Is Altered Surfactant Protein Gene Expression in Peripheral Blood Associated with COVID-19 Disease Severity?
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Expression Analysis
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Number of COVID-19 Deaths Reported to WHO. WHO COVID-19 Dashboard/WHO Data/Cumulative Total. Available online: https://data.who.int/dashboards/covid19/deaths? (accessed on 3 June 2025).
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, N.; Zhou, M.; Dong, X.; Qu, J.; Gong, F.; Han, Y.; Qiu, Y.; Wang, J.; Liu, Y.; Wei, Y.; et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: A descriptive study. Lancet 2020, 395, 507–513. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; McGoogan, J.M. Characteristics of and Important Lessons from the Coronavirus Disease 2019 (COVID-19) Outbreak in China: Summary of a Report of 72 314 Cases From the Chinese Center for Disease Control and Prevention. JAMA 2020, 323, 1239–1242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oran, D.P.; Topol, E.J. The Proportion of SARS-CoV-2 Infections That Are Asymptomatic: A Systematic Review. Ann. Intern. Med. 2021, 174, 655–662. [Google Scholar] [CrossRef] [Scilit]
- Centers for Disease Control and Prevention. COVID Data Tracker. Trends in United States COVID-19 Hospitalizations, Deaths, Emergency Department (ED) Visits, and Test Positivity by Geographic Area. Available online: https://covid.cdc.gov/covid-data-tracker/#datatracker-home (accessed on 4 March 2025).
- Xu, Z.; Shi, L.; Wang, Y.; Zhang, J.; Huang, L.; Zhang, C.; Liu, S.; Zhao, P.; Liu, H.; Zhu, L.; et al. Pathological findings of COVID-19 associated with acute respiratory distress syndrome. Lancet Respir. Med. 2020, 8, 420–422. [Google Scholar] [CrossRef] [Scilit]
- Arentz, M.; Yim, E.; Klaff, L.; Lokhandwala, S.; Riedo, F.X.; Chong, M.; Lee, M. Characteristics and Outcomes of 21 Critically Ill Patients With COVID-19 in Washington State. JAMA 2020, 323, 1612–1614. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Gao, Y.; Qiao, L.; Wang, W.; Chen, D. Inflammatory Response Cells During Acute Respiratory Distress Syndrome in Patients with Coronavirus Disease 2019 (COVID-19). Ann. Intern. Med. 2020, 173, 402–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.; Chen, X.; Cai, Y.; Xia, J.; Zhou, X.; Xu, S.; Huang, H.; Zhang, L.; Zhou, X.; Du, C.; et al. Risk Factors Associated with Acute Respiratory Distress Syndrome and Death in Patients With Coronavirus Disease 2019 Pneumonia in Wuhan, China. JAMA Intern. Med. 2020, 180, 934–943. [Google Scholar] [CrossRef] [Scilit]
- Chand, S.; Kapoor, S.; Orsi, D.; Fazzari, M.J.; Tanner, T.G.; Umeh, G.C.; Islam, M.; Dicpinigaitis, P.V. COVID-19-Associated Critical Illness-Report of the First 300 Patients Admitted to Intensive Care Units at a New York City Medical Center. J. Intensive Care Med. 2020, 35, 963–970. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Li, S.; Niu, S. ACE2 and COVID-19 and the resulting ARDS. Postgrad. Med. J. 2020, 96, 403–407. [Google Scholar] [CrossRef] [Scilit]
- Zhou, P.; Yang, X.L.; Wang, X.G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.R.; Zhu, Y.; Li, B.; Huang, C.L.; et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [Scilit]
- Glasser, J.R.; Mallampalli, R.K. Surfactant and its role in the pathobiology of pulmonary infection. Microbes Infect. 2012, 14, 17–25. [Google Scholar] [CrossRef] [Scilit]
