; Huvenne, H.; Kanginakudru, S. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [PubMed][Green Version]
  7. Prentice, K.; Pertry, I.; Christiaens, O.; Bauters, L.; Bailey, A.; Niblett, C.; Gislain, M.; Smagghe, G. Transcriptome analysis and systemic RNAi response in the African sweetpotato weevil (Cylas puncticollis, Coleoptera, Brentidae). PLoS ONE 2015, 10, e0115336. [Google Scholar] [CrossRef][Green Version]
  8. Siegert, N.W.; McCullough, D.G.; Liebhold, A.; Telewski, F.W. Dendrochronological reconstruction of the epicenter and early spread of emerald ash borer in North America. Divers. Distrib. 2014, 20, 847–858. [Google Scholar] [CrossRef]
  9. Haack, R.A.; Jendek, E.; Liu, H.; Merchant, K.R.; Petrice, T.R.; Poland, T.M.; Ye, H. The emerald ash borer: A new exotic pest in North America. Newsl. Michigan Entomol. Soc. 2012, 47, 1–7. [Google Scholar]
  10. Rebek, E.J.; Herms, D.A.; Smitley, D.R. Interspecific variation in resistance to emerald ash borer (Coleoptera: Buprestidae) among North American and Asian ash (Fraxinus spp.). Environ. Entomol. 2008, 37, 242–246. [Google Scholar] [CrossRef][Green Version]
  11. Herms, D.A.; McCullough, D.G. Emerald ash borer invasion of North America: History, biology, ecology, impacts, and management. Annu. Rev. Entomol. 2014, 59, 13–30. [Google Scholar] [CrossRef] [PubMed][Green Version]
  12. Davidson, W.; Rieske, L.K. Establishment of classical biological control targeting emerald ash borer is facilitated by use of insecticides, with little effect on native arthropod communities. Biol. Control 2016, 101, 78–86. [Google Scholar] [CrossRef][Green Version]
  13. Miller, F.; Gould, J.; Fierke, M.; Jones, M.; Kaltenbach, J. Compatibility of insecticides and biocontrol for controlling EAB in urban environments. In Proceedings of the Emerald Ash Borer National Research and Technology Development Meeting, Wooster, OH, USA, 15–16 October 2014. [Google Scholar]
  14. Duan, J.J.; Abell, J.; Bauer, L.S.; Gould, J.; Van Driesche, R. Natural enemies implicated in the regulation of an invasive pest: A life table analysis of the population dynamics of the emerald ash borer. Agric. Forest Entomol. 2014, 16, 406–416. [Google Scholar] [CrossRef]
  15. Rodrigues, T.B.; Rieske, L.K.; Duan, J.J.; Mogilicherla, K.; Palli, S.R. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis. Sci. Rep. 2017, 7, 7379. [Google Scholar] [CrossRef] [PubMed][Green Version]
  16. Jacobus, A.P.; Gross, J. Optimal cloning of PCR fragments by homologous recombination in Escherichia coli. PLoS ONE 2015, 10, 1–17. [Google Scholar] [CrossRef] [PubMed][Green Version]
  17. Solis, F.C.; Julien, S.R.; Doranda, P.; Christian, W.; Nancy, G. Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression. PLoS ONE 2009, 4, e8424. [Google Scholar] [CrossRef] [PubMed]
  18. Al Baki, A.; Jung, J.K.; Kim, Y. Alteration of insulin signaling to control insect pest by using transformed bacteria expressing dsRNA. Pest Manag. Sci. 2020, 76, 1020–1030. [Google Scholar] [CrossRef]
  19. Rajarapu, S.P.; Mamidala, P.; Mittapalli, O. Validation of reference genes for gene expression studies in the emerald ash borer. Insect Sci. 2011, 19, 41–46. [Google Scholar] [CrossRef]
  20. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  21. Timmons, L.; Fire, A. Specific interference by ingested dsRNA. Nature 1998, 395, 854. [Google Scholar] [CrossRef]
  22. Zhu, F.; Xu, J.; Palli, R.; Ferguson, J.; Palli, S.R. Ingested RNA interference for managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata. Pest Manag. Sci. 2010, 67, 175–182. [Google Scholar] [CrossRef] [PubMed]
