Hemodynamic and Genetic Associations with the Risk of Idiopathic Pulmonary Arterial Hypertension Development in an Ethnic Cohort of Kazakhs
by
,
Dana Taizhanova
1,
Togzhan Nurpissova
1,2,*,
Gulshara Abildinova
3,
Tamilla Martynyuk
4,
Nazgul Kulmyrzayeva
2 and
Elena Zholdybayeva
5 1
Department of Internal Diseases, Karaganda Medical University Non-Commercial Joint Stock Company, Karaganda 100000, Kazakhstan
2
Department of Therapy No. 7, Medical Center Hospital of the President’s Affairs Administration of the Republic of Kazakhstan, Astana 010000, Kazakhstan
3
Laboratory of Personalized Genomic Diagnostics, Medical Center Hospital of the President’s Affairs Administration of the Republic of Kazakhstan, Astana 010000, Kazakhstan
4
Institution «National Medical Cardiology Research Center Named After Academician Ye. I. Chazov» of the Ministry of Health of the Russian Federation, Moscow 105064, Russia
5
National Scientific Shared Laboratory of Biotechnology, National Center of Biotechnology Limited Liability Partnership, Astana 010000, Kazakhstan
*
Author to whom correspondence should be addressed.
Diagnostics 2024, 14(23), 2687; https://doi.org/10.3390/diagnostics14232687
Submission received: 30 October 2024
/
Revised: 21 November 2024
/
Accepted: 24 November 2024
/
Published: 28 November 2024
(This article belongs to the Section Clinical Diagnosis and Prognosis)
Abstract
:Introduction: Idiopathic pulmonary arterial hypertension (IPAH) is a progressive and fatal disease. The aim of this study was to evaluate the association of polymorphism of the type 2 bone morphogenetic protein receptor gene (BMPR2) with the risk of IPAH development in an ethnic group of Kazakhs. We also describe the clinical and hemodynamic characteristics and outcomes of patients with and without carriers of BMPR2 gene mutations in IPAH. No available research highlights this problem in an ethnic group of Kazakhs. Materials and methods: A total of 53 patients of only Kazakh nationality with IPAH participated in the study. Clinical, functional, and hemodynamic characteristics, as well as the outcome of the disease, were compared among carriers and non-carriers of the BMPR2 mutation. Results: When receiving IPAH diagnosis, the average age of patients was 40.0 (32.0–48.0) years. Women predominated among the patients (86.8%). Of these, 17 (32.0%) were carriers of the gene mutation, and 36 (68.0%) did not have this mutation. The results of our research demonstrate that the Rs17199249 variant in BMPR2 contributed to increased susceptibility to IPAH. The T allele was associated with an increased risk of IPAH, with T = 75 (70.75%), G = 31 (29.24%), MAF—0.2925, x2—0.001, and HWE p—0.975. Carriers of the BMPR2 mutation were predominantly women (80.0%), and they had higher pulmonary vascular resistance (8.7–14.9 vs. 5.9–12.6 WU; p = 0.038), a low cardiac index (1.9–2.6 vs. 2.3–3.1 L/min per m2; p = 0.027), and a shorter time to death (p = 0.022). Conclusions: This is the first study of the genetic causes of IPAH that demonstrates the genetic polymorphism of BMPR2 is associated with an increased risk of IPAH developing with worse hemodynamic parameters and clinical outcomes.
1. Introduction
Pulmonary arterial hypertension (PAH) is a rare disease associated with unfavorable prognosis of a pressure increase in the small circle of blood circulation. The phenotypes of PAH are diverse and include idiopathic PAH (IPAH), the cause of which is unknown, and hereditary PAH (HPAH), which is associated with genetic changes or illustrates familial aggregation [1,2].
IPAH is a sporadic disease without any family PAH history or known causes. IPAH prevalence is 5.9 cases per 1,000,000 of the population. HPAH is diagnosed if there is a positive family history or a pathogenic variant is detected. IPAH is the most common PAH form according to the registers of European countries (France, Great Britain, and Ireland), the United States of America, and the Russian Federation [3]. PAH occurs in 15–50 patients per million of the population in Europe and the United States, of which hereditary, idiopathic, and anorexigen-induced PAH is 52.6% [4]. According to the Russian Register, these variants account for 41.5% of all PAH forms [5,6]. There is currently no register of patients with PAH in the territory of the Republic of Kazakhstan. Some highly specialized centers create databases, but there is no unified system for registering patients with PAH.