- Spragg, R.G.; Lewis, J.F.; Wurst, W.; Häfner, D.; Baughman, R.P.; Wewers, M.D.; Marsh, J.J. Treatment of acute respiratory distress syndrome with recombinant surfactant protein C surfactant. Am. J. Respir. Crit. Care Med. 2003, 167, 1562–1566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katsura, H.; Sontake, V.; Tata, A.; Kobayashi, Y.; Edwards, C.E.; Heaton, B.E.; Konkimalla, A.; Asakura, T.; Mikami, Y.; Fritch, E.J.; et al. Human Lung Stem Cell-Based Alveolospheres Provide Insights into SARS-CoV-2-Mediated Interferon Responses and Pneumocyte Dysfunction. Cell Stem Cell 2020, 27, 890–904.e8. [Google Scholar] [CrossRef] [Scilit]
- Hartl, D.; Griese, M. Surfactant protein D in human lung diseases. Eur. J. Clin. Investig. 2006, 36, 423–435. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Gil, J. Structure of pulmonary surfactant membranes and films: The role of proteins and lipid-protein interactions. Biochim. Biophys. Acta 2008, 1778, 1676–1695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Echaide, M.; Autilio, C.; Arroyo, R.; Perez-Gil, J. Restoring pulmonary surfactant membranes and films at the respiratory surface. Biochim. Biophys. Acta Biomembr. 2017, 1859 Pt B, 1725–1739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weaver, T.E.; Whitsett, J.A. Function and regulation of expression of pulmonary surfactant-associated proteins. Biochem. J. 1991, 273 Pt 2, 249–264. [Google Scholar] [CrossRef] [Scilit]
- Crouch, E.; Hartshorn, K.; Ofek, I. Collectins and pulmonary innate immunity. Immunol. Rev. 2000, 173, 52–65. [Google Scholar] [CrossRef] [Scilit]
- Wright, J.R. Immunomodulatory functions of surfactant. Physiol. Rev. 1997, 77, 931–962. [Google Scholar] [CrossRef] [Scilit]
- Cheng, G.; Ueda, T.; Nakajima, H.; Nakajima, A.; Kinjyo, S.; Motojima, S.; Fukuda, T. Suppressive effects of SP-A on ionomycin-induced IL-8 production and release by eosinophils. Int. Arch. Allergy Immunol. 1998, 117 (Suppl. 1), 59–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chait, M.; Yilmaz, M.M.; Shakil, S.; Ku, A.W.; Dogra, P.; Connors, T.J.; Szabo, P.A.; Gray, J.I.; Wells, S.B.; Kubota, M.; et al. Immune and epithelial determinants of age-related risk and alveolar injury in fatal COVID-19. JCI Insight 2022, 7, e157608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salvioni, L.; Testa, F.; Sulejmani, A.; Pepe, F.; Giorgio Lovaglio, P.; Berta, P.; Dominici, R.; Leoni, V.; Prosperi, D.; Vittadini, G.; et al. Surfactant protein D (SP-D) as a biomarker of SARS-CoV-2 infection. Clin. Chim. Acta 2022, 537, 140–145. [Google Scholar] [CrossRef] [Scilit]
- Takenaka, H.; Saito, A.; Kuronuma, K.; Moniwa, K.; Nishikiori, H.; Takahashi, S.; Chiba, H. The Soluble Lectin Families as Novel Biomarkers for COVID-19 Pneumonia. In Vivo 2023, 37, 1721–1728. [Google Scholar] [CrossRef] [Scilit]
- Mapelli, M.; Salvioni, E.; Mattavelli, I.; Banfi, C.; Ghilardi, S.; Greco, A.; Biondi, M.L.; Rovai, S.; Mancini, E.; Harari, S.; et al. Surfactant-derived protein type B: A new biomarker linked to respiratory failure and lung damage in mild to moderate SARS-CoV-2 pneumonia. ERJ Open Res. 2024, 10, 00301–02024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gerosa, C.; Fann, D.; Cau, F.; Ravarino, A.; Senes, G.; Demontis, R.; Coni, P.; Piras, M.; Orrù, G.; Coghe, F.; et al. Immunohistochemical findings in the lungs of COVID-19 subjects: Evidence of surfactant dysregulation. Eur. Rev. Med. Pharmacol. Sci. 2021, 25, 4639–4643. [Google Scholar] [CrossRef] [Scilit]
