Differential Gene Expression and Methylation Analysis of Melanoma in TCGA Database to Further Study the Expression Pattern of KYNU in Melanoma
Abstract
1. Introduction
2. Materials and Methods
2.1. Data Download and Analysis
2.2. Immunohistochemistry
2.3. Cell Culture and Transfection
2.4. Western Blotting
2.5. qRT-PCR
2.6. CFDA-SE Method to Detect Cell Proliferation
2.7. Annexin V–PI Double Staining to Detect Cell Apoptosis
3. Results
3.1. Research on the Expression of Melanoma-Related Genes and Signaling Pathways in TCGA Database
3.2. Study of the Mutated Genes and Loci of Melanoma in TCGA Database
3.3. DNA Methylation Studies of Melanoma in TCGA Database
3.4. Expression Level of KYNU in Melanoma
3.5. Study of the Regulatory Factors of KYNU in Melanoma
3.6. Effects of KYNU on Proliferation, Differentiation, Apoptosis, Invasion, and Migration of Melanoma
3.7. CFDA-SE Cell Staining and Flow Cytometry to Detect Cell Proliferation
3.8. Cell-Cycle and Apoptosis Detection in Melanoma
3.9. 3D and Coculture Cell Models Established to Analyze the Feasibility of the KYNU Tyrosinase Locus as a Melanoma Target
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Situm, M.; Buljan, M.; Kolic, M.; Vucic, M. Melanoma—Clinical, dermatoscopical, and histopathological morphological characteristics. Acta Dermatovenerol. Croat. 2014, 22, 1–12. [Google Scholar] [PubMed]
- Leonardi, G.C.; Falzone, L.; Salemi, R.; Zanghi, A.; Spandidos, D.A.; McCubrey, J.A.; Candido, S.; Libra, M. Cutaneous melanoma: From pathogenesis to therapy (Review). Int. J. Oncol. 2018, 52, 1071–1080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rastrelli, M.; Tropea, S.; Rossi, C.R.; Alaibac, M. Melanoma: Epidemiology, risk factors, pathogenesis, diagnosis and classification. In Vivo 2014, 28, 1005–1011. [Google Scholar] [PubMed]
- Grimaldi, A.M.; Cassidy, P.B.; Leachmann, S.; Ascierto, P.A. Novel approaches in melanoma prevention and therapy. In Advances in Nutrition and Cancer; Cancer Treatment and Research Series; Springer: Berlin/Heidelberg, Germany, 2014; Volume 159, pp. 443–455. [Google Scholar]
- Elder, D.E.; van Belle, P.; Elenitsas, R.; Halpern, A.; Guerry, D. Neoplastic progression and prognosis in melanoma. Semin. Cutan. Med. Surg. 1996, 15, 336–348. [Google Scholar] [CrossRef] [Scilit]
- Vukovic, P.; Lugovic-Mihic, L.; Cesic, D.; Novak-Bilic, G.; Situm, M.; Spoljar, S. Melanoma Development: Current Knowledge on Melanoma Pathogenesis. Acta Dermatovenerol. Croat. 2019, 27, 163–168. [Google Scholar]
- Garbe, C.; Hauschild, A.; Volkenandt, M.; Schadendorf, D.; Stolz, W.; Reinhold, U.; Kortmann, R.-D.; Kettelhack, C.; Frerich, B.; Keilholz, U.; et al. Evidence and interdisciplinary consense-based German guidelines: Diagnosis and surveillance of melanoma. Melanoma Res. 2007, 17, 393–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Esteva, A.; Kuprel, B.; Novoa, R.; Ko, J.; Swetter, S.; Blau, H.; Thrun, S. Dermatologist-level classification of skin cancer with deep neural networks. Nature 2017, 542, 115–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabrera, R.; Recule, F. Unusual Clinical Presentations of Malignant Melanoma: A Review of Clinical and Histologic Features with Special Emphasis on Dermatoscopic Findings. Am. J. Clin. Dermatol. 2018, 19 (Suppl. 1), 15–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mısır, A.F.; Durmuslar, M.C.; Zerener, T.; Gun, B.D. Primary malignant melanoma. Saudi Med. J. 2016, 37, 446–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lens, M.; Bataille, V.; Krivokapic, Z. Melanoma of the small intestine. Lancet Oncol. 2009, 10, 516–521. [Google Scholar] [CrossRef] [Scilit]