  23. Kim, E.; Park, Y.; Kim, Y. A transformed bacterium expressing double-stranded RNA specific to integrin β1enhances Bt toxin efficacy against a polyphagous insect pest, Spodoptera exigua. PLoS ONE 2015, 10, 7. [Google Scholar] [CrossRef]
  24. Wang, Y.; Zangh, H.; Li, X.; Miao, X. Second generation sequencing supply an effective way to screen RNAi targets in large-scale for potential application in pest insect control. PLoS ONE 2011, 6, e18644. [Google Scholar] [CrossRef] [PubMed][Green Version]
  25. Tavaria, M.; Gabriele, T.; Kola, I.; Anderson, R.L. A hitchhiker’s guide to the human Hsp70 family. Cell Stress Chaperon. 1996, 1, 23–28. [Google Scholar] [CrossRef][Green Version]
  26. Kosaka, T.; Ikeda, K. Reversible blockage of membrane retrieval and endocytosis in the garland cell of the temperature-sensitive mutant of Drosophila melanogaster, shribirets 1. J. Cell Biol. 1983, 97, 499–507. [Google Scholar] [CrossRef] [PubMed]
  27. Pampolini, F.B.; Rodrigues, T.B.; Leelesh, R.S.; Kawashima, T.; Rieske, L.K. Confocal microscopy provides visual evidence and confirms the feasibility of dsRNA delivery to emerald ash borer through plant tissues. J. Pest Sci. 2020. [Google Scholar] [CrossRef]
  28. Tenllado, F.; Martínez-García, B.; Vargas, M.; Diaz-Ruiz, J.R. Crude extracts of bacterially expressed dsRNA can be used to protect plants against virus infections. BMC Biotechnol. 2003, 3. [Google Scholar] [CrossRef][Green Version]
  29. Kalantidis, K.; Psaradakis, S.; Tabler, M.; Tsagris, M. The occurrence of CMV-specific short RNAs in transgenic tobacco expressing virus-derived double-stranded RNA is indicative of resistance to the virus. Mol. Plant-Microbe Inter. 2002, 15, 826–833. [Google Scholar] [CrossRef][Green Version]
  30. Khajuria, C.; Ivashuta, S.; Wiggins, E.; Flagel, L.; Moar, W.; Pleau, M.; Miller, K.; Zhang, Y.; Ramaseshadri, P.; Jiang, C.; et al. Development and characterization of the first dsRNA-resistant insect population from western corn rootworm, Diabrotica virgifera virgifera LeConte. PLoS ONE. 2018, 13, e0197059. [Google Scholar] [CrossRef][Green Version]
  31. William, M.; Clark, G.; Sathasivan, K.; Islam, A.S. RNA interference and its application in crop improvement. Plant Tissue Cult. Biotechnol. 2004, 1, 18. [Google Scholar]
  32. Burand, J.P.; Hunter, W.B. RNAi: Future in insect management. J. Invert. Pathol. 2013, 112, S68–S74. [Google Scholar] [CrossRef]
  33. Taning, C.N.T.; Andrade, E.C.; Hunter, W.B.; Christiaens, O.; Smagghe, G. Asian citrus psyllid RNAi pathway—RNAi evidence. Sci. Rep. 2016, 6, 38082. [Google Scholar] [CrossRef] [PubMed][Green Version]
  34. Kyre, B.R.; Rodrigues, T.B.; Rieske, L.K. RNA interference and validation of reference genes for gene expression analyses using RT-qPCR in southern pine beetle, Dendroctonus frontalis. Sci. Rep. 2019, 9, 5640. [Google Scholar] [CrossRef]
  35. Kyre, B.R.; Bentz, B.J.; Rieske, L.K. Susceptibility of mountain pine beetle (Dendroctonus ponderosae Hopkins) to gene silencing through RNAi provides potential as a novel management tool. For. Ecol. 2020, in press. [Google Scholar]
  36. Hunter, W.B.; Sinisterra-Hunter, X. Emerging RNA suppression technologies to protect citrus trees from citrus greening disease bacteria. Adv. Insect Physiol. 2018, 55, 163–199. [Google Scholar] [CrossRef]