- Wojcik, M.; Zieleniak, A.; Zurawska-Klis, M.; Cypryk, K.; Wozniak, L.A. Increased expression of immune-related genes in leukocytes of patients with diagnosed gestational diabetes mellitus (GDM). Exp. Biol. Med. 2016, 241, 457–465. [Google Scholar] [CrossRef] [Scilit]
- Pincus, R. Barnett, V., and Lewis T.: Outliers in Statistical Data. 3rd edition. J. Wiley & Sons 1994, XVII. 582 pp., £49.95. Biom. J. 1995, 37, 256. [Google Scholar] [CrossRef] [Scilit]
- Iglewicz, B.; Hoaglin, D. The ASQC Basic References in Quality Control: Statistical Techniques. In How to Detect and Handle Outliers; Mykytka, E.F., Ed.; ASQC Quality Press: Milwaukee, WI, USA, 1993; Volume 16. [Google Scholar]
- Sjoding, M.W.; Admon, A.J.; Saha, A.K.; Kay, S.G.; Brown, C.A.; Co, I.; Claar, D.; McSparron, J.I.; Dickson, R.P. Comparing Clinical Features and Outcomes in Mechanically Ventilated Patients with COVID-19 and Acute Respiratory Distress Syndrome. Ann. Am. Thorac. Soc. 2021, 18, 1876–1885. [Google Scholar] [CrossRef] [Scilit]
- Vahidy, F.S.; Drews, A.L.; Masud, F.N.; Schwartz, R.L.; Askary, B.B.; Boom, M.L.; Phillips, R.A. Characteristics and Outcomes of COVID-19 Patients During Initial Peak and Resurgence in the Houston Metropolitan Area. JAMA 2020, 324, 998–1000. [Google Scholar] [CrossRef] [Scilit]
- Grasselli, G.; Pesenti, A.; Cecconi, M. Critical Care Utilization for the COVID-19 Outbreak in Lombardy, Italy: Early Experience and Forecast During an Emergency Response. JAMA 2020, 323, 1545–1546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, S.; Hayek, S.S.; Wang, W.; Chan, L.; Mathews, K.S.; Melamed, M.L.; Brenner, S.K.; Leonberg-Yoo, A.; Schenck, E.J.; Radbel, J.; et al. Factors Associated with Death in Critically Ill Patients With Coronavirus Disease 2019 in the US. JAMA Intern. Med. 2020, 180, 1436–1447. [Google Scholar] [CrossRef] [Scilit]
- Schousboe, P.; Ronit, A.; Nielsen, H.B.; Benfield, T.; Wiese, L.; Scoutaris, N.; Verder, H.; Berg, R.M.G.; Verder, P.; Plovsing, R.R. Reduced levels of pulmonary surfactant in COVID-19 ARDS. Sci. Rep. 2022, 12, 4040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tong, M.; Xiong, Y.; Zhu, C.; Xu, H.; Zheng, Q.; Jiang, Y.; Zou, L.; Xiao, X.; Chen, F.; Yan, X.; et al. Serum surfactant protein D in COVID-19 is elevated and correlated with disease severity. BMC Infect. Dis. 2021, 21, 737. [Google Scholar] [CrossRef] [Scilit]
- Bastani, M.N.; Jalilian, S. Unraveling the enigma: The emerging significance of pulmonary surfactant proteins in predicting, diagnosing, and managing COVID-19. Immun. Inflamm. Dis. 2024, 12, e1302. [Google Scholar] [CrossRef] [Scilit]
- Maddaloni, L.; Zullino, V.; Bugani, G.; Lazzaro, A.; Brisciani, M.; Mastroianni, C.M.; Santinelli, L.; Ruberto, F. Could SP-A and SP-D Serum Levels Predict COVID-19 Severity? Int. J. Mol. Sci. 2024, 25, 5620. [Google Scholar] [CrossRef] [Scilit]
- Floros, J.; Phelps, D.S. Is the role of lung innate immune molecules, SP-A1 and SP-A2, and of the alveolar macrophage being overlooked in COVID-19 diverse outcomes? Pneumon 2020, 33, 51. [Google Scholar]
- Das, A.; Meng, W.; Liu, Z.; Hasib, M.M.; Galloway, H.; Ramos da Silva, S.; Chen, L.; Sica, G.L.; Paniz-Mondolfi, A.; Bryce, C.; et al. Molecular and immune signatures, and pathological trajectories of fatal COVID-19 lungs defined by in situ spatial single-cell transcriptome analysis. J. Med. Virol. 2023, 95, e29009. [Google Scholar] [CrossRef] [Scilit]