- Donizy, P.; Kaczorowski, M.; Biecek, P.; Halon, A.; Matkowski, R. Nuclear pseudoinclusions in melanoma cells: Prognostic fact or artifact? The possible role of Golgi phosphoprotein 3 overexpression in nuclear pseudoinclusions generation. Pathol. Int. 2018, 68, 117–122. [Google Scholar] [CrossRef] [Scilit]
- MacKay, R.J. Treatment Options for Melanoma of Gray Horses. Vet. Clin. N. Am. Equine Pract. 2019, 35, 311–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brandner, J.M.; Haass, N.K. Melanoma’s connections to the tumour microenvironment. Pathology 2013, 45, 443–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elder, D.E. Thin melanoma. Arch. Pathol. Lab. Med. 2011, 135, 342–346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pavri, S.N.; Clune, J.; Ariyan, S.; Narayan, D. Malignant Melanoma: Beyond the Basics. Plast. Reconstr. Surg. 2016, 138, e330–e340. [Google Scholar] [CrossRef] [Scilit]
- Caldarella, A.; Fancelli, L.; Manneschi, G.; Chiarugi, A.; Nardini, P.; Crocetti, E. How staging of thin melanoma is changed after the introduction of TNM 7th edition: A population-based analysis. J. Cancer Res. Clin. Oncol. 2016, 142, 73–76. [Google Scholar] [CrossRef] [Scilit]
- Kroon, B.B.; Bergman, W.; Coebergh, J.W.; Ruiter, D.J. Consensus on the management of malignant melanoma of the skin in The Netherlands. Dutch Melanoma Working Party. Melanoma Res. 1999, 9, 207–212. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, I. Malignant melanoma: Prognostic indicators. Mayo Clin. Proc. 1997, 72, 356–361. [Google Scholar] [CrossRef] [Scilit]
- Yde, S.S.; Sjoegren, P.; Heje, M.; Stolle, L.B. Mucosal Melanoma: A Literature Review. Curr. Oncol. Rep. 2018, 20, 28. [Google Scholar] [CrossRef] [Scilit]
- Bello, D.M.; Ariyan, C.E.; Carvajal, R.D. Melanoma mutagenesis and aberrant cell signaling. Cancer Control 2013, 20, 261–281. [Google Scholar] [CrossRef] [Scilit]
- Namikawa, K.; Yamazaki, N. Targeted Therapy and Immunotherapy for Melanoma in Japan. Curr. Treat. Options Oncol. 2019, 20, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lang, G. Current concepts in the management of patients with melanoma. Am. J. Clin. Dermatol. 2002, 3, 401–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shannan, B.; Perego, M.; Somasundaram, R.; Herlyn, M. Heterogeneity in melanoma. In Melanoma; Cancer Treatment Research Series; Springer: Berlin/Heidelberg, Germany, 2016; Volume 167. [Google Scholar]
- Triplett, T.A.; Garrison, K.C.; Marshal, N.; Donkor, M.; Blazeck, J.; Lamb, C.; Qerqez, A.; Dekker, J.D.; Tanno, Y.; Lu, W.-C.; et al. Reversal of indoleamine 2,3-dioxygenase-mediated cancer immune suppression by systemic kynurenine depletion with a therapeutic enzyme. Nat. Biotechnol. 2018, 36, 758–764. [Google Scholar] [CrossRef] [Scilit]
- Han, S.; Ren, Y.; He, W.; Liu, H.; Zhi, Z.; Zhu, X.; Yang, T.; Rong, Y.; Ma, B.; Purwin, T.J.; et al. ERK-mediated phosphorylation regulates SOX10 sumoylation and targets expression in mutant BRAF melanoma. Nat. Commun. 2018, 9, 28. [Google Scholar] [CrossRef] [Scilit]
- Turner, N.; Ware, O.; Bosenberg, M. Genetics of metastasis: Melanoma and other cancers. Clin. Exp. Metastasis 2018, 35, 379–391. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; McArthur, G. Cell Cycle Regulation and Melanoma. Curr. Oncol. Rep. 2016, 18, 34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, Y.; Huang, H. Interplay Among PI3K/AKT, PTEN/FOXO and AR Signaling in Prostate Cancer. Adv. Exp. Med. Biol. 2019, 1210, 319–331. [Google Scholar]