  37. Cagliari, D.; Dias, N.P.; Galdeano, D.M.; dos Santos, E.Á.; Smagghe, G.; Zotti, M.J. Management of pest insects and plant diseases by non-transformative RNAi. Front. Plant Sci. 2019, 10, 1319. [Google Scholar] [CrossRef] [PubMed][Green Version]
  38. Fletcher, S.J.; Reeves, P.T.; Hoang, B.T.; Mitter, N. A perspective on RNAi-based biopesticides. Front. Plant Sci. 2020, 11, 51. [Google Scholar] [CrossRef] [PubMed][Green Version]
  39. Herms, D.A.; McCullough, D.G.; Smitley, D.R.; Sadof, C.S.; Cranshaw, W. Insecticide options for protecting ash trees from emerald ash borer. North Central IPM Center Bull. 2009, 3–14. [Google Scholar]
Figure 1. Emerald ash borer egg hatch at 24 ± 1 °C and neonate larva.
Figure 1. Emerald ash borer egg hatch at 24 ± 1 °C and neonate larva.
Insects 11 00440 g001
Figure 2. Construction of recombinant E. coli expressing emerald ash borer (EAB)-specific dsRNAs, showing (a) a schematic diagram of the recombinant plasmid for the expression and production of dsRNA, (b) colony PCR confirmation of recombinant bacteria (lane M: 1Kb marker, lane SHI: shi gene amplified from two individual bacterial colonies), lane HSP: heat shock protein (hsp) gene amplified from two individual bacterial colonies, (c) biosynthesis of dsRNA corresponding to partial sequence of the shibire (shi) gene in the RNAse III deficient bacterial strain (lane M: 1Kb marker, lanes 1 and 2: uninduced dsSHI, lane 3: dsSHI induced by IPTG), and (d) biosynthesis of dsRNA corresponding to partial sequence of the hsp gene in the RNAse III deficient bacterial strain (lane M: 1Kb marker, lane 1: uninduced dsHSP, lane 2: dsHSP induced by IPTG).
Figure 2. Construction of recombinant E. coli expressing emerald ash borer (EAB)-specific dsRNAs, showing (a) a schematic diagram of the recombinant plasmid for the expression and production of dsRNA, (b) colony PCR confirmation of recombinant bacteria (lane M: 1Kb marker, lane SHI: shi gene amplified from two individual bacterial colonies), lane HSP: heat shock protein (hsp) gene amplified from two individual bacterial colonies, (c) biosynthesis of dsRNA corresponding to partial sequence of the shibire (shi) gene in the RNAse III deficient bacterial strain (lane M: 1Kb marker, lanes 1 and 2: uninduced dsSHI, lane 3: dsSHI induced by IPTG), and (d) biosynthesis of dsRNA corresponding to partial sequence of the hsp gene in the RNAse III deficient bacterial strain (lane M: 1Kb marker, lane 1: uninduced dsHSP, lane 2: dsHSP induced by IPTG).
Insects 11 00440 g002
Figure 3. Insecticidal activity of bacterial dsRNA specific to shi and hsp in EAB larvae is demonstrated by mortality of neonate EAB larvae (mean ± Standard Error) following ingestion of dsRNA-expressing bacteria relative to those ingesting HT115 (control), which contained no dsRNA (N = 3). One-way ANOVA, with a post-hoc t-test (Tukey) was used to evaluate differences at p < 0.05.
Figure 3. Insecticidal activity of bacterial dsRNA specific to shi and hsp in EAB larvae is demonstrated by mortality of neonate EAB larvae (mean ± Standard Error) following ingestion of dsRNA-expressing bacteria relative to those ingesting HT115 (control), which contained no dsRNA (N = 3). One-way ANOVA, with a post-hoc t-test (Tukey) was used to evaluate differences at p < 0.05.
Insects 11 00440 g003
Figure 4. Effect of dsRNAs specific to shi and hsp on EAB neonate larval survival (%) 7 d after feeding on dsRNA-expressing bacteria (N = 3). Observations were taken on day 1, day 5, and day 7. One-way ANOVA, with a post-hoc t-test (Tukey) was used to evaluate differences at p < 0.05.