- Islam, A.B.M.M.K.; Khan, M.A. Lung transcriptome of a COVID-19 patient and systems biology predictions suggest impaired surfactant production which may be druggable by surfactant therapy. Sci. Rep. 2020, 10, 19395. [Google Scholar] [CrossRef] [Scilit]
- Sicher, N.; Aldrich, B.; Zhang, S.; Mazur, L.; Juarez, S.; Lehman, E.; Liu, D.; Gandhi, C.K. Surfactant protein levels and genetic variants as biomarkers for COVID-19 severity in children. Am. J. Physiol. Lung Cell. Mol. Physiol. 2025, 328, L350–L356. [Google Scholar] [CrossRef] [Scilit]
- Numata, M.; Voelker, D.R. Anti-inflammatory and anti-viral actions of anionic pulmonary surfactant phospholipids. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2022, 1867, 159139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bersten, A.D.; Hunt, T.; Nicholas, T.E.; Doyle, I.R. Elevated plasma surfactant protein-B predicts development of acute respiratory distress syndrome in patients with acute respiratory failure. Am. J. Respir. Crit. Care Med. 2001, 164, 648–652. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- do Nascimento, M.F.; Ferreira, L.R.P.; Vieira Junior, J.M.; Deheinzelin, D.; Aparecida Santos Nussbaum, A.C.; Toshihiro Sakamoto, L.H.; Vasconcelos, R.O.; Salomao, R.; Waisberg, J.; Azevedo, L.C.P.; et al. Circulating extracellular vesicles as potential biomarkers and mediators of acute respiratory distress syndrome in sepsis. Sci. Rep. 2025, 15, 5512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dohmoto, K.; Hojo, S.; Fujita, J.; Kamei, T.; Ueda, Y.; Miyawaki, H.; Bandoh, S.; Okada, H.; Takahara, J. Circulating bronchoepithelial cells expressing mRNA for surfactant protein A in patients with pulmonary fibrosis. Respir. Med. 2000, 94, 475–481. [Google Scholar] [CrossRef] [Scilit]
- Park, J.; Pabon, M.; Choi, A.M.K.; Siempos, I.I.; Fredenburgh, L.E.; Baron, R.M.; Jeon, K.; Chung, C.R.; Yang, J.H.; Park, C.M.; et al. Plasma surfactant protein-D as a diagnostic biomarker for acute respiratory distress syndrome: Validation in US and Korean cohorts. BMC Pulm. Med. 2017, 17, 204. [Google Scholar] [CrossRef] [Scilit]

| Asymp (n = 44) | Mild (n = 48) | Severe (n = 30) | |
|---|---|---|---|
| Age (years) | 30.3 ± 1.7 | 33.8 ± 2.3 | 59.2 ± 2.8 |
| Sex | |||
| Male | 18 | 18 | 19 |
| Female | 26 | 30 | 11 |
| Smoking status | 19 | 14 | 25 |
| Comorbidities | |||
| HT | 7 | 6 | 14 |
| DM | 6 | 3 | 2 |
| CAD | 1 | 3 | |
| Symptoms | |||
| Fever | 41 | 3 | |
| Fatigue | 42 | 2 | |
| Sepsis | 1 | 27 | |
| ARDS | 1 | 24 | |
| BP | 2 | 2 | |
| Name | Sequence (5′–3′) |
|---|---|
| SFTPA1_sense | CTCCTGGAAATGATGGGCTGC |
| SFTPA1_antisense | GTCTAAAGTCGTGGAGTGTGGC |
| SFTPA2_sense | TGGAGAGCGTGGAGAGAAGG |
| SFTPA2_antisense | TGATGTCTGAAGTCGTGGAGTG |
| SFTPB_sense | CACCTCATCCTTGGCCTGTG |
| SFTPB_antisense | CTTGGCATAGGTCATCGGCTC |
| SFTPC_sense | GCCTTCTTATCGTGGTGGTGG |
| SFTPC_antisense | TGGTAACCAGGTGCTCACTCA |
| SFTPD_sense | GGAGCAAAGGGAGAAAGTGGG |
| SFTPD_antisense | CTGAGAGAAAGCAGCCTGGAG |
| GAPDH_sense | GAGTCAACGGATTTGGTCGT |
| GAPDH_antisense | GACAAGCTTCCCGTTCTCAG |
| Asymp (n = 44) | Mild (n = 48) | Severe (n = 30) | p-Value | |
|---|---|---|---|---|
| Age (years) | 30.3 ± 1.7 | 33.8 ± 2.3 | 59.2 ± 2.8 | <0.0001 a |
| Sex | ||||
| Male | 18 (40.9) | 18 (37.5) | 19 (63.3) | 0.0652 b |
| Female | 26 (59.1) | 30 (62.5) | 11 (36.7) | |
| Smoking status (%) | 19 (43.2) | 14 (29.2) | 25 (83.3) | <0.0001 b |
| Comorbidities | ||||
| HT | 7 (15.9) | 6 (12.5) | 14 (46.7) | 0.0009 b |
| DM | 6 (13.6) | 3 (6.3) | 2 (6.7) | 0.4797 c |
| CAD | 0 (0) | 1 (2.1) | 3 (10) | 0.0833 c |
| Symptoms | ||||
| Fever | 0 (0) | 41 (85.4) | 3 (10) | <0.0001 b |
| Fatigue | 0 (0) | 42 (87.5) | 2 (6.7) | <0.0001 b |
| Sepsis | 0 (0) | 1 (2.1) | 27 (90) | <0.0001 b |
| ARDS | 0 (0) | 1 (2.1) | 24 (80) | <0.0001 b |
| BP | 0 (0) | 2 (4.2) | 2 (6.7) | 0.2312 c |
| Mild/Asympt | Severe/Asympt | Severe/Mild | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Genes | Fold Change | p-Value | Effect Size | Power (1-β) | Fold Change | p-Value | Effect Size | Power (1-β) | Fold Change | p-Value | Effect Size | Power (1-β) |
| SFTPA1 | −1.70 | 0.3997 | 0.21 | 0.16 | −2.31 | 0.0632 | 0.39 | 0.36 | −1.36 | 0.0013 | 0.48 | 0.51 |
| SFTPA2 | −9.74 | 0.0663 | 0.22 | 0.18 | 5.13 | <0.0001 | 0.48 | 0.50 | 50.02 | <0.0001 | 0.72 | 0.85 |
| SFTPB | −1.44 | 0.0482 | 0.27 | 0.23 | −2.50 | 0.7874 | 0.12 | 0.08 | −1.73 | 0.0120 | 0.35 | 0.31 |
| SFTPC | 48.74 | <0.0001 | 0.84 | 0.97 | −1.10 | 0.9741 | 0.18 | 0.11 | −53.84 | <0.0001 | 0.82 | 0.93 |
| SFTPD | 454.47 | <0.0001 | 0.84 | 0.97 | 4345.92 | <0.0001 | 0.84 | 0.93 | 9.56 | 0.0002 | 0.52 | 0.58 |
| Asymptomatic | Mild | Severe | ||||
|---|---|---|---|---|---|---|
| Gene Pair | r | p-Value | r | p-Value | r | p-Value |
| SFTPA1-SFTPA2 | 0.307 | 0.0541 | 0.673 | <0.0001 | 0.020 | 0.9258 |
| SFTPA1-SFTPB | −0.080 | 0.6345 | 0.102 | 0.5062 | 0.370 | 0.0748 |
| SFTPA1-SFTPC | 0.001 | 0.9946 | −0.492 | 0.0015 | −0.049 | 0.8281 |
| SFTPA1-SFTPD | −0.396 | 0.0273 | −0.549 | 0.0001 | −0.653 | 0.0007 |
| SFTPA2-SFTPB | 0.024 | 0.8781 | 0.037 | 0.8105 | −0.033 | 0.8671 |
| SFTPA2-SFTPC | 0.058 | 0.7115 | −0.537 | 0.0004 | −0.059 | 0.7785 |
| SFTPA2-SFTPD | −0.092 | 0.5974 | −0.499 | 0.0004 | 0.074 | 0.7243 |
| SFTPB-SFTPC | −0.013 | 0.9341 | −0.083 | 0.6126 | 0.050 | 0.8150 |
| SFTPB-SFTPD | 0.046 | 0.7949 | −0.254 | 0.0927 | −0.230 | 0.2787 |
| SFTPC-SFTPD | 0.161 | 0.3705 | 0.772 | <0.0001 | −0.037 | 0.8712 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koc, S.; Senturk, K.C.; Cetinkaya, S.; Yenmis, G.; Arkan, H.; Demirbilek, M.; Acar, P.; Arikan, E.; Dokur, M. Is Altered Surfactant Protein Gene Expression in Peripheral Blood Associated with COVID-19 Disease Severity? Diagnostics 2025, 15, 1690. https://doi.org/10.3390/diagnostics15131690
Koc S, Senturk KC, Cetinkaya S, Yenmis G, Arkan H, Demirbilek M, Acar P, Arikan E, Dokur M. Is Altered Surfactant Protein Gene Expression in Peripheral Blood Associated with COVID-19 Disease Severity? Diagnostics. 2025; 15(13):1690. https://doi.org/10.3390/diagnostics15131690
Chicago/Turabian StyleKoc, Suna, Kamil Cankut Senturk, Sefa Cetinkaya, Guven Yenmis, Hulya Arkan, Mahmut Demirbilek, Pinar Acar, Erhan Arikan, and Mehmet Dokur. 2025. "Is Altered Surfactant Protein Gene Expression in Peripheral Blood Associated with COVID-19 Disease Severity?" Diagnostics 15, no. 13: 1690. https://doi.org/10.3390/diagnostics15131690
APA StyleKoc, S., Senturk, K. C., Cetinkaya, S., Yenmis, G., Arkan, H., Demirbilek, M., Acar, P., Arikan, E., & Dokur, M. (2025). Is Altered Surfactant Protein Gene Expression in Peripheral Blood Associated with COVID-19 Disease Severity? Diagnostics, 15(13), 1690. https://doi.org/10.3390/diagnostics15131690