- Fard, S.S. The Correlation between EGFR and Androgen Receptor Pathways: A Novel Potential Prognostic Marker in Gastric Cancer. Anticancer Agents Med. Chem. 2019, 19, 2097–2107. [Google Scholar] [CrossRef] [Scilit]
- Wong, S.H.M.; Fang, C.M.; Chuah, L.-C.; Leong, C.O.; Ngai, S.C. E-cadherin: Its dysregulation in carcinogenesis and clinical implications. Crit. Rev. Oncol. Hematol. 2018, 121, 11–22. [Google Scholar] [CrossRef] [Scilit]
- Inkeles, M.S.; Scumpia, P.O.; Swindell, W.R.; Lopez, D.; Teles, R.M.B.; Graeber, T.G.; Meller, S.; Homey, B.; Elder, J.T.; Gilliet, M.; et al. Comparison of molecular signatures from multiple skin diseases identifies mechanisms of immunopathogenesis. J. Investig. Dermatol. 2015, 135, 151–159. [Google Scholar] [CrossRef] [Scilit]
- Hsiao, J.J.; Fisher, D.E. The roles of microphthalmia-associated transcription factor and pigmentation in melanoma. Arch. Biochem. Biophys. 2014, 563, 28–34. [Google Scholar] [CrossRef] [Scilit]
- Hayashi, T.; Mo, J.H.; Gong, X.; Rossetto, C.; Jang, A.; Beck, L.; Elliott, G.I.; Kufareva, I.; Abagyan, R.; Broide, D.H.; et al. 3-Hydroxyanthranilic acid inhibits PDK1 activation and suppresses experimental asthma by inducing T cell apoptosis. Proc. Natl. Acad. Sci. USA 2007, 104, 18619–18624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amann, V.C.; Ramelyte, E.; Thurneysen, S.; Pitocco, R.; Bentele-Jaberg, N.; Goldinger, S.M.; Dummer, R.; Mangana, J. Developments in targeted therapy in melanoma. Eur. J. Surg. Oncol. 2017, 43, 581–593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nassar, K.W.; Tan, A.C. The mutational landscape of mucosal melanoma. Semin. Cancer Biol. 2020, 61, 139–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Traube, F.R.; Carell, T. The chemistries and consequences of DNA and RNA methylation and demethylation. RNA Biol. 2017, 14, 1099–1107. [Google Scholar] [CrossRef] [Scilit]
- Christman, J.K. 5-Azacytidine and 5-aza-2’-deoxycytidine as inhibitors of DNA methylation: Mechanistic studies and their implications for cancer therapy. Oncogene 2002, 55, 5483–5495. [Google Scholar] [CrossRef] [Scilit]
- Guastella, A.R.; Michelhaugh, S.K.; Klinger, N.V.; Kupsky, W.J.; Polin, L.A.; Muzik, O.; Juhasz, C.; Mittal, S. Tryptophan PET Imaging of the Kynurenine Pathway in Patient-Derived Xenograft Models of Glioblastoma. Mol. Imaging 2016, 15, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Yi, R.; Poy, M.N.; Stoffel, M.; Fuchs, E. A skin microRNA promotes differentiation by repressing ‘stemness’. Nature 2008, 452, 225–229. [Google Scholar] [CrossRef] [Scilit]
- Elsholz, F.; Harteneck, C.; Muller, W.; Friedland, K. Calcium—A central regulator of keratinocyte differentiation in health and disease. Eur. J. Dermatol. 2014, 24, 650–661. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, J.C.; Oton-Leite, A.F.; Guidi, R.; Mendonca, E.F. Granular cell tumor mimicking a squamous cell carcinoma of the tongue: A case report. BMC Res. Notes 2017, 10, 14. [Google Scholar] [CrossRef] [Scilit]
- Garcia-Diaz, A.; Shin, D.S.; Moreno, B.H.; Saco, J.; Escuin-Ordinas, H.; Rodriguez, G.A.; Zaretsky, J.M.; Sun, L.; Hugo, W.; Wang, X.; et al. Interferon Receptor Signaling Pathways Regulating PD-L1 and PD-L2 Expression. Cell Rep. 2017, 19, 1189–1201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hermankova, B.; Zajicova, A.; Javorkova, E.; Chudickova, M.; Trosan, P.; Hajkova, M.; Krulova, M.; Holan, V. Suppression of IL-10 production by activated B cells via a cell contact-dependent cyclooxygenase-2 pathway upregulated in IFN-gamma-treated mesenchymal stem cells. Immunobiology 2016, 221, 129–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, J.Y.; Im, K.-I.; Lee, E.-S.; Kim, N.; Nam, Y.-S.; Jeon, Y.-W.; Cho, S.-G. Enhanced immunoregulation of mesenchymal stem cells by IL-10-producing type 1 regulatory T cells in collagen-induced arthritis. Sci. Rep. 2016, 6, 26851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.-F.; Wang, H.-S.; Wang, H.; Zhang, F.; Wang, K.-F.; Guo, Q.; Zhang, G.; Cai, S.-H.; Du, J. The role of indoleamine 2,3-dioxygenase (IDO) in immune tolerance: Focus on macrophage polarization of THP-1 cells. Cell Immunol. 2014, 289, 42–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.; Nan, H.; Ma, J.; Jiang, L.; Guo, Q.; Han, L.; Zhang, Y.; Nan, K.; Guo, H. High Skp2/Low p57(Kip2) Expression is Associated with Poor Prognosis in Human Breast Carcinoma. Breast Cancer 2015, 9, 13–21. [Google Scholar] [PubMed]
- Koledova, Z. 3D Cell Culture: An Introduction. Methods Mol. Biol. 2017, 1612, 1–11. [Google Scholar] [PubMed]
- Xie, S.H.; Chen, Z.Q.; Ma, P.C. Down-regulation of melanin synthesis and transfer by paeonol and its mechanisms. Am. J. Chin. Med. 2007, 35, 139–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Detect Genes | Primer Sequence (5′–3′) |
|---|---|
| human GAPDH | forward 5′–TGTTGCCATCAATGACCCCTT–3′ reverse 5′–CTCCACGACGTACTCAGCG–3′ |
| human KYNU | forward 5′–GTCACAACTACAACTTCACGGA–3′ reverse 5′–CCCCACTGAACAGGATCACTG–3′ |
| human E-cadherin | forward 5′–AAAGGCCCATTTCCTAAAAACCT–3′ reverse 5′–TGCGTTCTCTCTATCCAGAGGCT–3′ |
| human AKT1 | forward 5′–CCAGCCTGGGTCAAAGAAGT–3′ reverse 5′–GTCCTCGGAGAACACACGTT–3′ |
| human ERK1/2 | forward 5′–CAGTTCTTGACCCCTGGTCC–3′ reverse 5′–AATGGGTGACACACACAGGG–3′ |
| human CDK1 | forward 5′–AAACTACAGGTCAAGTGGTAGCC–3′ reverse 5′–TCCTGCATAAGCACATCCTGA–3′ |
| human CDK2 | forward 5′–CCAGGAGTTACTTCTATGCCTGA–3′ reverse 5′–TTCATCCAGGGGAGGTACAAC–3′ |
| human CDK4 | forward 5′–ATGGCTACCTCTCGATATGAGC–3′ reverse 5′–CATTGGGGACTCTCACACTCT–3′ |
| human P21 | forward 5′–TGTCCGTCAGAACCCATGC–3′ reverse 5′–AAAGTCGAAGTTCCATCGCTC–3′ |
| human P27 | forward 5′–AACGTGCGAGTGTCTAACGG–3′ reverse 5′–CCCTCTAGGGGTTTGTGATTCT–3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.; Liu, M.; Huang, Y.; Wang, Z.; Wang, Y.; He, K.; Bai, R.; Ying, T.; Zheng, Y. Differential Gene Expression and Methylation Analysis of Melanoma in TCGA Database to Further Study the Expression Pattern of KYNU in Melanoma. J. Pers. Med. 2022, 12, 1209. https://doi.org/10.3390/jpm12081209
Wang M, Liu M, Huang Y, Wang Z, Wang Y, He K, Bai R, Ying T, Zheng Y. Differential Gene Expression and Methylation Analysis of Melanoma in TCGA Database to Further Study the Expression Pattern of KYNU in Melanoma. Journal of Personalized Medicine. 2022; 12(8):1209. https://doi.org/10.3390/jpm12081209
Chicago/Turabian StyleWang, Min, Meng Liu, Yingjian Huang, Ziyang Wang, Yuqian Wang, Ke He, Ruimin Bai, Tingyi Ying, and Yan Zheng. 2022. "Differential Gene Expression and Methylation Analysis of Melanoma in TCGA Database to Further Study the Expression Pattern of KYNU in Melanoma" Journal of Personalized Medicine 12, no. 8: 1209. https://doi.org/10.3390/jpm12081209
APA StyleWang, M., Liu, M., Huang, Y., Wang, Z., Wang, Y., He, K., Bai, R., Ying, T., & Zheng, Y. (2022). Differential Gene Expression and Methylation Analysis of Melanoma in TCGA Database to Further Study the Expression Pattern of KYNU in Melanoma. Journal of Personalized Medicine, 12(8), 1209. https://doi.org/10.3390/jpm12081209