Figure 4. Effect of dsRNAs specific to shi and hsp on EAB neonate larval survival (%) 7 d after feeding on dsRNA-expressing bacteria (N = 3). Observations were taken on day 1, day 5, and day 7. One-way ANOVA, with a post-hoc t-test (Tukey) was used to evaluate differences at p < 0.05.
Insects 11 00440 g004
Figure 5. Neonate EAB larvae showing suppressed growth of those fed bacteria expressing dsSHI relative to control larvae (C—control) fed bacteria containing no dsRNA.
Figure 5. Neonate EAB larvae showing suppressed growth of those fed bacteria expressing dsSHI relative to control larvae (C—control) fed bacteria containing no dsRNA.
Insects 11 00440 g005
Figure 6. Quantitative RT-PCR analysis of transcript levels after RNAi-mediated repression of gene expression in EAB. Relative expression (mean ± SE) of (a) shi and (b) hsp genes in neonate EAB larvae 72 h and 120 h after feeding on dsRNA-expressing bacteria (N = 3). Asterisks (*) indicate a significant difference in gene expression within each time interval (t-test, two-tailed p < 0.05). Results are expressed as the relative expression of the target gene in treated samples relative to the control.
Figure 6. Quantitative RT-PCR analysis of transcript levels after RNAi-mediated repression of gene expression in EAB. Relative expression (mean ± SE) of (a) shi and (b) hsp genes in neonate EAB larvae 72 h and 120 h after feeding on dsRNA-expressing bacteria (N = 3). Asterisks (*) indicate a significant difference in gene expression within each time interval (t-test, two-tailed p < 0.05). Results are expressed as the relative expression of the target gene in treated samples relative to the control.
Insects 11 00440 g006
Table 1. Primer sequences for dsRNA synthesis and qPCR of the target genes shi and hsp, and for qPCR of the reference gene TEF-1α; bold italics indicate sequences of restriction enzymes.
Table 1. Primer sequences for dsRNA synthesis and qPCR of the target genes shi and hsp, and for qPCR of the reference gene TEF-1α; bold italics indicate sequences of restriction enzymes.
GenePrimerPrimer Sequence (5′–3′)
hsp—heat shock protein (70kDA)F-dsRNA-HSPCTAGTCTAGAGTTACGAGCCAGGGTGAAAA
R-dsRNA-HSPTCCCCCCGGGCCTTTTGAACGGCACGGTTAT
F-qRNA-HSPGACAAAGGAACGGGAAACAA
R-qRNA-HSPTCTCGGCATCCCTTATCATC
shi—shibireF-dsRNA-SHICTAGTCTAGATGGCACATTTGTATGCCAGT
R-dsRNA-SHITCCCCCCGGGCTTGTTGCATTTGCTGAGGA
F-qRNA-SHIGGGATCTGCCCAAATTAACA
R-qRNA-SHICCCGTCTGAGTTCTTTCTCG
TEF-1α-Translation elongation factor 1 alphaF-qRNA-TEFCATTGAAACCTACGTTGTCGC
R-qRNA-TEFACTGGAGTGCTTAAACCTGG

Share and Cite

MDPI and ACS Style

Leelesh, R.S.; Rieske, L.K. Oral Ingestion of Bacterially Expressed dsRNA Can Silence Genes and Cause Mortality in a Highly Invasive, Tree-Killing Pest, the Emerald Ash Borer. Insects 2020, 11, 440. https://doi.org/10.3390/insects11070440

AMA Style

Leelesh RS, Rieske LK. Oral Ingestion of Bacterially Expressed dsRNA Can Silence Genes and Cause Mortality in a Highly Invasive, Tree-Killing Pest, the Emerald Ash Borer. Insects. 2020; 11(7):440. https://doi.org/10.3390/insects11070440

Chicago/Turabian Style

Leelesh, Ramya Shanivarsanthe, and Lynne K. Rieske. 2020. "Oral Ingestion of Bacterially Expressed dsRNA Can Silence Genes and Cause Mortality in a Highly Invasive, Tree-Killing Pest, the Emerald Ash Borer" Insects 11, no. 7: 440. https://doi.org/10.3390/insects11070440

Note that from the first issue of 2016, MDPI journals use article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop