Genetic Addiction Risk Severity Assessment Identifies Polymorphic Reward Genes as Antecedents to Reward Deficiency Syndrome (RDS) Hypodopaminergia’s Effect on Addictive and Non-Addictive Behaviors in a Nuclear Family
Abstract
:1. Introduction
GENE | Risk Allele | Positive Phenotypes | Studies | Case (N) Control (N) | Meta-Analysis | Sig (p) | Ref |
---|---|---|---|---|---|---|---|
DRD1 | Rs4532 and specific haplotype rs686*T-rs4532*G within the DRD1 gene | AUD, aggression, and impulsivity | 3 | Case (569) Control (218) | NONE | <0.01–0.001 | [27] |
DRD2 | Rs1800497 | Severe alcoholism, long-term drinking, AD, parental rule-setting, comparison severe vs. less severe alcoholics, relapse and ASI after 12 years in 12-step programs, family linkage, heavy drinking, early onset, stress, harm avoidance and antisocial behavior related to AUD, severe medical consequences, mortality hospitalization, COAs, parental history of alcoholism, and drinking in the general population, | 62 | Case (17,382) Control (17,036) | 4 | <0.04–0.009 | [29] |
DRD3 | DRD3 Ser9Gly polymorphism (rs6280) | AD, anhedonia, MDD, and obsessive compulsive drinking | 3 | Case (545) Control (156) | NONE | <0.001–0.008 | [27] |
DRD4 | Rs180095 48bP repeat VNTR | Risk factor for alcoholism, AD smoking behavior, polysubstance abuse, higher rates of novelty seeking, higher lifetime alcoholism, generalized addiction, increased influence of peer pressure to drink, problematic alcohol use, increase the risk for severity of alcoholism, blunted response to alcohol cues, increase in alcohol craving, increased risk for social bonding with fellow alcoholics. | 48 | Case (11,740) Control (9365) | 2 | <0.06–0.005 | [17] |
DAT1 | 9R allele compared to 10R | Alcoholism, alcohol consumption, AWS, DTs, number of drinking days, vulnerability to alcoholism, and families with alcoholism compared to families without alcoholism | 24 | Case (4644) Control (3761) | 2 | <0.05–0.009 | [6] |
COMT | Rs4680 COMT Val158Met | AD, alcohol intake past year, generalized SUD, alcohol and tobacco consumption, drug abuse, in alcoholics reduced dopamine receptor sensitivity | 75 | Case (10,018) Control (8861) | 1 | <0.01–0.001 | [8] |
OPRM1 | OPRMI (rs1799971) | AD, severity of AWS, sensitivity to dopamine receptors, alcohol consumption, depression, response to alcohol cues and relapse risk, alcohol sensitivity in adolescents, drinking frequency, vulnerability for alcohol to hijack the reward system, alcohol craving, alcohol-related hospital readmission, more readmissions, and fewer days until the first readmission | 15 | Case (6428) Control (5196) | 1 | <0.047–0.006 | [12] |
GABRB3 | Receptor beta3 subunit (GABRB3) 181 variant | The risk for alcoholism, the onset of drug abuse in COAS, parental transmission and alcoholism, hypodopaminergia, Mood-related alcohol expectancy, drinking refusal self-efficacy, depression, and prevalence in COAS | 6 | Case (196) Control (0) | NONE | <0.05–0.007 | [6] |
MAOA | 30 BP VNTR-3.5R, 4R DN repeat polymorphisms | AD, impulsivity, antisocial personality, susceptibility to alcoholism, smoking behavior, poor psychosocial environment, and lower age of onset of alcoholism. | 5 | Case (731) Control (1111) | NONE | <0.043–0 | [5] |
SLC6A4 (5HTTLPR) | promoter region (5HTTLPR) (rs25531) | AD, anxiety, age of onset, cue craving, lower socialization, depression, and poly drug abuse | 27 | Case (13,328) Control (2982) | 2 | <0.03–0.001 | [9] |
TOTAL | NA | NA | 268 | Case (65,581) Control (48,686) | 10 | <0.06–0.009 | NA |
2. Materials and Methods
Sample Collection and Processing Utilized to Obtain Data
3. Results
3.1. Mother (135530)
Gene | Identifiers | Risk Allele | Patient Results Risk | Risk Allele Count |
---|---|---|---|---|
DRD1 | rs4532 | A | A/A | 2 |
DRD2 | rs1800497 | A | A/G | 1 |
DRD3 | rs6280 | C | C/T | 1 |
DRD4 | rs1800955 | C | C/T | 1 |
OPRM1 | rs1799971 | G | A/G | 1 |
COMT | rs4680 | G | A/A | 0 |
DAT1 | rs28363170 | <9 Repeats | 10/10R | 0 |
5HTTLPR | rs4795541 | S, LG | S/S | 2 |
MAOA | rs768062321 | 3.5 R, 4R | 4R/4R | 2 |
GABRB3 | rs764926719 | 181 | 185/185 | 0 |
DRD4 | rs761010487 | ≥7 Repeats | 2R/4R | 0 |
3.2. Father (135511)
Gene | Identifiers | Risk Allele | Patient Results Risk | Risk Allele Count |
---|---|---|---|---|
DRD1 | rs4532 | A | A/A | 2 |
DRD2 | rs1800497 | A | G/G | 0 |
DRD3 | rs6280 | C | C/T | 1 |
DRD4 | rs1800955 | C | C/T | 1 |
OPRM1 | rs1799971 | G | A/A | 0 |
COMT | rs4680 | G | A/A | 0 |
DAT1 | rs28363170 | <9 Repeats | 10/10R | 0 |
5HTTLPR | rs4795541 | S, LG | S/LA | 1 |
MAOA | rs768062321 | 3.5 R, 4R | 3R | 0 |
GABRB3 | rs764926719 | 181 | 181/181 | 2 |
DRD4 | rs761010487 | ≥7 Repeats | 7R/7R | 2 |
3.3. Son (184700)
Gene | Identifiers | Risk Allele | Patient Results Risk | Risk Allele Count |
---|---|---|---|---|
DRD1 | rs4532 | A | A/A | 2 |
DRD2 | rs1800497 | A | A/G | 1 |
DRD3 | rs6280 | C | C/T | 1 |
DRD4 | rs1800955 | C | C/T | 1 |
OPRM1 | rs1799971 | G | A/G | 1 |
COMT | rs4680 | G | A/A | 0 |
DAT1 | rs28363170 | <9 Repeats | 10/10R | 0 |
5HTTLPR | rs4795541 | S, LG | S/S | 2 |
MAOA | rs768062321 | 3.5R, 4R | 3R/4R | 1 |
GABRB3 | rs764926719 | 181 | 181/185 | 1 |
DRD4 | rs761010487 | ≥7 Repeats | 4R/7R | 1 |
3.4. Daughter (142430)
Gene | Identifiers | Risk Allele | Patient Results Risk | Risk Allele Count |
---|---|---|---|---|
DRD1 | rs4532 | A | A/A | 2 |
DRD2 | rs1800497 | A | A/G | 1 |
DRD3 | rs6280 | C | C/T | 1 |
DRD4 | rs1800955 | C | C/T | 1 |
OPRM1 | rs1799971 | G | A/G | 1 |
COMT | rs4680 | G | A/A | 0 |
DAT1 | rs28363170 | <9 Repeats | 10/10R | 0 |
5HTTLPR | rs4795541 | S, LG | S/S | 2 |
MAOA | rs768062321 | 3.5R, 4R | 3R/4R | 1 |
GABRB3 | rs764926719 | 181 | 181/185 | 1 |
DRD4 | rs761010487 | ≥7 Repeats | 4R/7R | 1 |
4. Discussion
5. Limitations
6. Summary
7. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blum, K.; Sheridan, P.J.; Wood, R.C.; Braverman, E.R.; Chen, T.J.H.; Cull, J.G.; E Comings, D. The D2 Dopamine Receptor Gene as a Determinant of Reward Deficiency Syndrome. J. R. Soc. Med. 1996, 89, 396–400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Casey, B.J.; Craddock, N.; Cuthbert, B.N.; Hyman, S.E.; Lee, F.S.; Ressler, K.J. DSM-5 and RDoC: Progress in psychiatry research? Nat. Rev. Neurosci. 2013, 14, 810–814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blum, K.; Bowirrat, A.; Lewis, M.C.; Simpatico, T.A.; Ceccanti, M.; Steinberg, B.; Modestino, E.J.; Thanos, P.K.; Baron, D.; McLaughlin, T.; et al. Exploration of Epigenetic State Hyperdopaminergia (Surfeit) and Genetic Trait Hypodopaminergia (Deficit) during Adolescent Brain Development. Curr. Psychopharmacol. 2021, 10, 181–196. [Google Scholar] [CrossRef]
- Blum, K.; Han, D.; Gupta, A.; Baron, D.; Braverman, E.R.; Dennen, C.A.; Kazmi, S.; Llanos-Gomez, L.; Badgaiyan, R.D.; Elman, I.; et al. Statistical Validation of Risk Alleles in Genetic Addiction Risk Severity (GARS) Test: Early Identification of Risk for Alcohol Use Disorder (AUD) in 74,566 Case–Control Subjects. J. Pers. Med. 2022, 12, 1385. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.J.; Blum, K.; Mathews, D.; Fisher, L.; Schnautz, N.; Braverman, E.R.; Schoolfield, J.; Downs, B.W.; Comings, D.E. Are dopaminergic genes involved in a predisposition to pathological aggression?: Hypothesizing the importance of “super normal controls” in psychiatricgenetic research of complex behavioral disorders. Med. Hypotheses 2005, 65, 703–707. [Google Scholar] [CrossRef]
- Blum, K.; Febo, M.; DBadgaiyan, R.; Demetrovics, Z.; Simpatico, T.; Fahlke, C.; Li, M.; Dushaj, K.; SGold, M. Common Neurogenetic Diagnosis and Meso-Limbic Manipulation of Hypodopaminergic Function in Reward Deficiency Syndrome (RDS): Changing the Re-covery Landscape. Curr. Neuropharmacol. 2017, 15, 184–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pitchers, K.K.; Coppens, C.M.; Beloate, L.N.; Fuller, J.; Van, S.; Frohmader, K.S.; LaViolette, S.R.; Lehman, M.N.; Coolen, L.M. Endogenous Opioid-Induced Neuroplasticity of Dopaminergic Neurons in the Ventral Tegmental Area Influences Natural and Opiate Reward. J. Neurosci. 2014, 34, 8825–8836. [Google Scholar] [CrossRef] [Green Version]
- Archer, T.; Oscar-Berman, M.; Blum, K.; Gold, M. Epigenetic Modulation of Mood Disorders. J. Genet. Syndr. Gene Ther. 2013, 4, 1000120. [Google Scholar]
- Borsook, D.; Linnman, C.; Faria, V.; Strassman, A.; Becerra, L.; Elman, I. Reward deficiency and anti-reward in pain chronification. Neurosci. Biobehav. Rev. 2016, 68, 282–297. [Google Scholar] [CrossRef]
- Blum, K.; Noble, E.P.; Sheridan, P.J.; Montgomery, A.; Ritchie, T.; Jagadeeswaran, P.; Nogami, H.; Briggs, A.H.; Cohn, J.B. Allelic association of human do-pamine D2 receptor gene in alcoholism. JAMA 1990, 263, 2055–2060. [Google Scholar] [CrossRef]
- Comings, D.E.; Blum, K. Reward deficiency syndrome: Genetic aspects of behavioral disorders. Prog. Brain Res. 2000, 126, 325–341. [Google Scholar] [CrossRef] [PubMed]
- Gatt, J.M.; Burton, K.L.; Williams, L.M.; Schofield, P.R. Specific and common genes implicated across major mental disorders: A review of meta-analysis studies. J. Psychiatr. Res. 2015, 60, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Gyollai, Á.; DGriffiths, M.; Barta, C.; Vereczkei, A.; Urbán, R.; Kun, B.; Kokonyei, G.; Székely, A.; Sasvári-Székely, M.; Blum, K.; et al. The genetics of problem and pathologi-cal gambling: A systematic review. Curr. Pharm. Des. 2014, 20, 3993–3999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blum, K.; Chen, T.J.; Chen, A.L.; Rhoades, P.; Prihoda, T.J.; Downs, B.W.; Bagchi, D.; Bagchi, M.; Blum, S.H.; Williams, L.; et al. Dopamine D2 Receptor Taq A1 allele predicts treatment compliance of LG839 in a subset analysis of a pilot study in The Netherlands. Gene Ther. Mol. Biol. 2008, 12, 129–140. [Google Scholar]
- Nestler, E.J.; Carlezon, W.A., Jr. Role of the Brain’s Reward Circuitry in Depression: Transcriptional Mechanisms. Biol. Psychiatry 2006, 59, 1151–1159. [Google Scholar] [CrossRef] [PubMed]
- Blum, K.; Gold, M.S.; Febo, M.; Baron, D.; Modestino, E.J.; Elman, I.; Badgaiyan, R.D. Molecular role of dopamine in anhedonia linked to reward deficiency syndrome RDS and anti- reward systems. Front. Biosci. 2018, 10, 309–325. [Google Scholar] [CrossRef] [Green Version]
- Browne, C.J.; Godino, A.; Salery, M.; Nestler, E.J. Epigenetic Mechanisms of Opioid Addiction. Biol. Psychiatry 2020, 87, 22–33. [Google Scholar] [CrossRef] [Green Version]
- Cadet, J.L.; Jayanthi, S. Epigenetics of addiction. Neurochem. Int. 2021, 147, 105069. [Google Scholar] [CrossRef]
- Yan, Z.; Rein, B. Mechanisms of synaptic transmission dysregulation in the prefrontal cortex: Pathophysiological implications. Mol. Psychiatry 2022, 27, 445–465. [Google Scholar] [CrossRef]
- Brocato, E.; Wolstenholme, J.T. Neuroepigenetic consequences of adolescent ethanol exposure. Int. Rev. Neurobiol. 2021, 160, 45–84. [Google Scholar] [CrossRef]
- Blum, K.; Brodie, M.S.; Pandey, S.C.; Cadet, J.L.; Gupta, A.; Elman, I.; Thanos, P.K.; Gondre-Lewis, M.C.; Baron, D.; Kazmi, S.; et al. Researching Mitigation of Alcohol Binge Drinking in Polydrug Abuse: KCNK13 and RASGRF2 Gene(s) Risk Polymorphisms Coupled with Genetic Addiction Risk Severity (GARS) Guiding Precision Pro-Dopamine Regulation. J. Pers. Med. 2022, 12, 1009. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Lee, D.; Do, K.; Kim, J. Interaction Effects of DRD2 Genetic Polymorphism and Interpersonal Stress on Problematic Gaming in College Students. Genes 2022, 13, 449. [Google Scholar] [CrossRef] [PubMed]
- Blum, K.; Braverman, E.R.; Wu, S.; Cull, J.G.; Chen, T.J.H.; Gill, J.; Wood, R.; Eisenberg, A.; Sherman, M.; Davis, K.R.; et al. Association of polymorphisms of dopamine D2 receptor (DRD2), and dopamine transporter (DAT1) genes with schizoid/avoidant behaviors (SAB). Mol. Psychiatry 1997, 2, 239–246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noble, E.P. Allelic Association of the D2 Dopamine Receptor Gene with Receptor-Binding Characteristics in Alcoholism or Gene ism. Arch. Gen. Psychiatry 1991, 48, 648–654. [Google Scholar] [CrossRef]
- Hillemacher, T.; Frieling, H.; Buchholz, V.; Hussein, R.; Bleich, S.; Meyer, C.; John, U.; Bischof, A.; Rumpf, H.-J. Alterations in DNA-methylation of the dopamine-receptor 2 gene are associated with abstinence and health care utilization in individuals with a lifetime history of pathologic gambling. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2015, 63, 30–34. [Google Scholar] [CrossRef] [PubMed]
- McLaughlin, T.; Blum, K.; Steinberg, B.; Modestino, E.J.; Fried, L.; Baron, D.; Siwicki, D.; Braverman, E.R.; Badgaiyan, R.D. Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUD and ADHD. J. Behav. Addict. 2018, 7, 192–203. [Google Scholar] [CrossRef]
- Blum, K.; Baron, D.; Lott, L.; Ponce, J.V.; Siwicki, D.; Boyett, B.; Steinberg, B.; Modestino, E.J.; Fried, L.; Hauser, M.; et al. In Search of Reward Deficiency Syndrome (RDS)-Free Controls: The “Holy Grail” in Genetic Addiction Risk Testing. Curr. Psychopharmacol. 2020, 9, 7–21. [Google Scholar] [CrossRef]
- Fried, L.; Modestino, E.J.; Siwicki, D.; Lott, L.; Thanos, P.K.; Baron, D.; Badgaiyan, R.D.; Ponce, J.V.; Giordano, J.; Downs, W.B.; et al. Hypodopaminergia and “Precision Behavioral Management” (PBM): It is a Generational Family Affair. Curr. Pharm. Biotechnol. 2020, 21, 528–541. [Google Scholar] [CrossRef]
- Blum, K.; Bowirrat, A.; Baron, D.; Lott, L.; Ponce, J.V.; Brewer, R.; Siwicki, D.; Boyett, B.; Gondre-Lewis, M.C.; Smith, D.E.; et al. Biotechnical development of genetic addiction risk score (GARS) and selective evidence for inclusion of polymorphic allelic risk in substance use disorder (SUD). J. Syst. Integr. Neurosci. 2020, 6. [Google Scholar] [CrossRef]
- Blum, K.; Chen, A.L.C.; Oscar-Berman, M.; Chen, T.J.H.; Lubar, J.; White, N.; Lubar, J.; Bowirrat, A.; Braverman, E.; Schoolfield, J.; et al. Generational Association Studies of Dopaminergic Genes in Reward Deficiency Syndrome (RDS) Subjects: Selecting Appropriate Phenotypes for Reward Dependence Behaviors. Int. J. Environ. Res. Public Health 2011, 8, 4425–4459. [Google Scholar] [CrossRef] [Green Version]
- Blum, K. Criterion Validity of the Genetic Addiction Risk Severity (GARS) as a Marker of Reward Deficiency in Chemical Substances’ Addiction: A Multi-Center Study. In Proceedings of the Annual Society Brain Mapping Meeting, Los Angeles, CA, USA, 10–13 March 2022. [Google Scholar]
- Blum, K.; Modestino, E.J.; Gondre-Lewis, M.; Chapman, E.J.; Neary, J.; Siwicki, D.; Baron, D.; Hauser, M.; Smith, D.E.; Roy, A.K.; et al. The Benefits of Genetic Addiction Risk Score (GARS™) Testing in Substance Use Disorder (SUD). Int. J. Genom. Data Min. 2018, 2018, 115. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, T.; Noble, E.P. [3H] Naloxone binding in the human brain: Alcoholism and theTaqI A D2 dopamine receptor polymorphism. Brain Res. 1996, 718, 193–197. [Google Scholar] [CrossRef]
- SAMHSA. Facing Addiction in America: The Surgeon Genera’s Report on Alcohol, Drugs, and Health. 2016. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28252892 (accessed on 30 August 2022).
- McLellan, A.T.; Koob, G.F.; Volkow, N.D. Preaddiction—A Missing Concept for Treating Substance Use Disorders. JAMA Psychiatry 2022, 79, 749. [Google Scholar] [CrossRef] [PubMed]
- Knowler, W.C.; Fowler, S.E.; Hamman, R.F.; Christophi, C.A.; Hoffman, H.J.; Brenneman, A.T.; Brown-Friday, J.O.; Goldberg, R.; Venditti, E.; Nathan, D.M. 10-year follow-up of diabetes incidence and weight loss in the Diabetes Prevention Program Outcomes Study. Lancet 2009, 374, 1677–1686. [Google Scholar]
- Glechner, A.; Keuchel, L.; Affengruber, L.; Titscher, V.; Sommer, I.; Matyas, N.; Wagner, G.; Kien, C.; Klerings, I.; Gartlehner, G. Effects of lifestyle changes on adults with pre-diabetes: A systematic review and meta-analysis. Prim. Care Diabetes 2018, 12, 393–408. [Google Scholar] [CrossRef]
- Kótyuk, E.; Urbán, R.; Hende, B.; Richman, M.; Magi, A.; Király, O.; Barta, C.; Griffiths, M.D.; Potenza, M.N.; Badgaiyan, R.D.; et al. Development and validation of the Reward Deficiency Syndrome Questionnaire (RDSQ-29). J. Psychopharmacol. 2022, 36, 409–422. [Google Scholar] [CrossRef]
- Miller, N.S.; Belkin, B.M.; Gold, M.S. Alcohol and drug dependence among the elderly: Epidemiology, diagnosis, and treatment. Compr. Psychiatry 1991, 32, 153–165. [Google Scholar] [CrossRef]
- Oesterle, T.S.; Thusius, N.J.; Rummans, T.A.; Gold, M.S. Medication-Assisted Treatment for Opioid-Use Disorder. Mayo Clin. Proc. 2019, 94, 2072–2086. [Google Scholar] [CrossRef] [Green Version]
- Dackis, C.A.; Gold, M.S. Pharmacological approaches to cocaine addiction. J. Subst. Abus. Treat. 1985, 2, 139–145. [Google Scholar] [CrossRef]
- Miller, N.S.; Gold, M.S. Benzodiazepines: Reconsidered. Adv. Alcohol Subst. Abus. 1990, 8, 67–84. [Google Scholar] [CrossRef]
- Blum, K.; Gold, M.; Modestino, E.J.; Baron, D.; Boyett, B.; Siwicki, D.; Lott, L.; Podesta, A.; Roy, A.K.; Hauser, M.; et al. Would induction of dopamine homeostasis via coupling genetic addiction risk score (GARS®) and pro-dopamine regulation benefit benzodiazepine use disorder (BUD)? J. Syst. Integr. Neurosci. 2018, 4. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, J.T.; Sellers, E.M. Treatment of the barbiturate abstinence syndrome. Med. J. Aust. 1986, 145, 456–458. [Google Scholar] [CrossRef] [PubMed]
- Dennen, C.A.; Blum, K.; Bowirrat, A.; Khalsa, J.; Thanos, P.K.; Baron, D.; Badgaiyan, R.D.; Gupta, A.; Braverman, E.R.; Gold, M.S. Neurogenetic and Epigenetic Aspects of Cannabinoids. Epigenomes 2022, 6, 27. [Google Scholar] [CrossRef]
- Blum, K.; Green, R.; Smith, J.; Llanos-Gomez, L.; Baron, D.; Badgaiyan, R.D. Hypothesizing High Negative Emotionality as a Function of Genetic Addiction Risk Severity (GARS) Testing in Alcohol Use Disorder (AUD). J. Syst. Integr. Neurosci. 2020, 7. [Google Scholar] [CrossRef] [PubMed]
- Border, R.; Johnson, E.C.; Evans, L.M.; Smolen, A.; Berley, N.; Sullivan, P.F.; Keller, M.C. No Support for Historical Candidate Gene or Candidate Gene-by-Interaction Hypotheses for Major Depression Across Multiple Large Samples. Am. J. Psychiatry 2019, 176, 376–387. [Google Scholar] [CrossRef] [PubMed]
- Duncan, L.E.; Keller, M.C. A Critical Review of the First 10 Years of Candidate Gene-by-Environment Interaction Research in Psychiatry. Am. J. Psychiatry 2011, 168, 1041–1049. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hatoum, A.S.; Wendt, F.R.; Galimberti, M.; Polimanti, R.; Neale, B.; Kranzler, H.R.; Gelernter, J.; Edenberg, H.J.; Agrawal, A. Ancestry may confound genetic machine learning: Candidate-gene prediction of opioid use disorder as an example. Drug Alcohol Depend. 2021, 229, 109115. [Google Scholar] [CrossRef] [PubMed]
- Johnson, E.C.; Border, R.; Melroy-Greif, W.E.; de Leeuw, C.; Ehringer, M.A.; Keller, M.C. No Evidence That Schizophrenia Candidate Genes Are More Associated with Schizophrenia Than Noncandidate Genes. Biol. Psychiatry 2017, 82, 702–708. [Google Scholar] [CrossRef]
- Zhou, H.; Sealock, J.M.; Sanchez-Roige, S.; Clarke, T.-K.; Levey, D.F.; Cheng, Z.; Li, B.; Polimanti, R.; Kember, R.L.; Smith, R.V.; et al. Genome-wide meta-analysis of problematic alcohol use in 435,563 individuals yields insights into biology and relationships with other traits. Nat. Neurosci. 2020, 23, 809–818. [Google Scholar] [CrossRef]
- Liu, M.; Jiang, Y.; Wedow, R.; Li, Y.; Brazel, D.M.; Chen, F.; Datta, G.; Davila-Velderrain, J.; McGuire, D.; Tian, C.; et al. Association studies of up to 1.2 million individuals yield new insights into the genetic etiology of tobacco and alcohol use. Nat. Genet. 2019, 51, 237–244. [Google Scholar] [CrossRef]
- Blum, K.; McLaughlin, T.; Bowirrat, A.; Modestino, E.J.; Baron, D.; Gomez, L.L.; Ceccanti, M.; Braverman, E.R.; Thanos, P.K.; Cadet, J.L.; et al. Reward Deficiency Syndrome (RDS) Surprisingly Is Evolutionary and Found Everywhere: Is It “Blowin’ in the Wind”? J. Pers. Med. 2022, 12, 321. [Google Scholar] [CrossRef] [PubMed]
- Blum, K. Reward Deficiency Syndrome. In The SAGE Encyclopedia of Abnormal and Clinical Psychology Seven Volume Set; Wenzel, A., Ed.; Sage Publishing: New York, NY, USA, 2017. [Google Scholar]
- Elman, I.; Lowen, S.; Frederick, B.B.; Chi, W.; Becerra, L.; Pitman, R.K. Functional Neuroimaging of Reward Circuitry Responsivity to Monetary Gains and Losses in Posttraumatic Stress Disorder. Biol. Psychiatry 2009, 66, 1083–1090. [Google Scholar] [CrossRef] [PubMed]
- Gold, M.S.; Blum, K.; Berman, M.O.; Braverman, E.R. Low Dopamine Function in Attention Deficit/Hyperactivity Disorder: Should Genotyping Signify Early Diagnosis in Children? Postgrad. Med. 2014, 126, 153–177. [Google Scholar] [CrossRef] [PubMed]
- Leszczyńska-Rodziewicz, A.; Hauser, J.; Dmitrzak-Węglarz, M.; Skibińska, M.; Czerski, P.; Zakrzewska, M.; Kosmowska, M.; Rybakowski, J. Lack of association between polymorphisms of dopamine receptors, type D2, and bipolar affective illness in a Polish popu-lation. Med. Sci. Monit. 2005, 11, CR289–CR295. [Google Scholar]
- Noble, E.P. D2 dopamine receptor gene in psychiatric and neurologic disorders and its phenotypes. Am. J. Med. Gen. 2013, 81, 257–267. [Google Scholar] [CrossRef]
- Pearson-Fuhrhop, K.M.; Dunn, E.; Mortero, S.; Devan, W.J.; Falcone, G.J.; Lee, P.; Holmes, A.; Hollinshead, M.O.; Roffman, J.; Smoller, J.W.; et al. Dopamine Genetic Risk Score Predicts Depressive Symptoms in Healthy Adults and Adults with Depression. PLoS ONE 2014, 9, e93772. [Google Scholar] [CrossRef] [Green Version]
- Tsang, R.S.; Mather, K.A.; Sachdev, P.S.; Reppermund, S. Systematic review and meta-analysis of genetic studies of late-life depression. Neurosci. Biobehav. Rev. 2017, 75, 129–139. [Google Scholar] [CrossRef]
- Stice, E.; Yokum, S.; Burger, K.; Epstein, L.; Smolen, A.; Burger, K.; Epstein, H. Multilocus Genetic Composite Reflecting Dopamine Signaling Capacity Predicts Reward Circuitry Responsivity. J. Neurosci. 2012, 32, 10093–10100. [Google Scholar] [CrossRef] [Green Version]
- Walters, C.L.; Kuo, Y.-C.; Blendy, J.A. Differential distribution of CREB in the mesolimbic dopamine reward pathway. J. Neurochem. 2003, 87, 1237–1244. [Google Scholar] [CrossRef]
- Blum, K.; Oscar-Berman, M.; Demetrovics, Z.; Barh, D.; Gold, M.S. Genetic Addiction Risk Score (GARS): Molecular Neurogenetic Evidence for Predisposition to Reward Deficiency Syndrome (RDS). Mol. Neurobiol. 2014, 50, 765–796. [Google Scholar] [CrossRef]
Gene | Polymorphism | Variant Alleles | Risk Allele |
---|---|---|---|
DRD1 | rs4532 | A/G | A |
DRD2 | rs1800497 | A/G (A1/A2) | A (A1) |
DRD3 | rs6280 | C/T | C |
DRD4 | rs1800955 | C/T | C |
COMT | rs4680 | A/G (Met/Val) | G (Val) |
OPRM1 | rs1799971 | A/G (Asn/Asp) | G (Asp) |
Gene | Polymorphism | Variant Alleles | Risk Allele |
---|---|---|---|
DRD4 | rs761010487 | 48bp repeat 2R-11R | ≥7R, long form |
DAT1 | rs28363170 | 40p repeat 3R-11R | <9R |
MAOA | rs768062321 | 30bp repeat 2R-5R | 3.5R, 4R, 5R |
Serotonin Transporter SLC6A4 (5-HTTLPR) | rs4795541, rs25531 | 43bp repeat, with SNP L/XL and S, G/A | S, LG |
Gene | Polymorphism | Variant Alleles | Risk Allele |
---|---|---|---|
GABA(A) Receptor, Alpha-3 GABRB3 | rs764926719 | CA dinucleotide repeat 171–201bp sized fragments | 181 |
Gene | Polymorphism | Location | Risk Allele(s) |
---|---|---|---|
DRD1 | rs4532 SNP | Chr 5 | A |
DRD2 | rs1800497 SNP | Chr 11 | A |
DRD3 | rs6280 SNP | Chr 3 | C |
DRD4 | rs1800955 SNP | Chr 11 | C |
48 bases Repeat VNTR | Chr 11, Exon 3 | 7R, 8R, 9R, 10R, 11R | |
COMT | rs4680 SNP | Chr 22 | G |
OPRM1 | rs1799971 SNP | Chr 6 | G |
DAT1 | 40 bases Repeat VNTR | Chr 5, Exon 15 | 3R, 4R, 5R, 6R, 7R, 8R |
MAOA | 30 bases Repeat VNTR | Chr X, Promoter | 3.5R, 4R |
SLC6A4 (5HTTLPR) | 43 bases Repeat INDEL/VNTR plus rs25531 SNP | Chr 17 | LG, S |
GABA(A) Receptor, Alpha-3 GABRB3 | CA-Repeat DNR | Chr15 (downstream) | 181 |
SNP | Global Heterozygous Prevalence |
---|---|
rs4532 | 32% |
rs1800497 | 46% |
rs6280 | 41% |
rs1800955 | Frequency of C allele = 0.42 Prevalence not available |
rs4680 | 42% |
rs1799971 | 29% |
Primer | Sequence (5′ to 3′) | 5′ Label | Reaction (nM) |
---|---|---|---|
AMELO-F AMELO-R | CCC TGG GCT CTG TAA AGA ATA GTG ATC AGA GCT TAA ACT GGG AAG CTG | NED - | 150 |
MAO-F MAO-R | ACA GCC TGA CCG TGG AGA AG GAA CGG ACG CTC CAT TCG GA | NED - | 120 |
DAT-F DAT-R | TGT GGT GTA GGG AAC GGC CTG AG CTT CCT GGA GGT CAC GGC TCA AGG | 6FAM - | 120 |
DRD4-F DRD4-R | GCT CAT GCT GCT GCT CTA CTG GGC CTG CGG GTC TGC GGT GGA GTC TGG | VIC - | 480 |
GABRA-F GABRA-R | CTC TTG TTC CTG TTG CTT TCA ATA CAC CAC TGT GCT AGT AGA TTC AGC TC | NED - | 120 |
HTTLPR-F HTTLPR-R | ATG CCA GCA CCT AAC CCC TAA TGT GAG GGA CTG AGC TGG ACA ACC AC | PET - | 120 |
Assay ID | Gene and SNP | Context Sequence |
---|---|---|
C 1011777_10 | DRD1 rs4532 | TCTGACTGACCCCTATTCCCTGCTT [G/A] GGAACTTGAGGGGTGTCAGAGCCCC |
C 7486676_10 | DRD2, ANKK1 rs1800497 | CACAGCCATCCTCAAAGTGCTGGTC [A/G] AGGCAGGCGCCCAGCTGGACGTCCA |
C 949770_10 | DRD3 rs6280 | GCCCCACAGGTGTAGTTCAGGTGGC [C/T] ACTCAGCTGGCTCAGAGATGCCATA |
C 7470700_30 | DRD4 rs1800955 | GGGCAGGGGGAGCGGGCGTGGAGGG [C/T] GCGCACGAGGTCGAGGCGAGTCCGC |
C 25746809_50 | COMT rs4680 | CCAGCGGATGGTGGATTTCGCTGGC [A/G] TGAAGGACAAGGTGTGCATGCCTGA |
C 8950074_1_ | OPRM1 rs1799971 | GGTCAACTTGTCCCACTTAGATGGC [A/G] ACCTGTCCGACCCATGCGGTCCGAA |
Proband | RDS Behavior (s) and Psychiatric Conditions |
---|---|
Mother | Gaming Memory Focus Addicted to TV shows Anxiety ADHD |
Father | Overeating ADHD |
Son | Substances-misuse Cannabis and Alcohol Sweets Depression Anxiety ADHD Amotivation Risk Taking |
Daughter | Internet-misuse Depression Anxiety |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dennen, C.A.; Blum, K.; Bowirrat, A.; Thanos, P.K.; Elman, I.; Ceccanti, M.; Badgaiyan, R.D.; McLaughlin, T.; Gupta, A.; Bajaj, A.; et al. Genetic Addiction Risk Severity Assessment Identifies Polymorphic Reward Genes as Antecedents to Reward Deficiency Syndrome (RDS) Hypodopaminergia’s Effect on Addictive and Non-Addictive Behaviors in a Nuclear Family. J. Pers. Med. 2022, 12, 1864. https://doi.org/10.3390/jpm12111864
Dennen CA, Blum K, Bowirrat A, Thanos PK, Elman I, Ceccanti M, Badgaiyan RD, McLaughlin T, Gupta A, Bajaj A, et al. Genetic Addiction Risk Severity Assessment Identifies Polymorphic Reward Genes as Antecedents to Reward Deficiency Syndrome (RDS) Hypodopaminergia’s Effect on Addictive and Non-Addictive Behaviors in a Nuclear Family. Journal of Personalized Medicine. 2022; 12(11):1864. https://doi.org/10.3390/jpm12111864
Chicago/Turabian StyleDennen, Catherine A., Kenneth Blum, Abdalla Bowirrat, Panayotis K. Thanos, Igor Elman, Mauro Ceccanti, Rajendra D. Badgaiyan, Thomas McLaughlin, Ashim Gupta, Anish Bajaj, and et al. 2022. "Genetic Addiction Risk Severity Assessment Identifies Polymorphic Reward Genes as Antecedents to Reward Deficiency Syndrome (RDS) Hypodopaminergia’s Effect on Addictive and Non-Addictive Behaviors in a Nuclear Family" Journal of Personalized Medicine 12, no. 11: 1864. https://doi.org/10.3390/jpm12111864
APA StyleDennen, C. A., Blum, K., Bowirrat, A., Thanos, P. K., Elman, I., Ceccanti, M., Badgaiyan, R. D., McLaughlin, T., Gupta, A., Bajaj, A., Baron, D., Downs, B. W., Bagchi, D., & Gold, M. S. (2022). Genetic Addiction Risk Severity Assessment Identifies Polymorphic Reward Genes as Antecedents to Reward Deficiency Syndrome (RDS) Hypodopaminergia’s Effect on Addictive and Non-Addictive Behaviors in a Nuclear Family. Journal of Personalized Medicine, 12(11), 1864. https://doi.org/10.3390/jpm12111864