Currently, IPAH is increasingly considered a multifaceted disease, including many points of interaction between genetics, metabolomics, imbalance of vasoconstrictor and vasodilator reactions, endothelial and smooth muscle dysfunction, and more. Available genetic studies of HPAH and IPAH in individual populations have shown that the superfamily of transforming growth factor-β (TGF-β) plays an important role. At the same time, the identified mutations occur in the receptor of the type 2 bone morphogenetic protein (BMPR2), type 1 activin receptor-like kinase (ALK1), endoglin, and SMAD9 [7]. The BMPR2 mutation has been identified as the main genetic cause of PAH. It accounts for 75–90% of cases of HPAH and 3.5–40% of sporadic cases with an autosomal dominant type of inheritance [8,9]. BMPR2 deficiency leads to abnormal overactivation of the TGF-β signaling pathway, which causes excessive proliferation of vascular smooth muscle cells in pulmonary arterioles [10,11,12,13,14]. Patients with PAH and BMPR2 genetic variants tend to have the earlier onset and the worse clinical scenario of the disease course. The international consortium centrally compared and coordinated the data of 1550 patients with PAH from eight cohorts of six countries. The results of the study show that when identifying the BMPR2 mutation, PAH manifests at a younger age, has a more severe course, and has an increased risk of death or lung transplantation compared to patients without the BMPR2 mutation [15]. It is well known that patients with positive BMPR2 mutation have worse hemodynamic parameters at admission and worse disease outcomes compared to patients diagnosed with PAH without mutations [16]. In addition, a total of 17 PAH genes were acknowledged at the Sixth World Symposium on Pulmonary Hypertension. Many of these genes have been shown to belong to or be associated with the BMPR2/transforming growth factor (TGF)-β pathway [11,13,17].
Apart from BMPR2 pathway genes, disease-causing variants in genes strongly associated with PAH have also been identified in genes that encode a plasma membrane protein (caveolin-1 (CAV1)), a potassium channel protein (KCNK3), and an ion channel protein (ATP13A3) [18]. For KCNK3, ATP13A3, and GDF2, not only monoallelic but also biallelic variants have been described with a more severe presentation of the respective patients [19,20]. Genetic screening to detect patients with mutations and then identify close relatives is an important aspect. As noted in previous reports, annual monitoring of these asymptomatic individuals can provide earlier PAH diagnosis and earlier interventions that could potentially affect morbidity and/or mortality [21]. For example, in 2020, researchers of the United States Pulmonary Hypertension Scientific Registry (USPHSR) provided data from the first PAH patient registry in the United States, including genetic information. Genetic testing identified pathogenic or suspected pathogenic variants in 67 out of 499 (13%) participants and reclassified 40 out of 218 (18%) patients diagnosed with IPAH and 13 out of 256 (5%) patients diagnosed with associated PAH (APAH) to HPAH [22]. The detection of BMPR2 mutations is a crucial step in the genetic diagnosis of PAH. This is very important for personalized therapy and genetic counseling [23,24,25].
2. Materials and Methods
Population study. The study included 53 patients of the Kazakh ethnic group with IPAH examined at the specialized National Scientific Cardiac Surgery Center (Astana, Kazakhstan) in the period from 2016 to 2022. All patients underwent thorough clinical examination, which made it possible to exclude other known causes of PAH. For the final verification of the clinical diagnosis of IPAH, all examined patients underwent catheterization of the right of the heart (the protocol of diagnosis and treatment in the Republic of Kazakhstan, as well as according to the recommendations of the European Society of Cardiology (ESC)).
A total of 53 examined patients with IPAH were identified as the main group, which consisted of an ethnic group of Kazakh nationality. The control group included 125 practically healthy individuals, comparable in age and gender and without a family history of PAH or other cardiovascular diseases (congenital heart defects, coronary heart disease, chronic heart failure, or arterial hypertension).
The demographic and clinical characteristics of all the surveyed were studied. Informed consent regarding the purpose and procedure of this study was obtained from each patient. To analyze the association between BMPR2 and the risk of IPAH, a stratified assessment was performed depending on hemodynamic parameters: mean right atrium pressure (mRAP), mean pulmonary arterial pressure (mPAP), the Fick cardiac index (CI), pulmonary vascular resistance (PVR), and the systemic vascular resistance index (SVR I). The scientific study was approved by the Ethics Committee of Karaganda Medical University NC JSC (Protocol No. 62, dated 12 April 2021).
Single nucleotide polymorphism (SNP) choice and genotyping. The choice of SNP was based on a literature review, allele frequency, and functional position. The study material was venous blood of patients with IPAH and practically healthy individuals. Genomic DNA was isolated from whole blood anticoagulated with ethylenediaminetetraacetic acid (EDTA) using PureLink® Genomic DNA Kits (K1820-02) (Thermo Fisher Scientific, Waltham, MA, USA) in accordance with the protocol recommended by the manufacturer. Flanking primers and destructible fluorescent probes were developed to analyze the single nucleotide polymorphism of the BMPR2 (rs1061157), BMPR2 (rs2228545), BMPR2 (rs17199249), and BMPR2 (rs113305949) gene loci. Table 1 shows the sequences of primers and probes.
Genotyping. Real-time PCR was performed in an amplifier CFX96 (BioRad, Hercules, CA, USA). The amplification program for the thermal cycler had the following temperature conditions: +95 °C (3 min)—1 cycle; +95 °C (10 s), +60 °C (40 s, optical detection)—45 cycles. The results were analyzed in the Laboratory of Personalized Genomic Diagnostics, Medical Center Hospital of the President’s Affairs Administration of the Republic of Kazakhstan. After automatic annotation and visual inspection, genotypes were determined for each sample (patient).
3. Statistical Analysis
Statistical analysis was performed with the use of R version 4.2.1 (R Foundation for Statistical Computing, Vienna, Austria, 21 March 2022). Descriptive statistics were calculated and presented as means (M) and standard deviations (SD) for continuous data with symmetric distribution, while medians (Mdns) and interquartile ranges (IQRs) were displayed otherwise. Frequencies (n) and percentages (%) were presented for categorical data. Distribution of the data was evaluated by analyzing Skew and Kurtosis, as well as the visual inspection of histograms. Levene’s test was utilized to assess the assumption of homogeneity of variance. Univariate associations were studied with the unpaired samples t-test for continuous data following parametric assumptions; otherwise, the Mann–Whitney U test was applied. In the case of categorical data, Pearson’s Chi-Square test was employed.
Furthermore, Pearson’s Chi-Square test was utilized to assess the correspondence of the distribution of genotype frequencies to the Hardy–Weinberg equilibrium. The results are consistent with the Hardy–Weinberg law at p < 0.05.
Finally, associations of BMPR2 mutation status with risk of death were assessed using Cox proportional hazards regression models. Survival curves comparing patients with and without BMPR2 mutations were calculated using unadjusted Kaplan-Meier estimates and compared using the log-rank test.
The sample size was calculated using an online sample size calculator (https://www.calculator.net/sample, accessed on 3 April 2021). The sample size was sufficient to identify the association between the studied gene and IPAH (95% power, 3% disease prevalence, and 4.59% error).
The results were considered statistically significant at p < 0.05 throughout.
4. Results of the Study
BMPR2 Mutations. Table 2 shows the distribution of genotypes and alleles in the studied polymorphisms of the BMPR2 gene in the main group (IPAH) and the control group.
Table 2 demonstrates that rs2228545 in the BMPR2 gene did not correspond to the Hardy–Weinberg equilibrium and was excluded from subsequent analysis. The frequency of the minor A allele of the rs1061157 polymorphism (G > A) was 0.2353, while the MAF from the database (Global1000G) was A = 0.109175 (https://www.ncbi.nlm.nih.gov/snp/rs1061157, accessed on 5 April 2024). It should be noted that the frequency of occurrence of the A allele in the Kazakh population is higher than in Asian populations (A = 0.111). The frequency of the minor A allele of the rs113305949 polymorphism (C > A) was 0.1375, while the MAF from the database (Global1000G) was A = 0.0044 (https://www.ncbi.nlm.nih.gov/snp/rs1061157 accessed on 5 April 2024). It should be noted that the A allele is found in the Kazakh population, whereas in Asian populations, it is not (A = 0.000). The frequency of the minor T allele of the rs17199249 polymorphism (T > G) was 0.2925, while the MAF from the database (Global1000G) was G = 0.125138 (https://www.ncbi.nlm.nih.gov/snp/rs17199249 accessed on 5 April 2024). It should be noted that the frequency of occurrence of the T allele in the Kazakh population is similarly higher than in Asian populations (T = 0.0025). Compared with the G allele, the T allele can significantly increase the risk of IPAH developing (T = 70.75%, G = 29.24, MAF—0.2925, χ2—0.001, HWE p—0.975).
Description of the cohort. A total of 53 patients with IPAH participated in the study, of whom 17 (32.0%) were carriers of the gene mutation, and 36 (68.0%) did not have this mutation. The assessment of the association of the genotype with clinical and hemodynamic parameters reveals a statistically significant difference in PVR (p = 0.038) within the main group. Patients with IPAH who were carriers of the mutation (n = 17) had higher PVR values than non-carriers of this mutation (n = 36). In addition (Table 3), patients with the mutation had significantly lower CI (p = 0.027) and LVEF (p = 0.017).
It should be noted that there were no significant differences between the average age at the time of diagnosis (p = 0.221). However, there was a significant difference in the distribution by sex (p = 0.040). Thus, 80.0% of mutation carriers were women among patients with IPAH, while only 10.5% were men.
Correlation of BMPR2 SNP with some hemodynamic characteristics. Table 4 presents data on the bivariate association between BMPR2 and the hemodynamic characteristics of patients.
The results indicate the relationship between BMPR2 and hemodynamic parameters of patients. Thus, it was found that BMPR2 (rs17199249) was significantly associated with PVR (p = 0.035).
Clinical outcomes. All patients were monitored for 5 years, and there were no dropouts from the study. The following cardiovascular events were registered during the monitoring period: 20 patients died, and 12 of them were carriers of the BMPR2 mutation.
According to the results from comparing data obtained from patients with IPAH (carriers and non-carriers of the BMPR2 mutation), the hazard ratio (HR) was 2.896 (95% CI [1.165–7.065]; p = 0.022), which demonstrates a higher association with fatal events in patients with IPAH who were carriers of the BMPR2 mutation.
In the group of patients with IPAH (n = 53), females (n = 46) prevailed, 14 (30.4%) of whom were carriers of the gene mutation, and 32 (69.6%) did not have the mutation. A comparative assessment of carriers and non-carriers of the BMPR2 mutation among females showed that HR was 3.142 (95% CI [1.212–8.143]; p = 0.019), which determines the higher probability of death among female patients with IPAH associated with the mutation carrier. At the same time, among male patients with IPAH (Table 5), the HR was 1.414 (95% CI [0.088–22.64]), which was not statistically significant (p = 0.806).
When comparing the survival curves of carriers and non-carriers of the gene mutation, it was found (Figure 1) that the survival rate of carriers is statistically significantly lower than in patients without the gene mutation (p = 0.017).
The comparative assessment of the survival curves of carriers and non-carriers of the gene mutation among female patients shows (Figure 2) that the survival rate of female carriers of the gene mutation is statistically significantly lower than in patients without the gene mutation (p = 0.013).
5. Discussion
It follows from the study results that the average age of patients with IPAH in the ethnic Kazakh group at the moment of diagnosis determination was 40.0 (32.0–48.0) years. This fact corresponds to similar data from the last European and North American registries [26]. It should be noted that the age at the time of diagnosis among women and men was almost the same for carriers and non-carriers of the BMPR2 mutation. This study is the first to be conducted among the Kazakh population and demonstrates the relationship between the genotypic frequencies of BMPR2 SNP and IPAH debut. The results of the study show significant associations between the polymorphism of the BMPR2 gene (rs17199249) and the risk of IPAH development. This association is higher in the Kazakh population compared to Central Asians and Europeans. At the same time, BMPR2 polymorphisms (rs1061157 and rs113305949) in the main group (IPAH) showed no significant differences compared with the control group.
Evans et al. conducted a meta-analysis of 1550 patients with idiopathic, hereditary, and anorexigen-related PAH from eight cohorts and revealed that 29% of the examined persons had BMPR2 gene mutations [16]. The decrease in gene expression was registered even in patients with PAH without BMPR2 mutations [27]. Data from the study of an Asian cohort from Korea demonstrated that the prevalence of BMPR2 variants in Korean patients with IPAH was 22% [28]. A Japanese group reported BMPR2 variants in all four patients with HPAH (4/4 = 100%) and 12 (12/30 = 40%) with IPAH, and this index was higher than in Caucasian patients [29]. A study by colleagues from central Taiwan revealed the BMPR2 gene mutation in 17.8% (8/45) of primary patients with PAH, which is slightly lower than the previously recorded prevalence in other cohorts. However, patients of the Taiwanese cohort with the BMPR2 mutation went to a clinic at a younger age and had higher mPAP, higher PVR, and worse CI [30]. In addition, more severe hemodynamic disorders (low cardiac index and high total pulmonary resistance) were registered in the ethnic group of Kazakhs with IPAH associated with BMPR2 mutations, which coincide with previously published observations by other authors [31,32,33].
The comparative assessment of overall survival from the period of IPAH diagnosis substantiation allowed the establishment that there were significantly more fatal outcomes among carriers of the BMPR2 mutation. In addition, cardiovascular events occurred much earlier in female carriers of the BMPR2 mutation than in male carriers of this mutation. The obtained data are similar to the results of the study by G. Pousada et al. [34] and demonstrate that higher PVR values were registered in patients with BMPR2 mutations. The facts obtained in this study conclude that the patients of the Kazakh ethnic group with IPAH associated with BMPR2 mutations had a more severe disease course and worse prognosis compared with patients with IPAH without this genetic defect. At the same time, Pfarr et al. [17] found significant differences only at low PVR values. In this regard, they proposed that in the presence of an association with BMPR2 mutations, patients should be classified as patients with HPAH and must undergo segregation analysis of the hereditary nature of the disease.
One of the limitations of this study was the sampling size. This problem may be considered in future studies.
6. Conclusions
This study is the first to report on the genetic basis of IPAH in the Kazakh ethnic group and highlights the important contribution of genetic polymorphism to the development of IPAH.
It was established that in the ethnic group of Kazakhs, polymorphism of the BMPR2 gene is associated with the risk of IPAH development and a more expressed degree of hemodynamic disorders in the form of low cardiac output and high peripheral resistance. Female individuals with higher fatal cardiovascular events significantly predominate among patients with IPAH associated with the BMPR2 mutation. The obtained results indicate the need for further studies on a larger number of patients with IPAH in order to expand the spectrum of mutations in populations of ethnic groups.
Author Contributions
Conceptualization, D.T. and T.N.; methodology, D.T., T.N. and G.A.; software, D.T., T.N., G.A., T.M. and E.Z.; validation, D.T., T.N. and G.A.; formal analysis, D.T., T.N., G.A., N.K., T.M. and E.Z.; investigation, D.T., T.N., G.A., N.K. and T.M.; resources, D.T., T.N., G.A. and N.K.; data curation, D.T., T.N., G.A., N.K. and E.Z.; writing—original draft preparation, D.T. and T.N.; writing review and editing, D.T., T.N. and G.A.; visualization, D.T. and T.N.; supervision, D.T.; project administration, D.T. and T.N.; funding acquisition, D.T., T.N., G.A., T.M., N.K. and E.Z. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
The scientific study was approved by the Ethics Committee of Karaganda Medical University NC JSC (Protocol No. 0.62, dated 12 April 2021).
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.
Conflicts of Interest
D.T was employed by the Karaganda Medical University Non-Commercial Joint Stock Company. T.N. was employed by the Medical Center Hospital of the President’s Affairs Administration of the Republic of Kazakhstan and was a PhD student of Karaganda Medical University Non-Commercial Joint Stock Company. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.
References
- Humbert, M.; Kovacs, G.; Hoeper, M.M.; Badagliacca, R.; Berger, R.M.F.; Brida, M.; Carlsen, J.; Coats, A.J.S.; Escribano-Subias, P.; Ferrari, P.; et al. 2022 ESC/ERS Guidelines for the diagnosis and treatment of pulmonary hypertension. Eur. Heart J. 2022, 38, 3618–3731. [Google Scholar] [CrossRef] [PubMed]
- Orriols, M.; Gomez-Puerto, M.C.; Ten Dijke, P. BMP type II receptor as a therapeutic target in pulmonary arterial hypertension. Cell. Mol. Life Sci. 2017, 16, 2979–2995. [Google Scholar] [CrossRef] [PubMed]
- Tielemans, B.; Delcroix, M.; Belge, C.; Quarck, R. TGFβ and BMPRII signalling pathways in the pathogenesis of pulmonary arterial hypertension. Drug Discov. Today 2019, 24, 703–716. [Google Scholar] [CrossRef] [PubMed]
- Galiè, N.; Palazzini, M.; Manes, A. Confirmation of survival prediction based on 2022 ESC/ERS pulmonary hypertension guidelines new haemodynamic thresholds. Eur. Heart J. 2023, 44, 4692–4695. [Google Scholar] [CrossRef] [PubMed]
- Chazova, I.E.; Arkhipova, O.A.; Martynyuk, T.V. Legochnaya arterial naya gipertenziya v Rossii: Analiz shestiletnego nablyudeniya po dannym Natsional nogo registra. Ther. Arch. 2019, 1, 24–31. [Google Scholar]
- Liu, D.; Morrell, N.W. Genetics and the molecular pathogenesis of pulmonary arterial hypertension. Curr. Hypertens. Rep. 2013, 15, 632–637. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Zeng, Q.; Ma, Y.; Liu, B.; Chen, Q.; Li, W.; Xiong, C.; Zhou, Z. Genetic analyses in a cohort of 191 pulmonary arterial hypertension patients. Respir. Res. 2018, 19, 87. [Google Scholar] [CrossRef] [PubMed]
- Navas, P.; Tenorio, J.; Quezada, C.A.; Barrios, E.; Gordo, G.; Arias, P.; López Meseguer, M.; Santos-Lozano, A.; Palomino Doza, J.; Lapunzina, P.; et al. Molecular Analysis of BMPR2, TBX4, and KCNK3 and Genotype-Phenotype Correlations in Spanish Patients and Families with Idiopathic and Hereditary Pulmonary Arterial Hypertension. Rev. Esp. Cardiol. (Engl. Ed.) 2016, 69, 1011–1019. [Google Scholar] [CrossRef] [PubMed]
- Girerd, B.; Montani, D.; Jais, X.; Eyries, M.; Yaici, A.; Sztrymf, B.; Savale, L.; Parent, F.; Coulet, F.; Godinas, L.; et al. Genetic counselling in a national referral Centre for pulmonary hypertension. Eur Respir. J. 2016, 47, 541–552. [Google Scholar] [CrossRef] [PubMed]
- Sharmin, N.; Nganwuchu, C.C.; Nasim, M.T. Targeting the TGF-β signaling pathway for resolution of pulmonary arterial hypertension. Trends Pharmacol. Sci. 2021, 7, 510–513. [Google Scholar] [CrossRef] [PubMed]
- Morrell, N.W.; Aldred, M.A.; Chung, W.K.; Elliott, C.G.; Nichols, W.C.; Soubrier, F.; Trembath, R.C.; Loyd, J.E. Genetics and genomics of pulmonary arterial hypertension. Eur Respir. J. 2019, 53, 1801899. [Google Scholar] [CrossRef] [PubMed]
- Zhu, N.; Pauciulo, M.W.; Welch, C.L.; Lutz, K.A.; Coleman, A.W.; Gonzaga-Jauregui, C.; Wang, J.; Grimes, J.M.; Martin, L.J.; He, H.; et al. Novel risk genes and mechanisms implicated by exome sequencing of 2572 individuals with pulmonary arterial hypertension. Genome Med. 2019, 11, 69. [Google Scholar] [CrossRef] [PubMed]
- Eichstaedt, C.A.; Belge, C.; Chung, W.K.; Gräf, S.; Grünig, E.; Montani, D.; Quarck, R.; Tenorio-Castano, J.A.; Soubrier, F.; Trembath, R.C.; et al. Genetic counselling and testing in pulmonary arterial hypertension: A consensus statement on behalf of the International Consortium for Genetic Studies in PAH. Eur. Respir. J. 2023, 2, 2201471. [Google Scholar] [CrossRef] [PubMed]
- Guignabert, C.; Bailly, S.; Humbert, M. Restoring BMPRII functions in pulmonary arterial hypertension: Opportunities, challenges and limitations. Expert Opin. Ther. Targets 2017, 2, 181–190. [Google Scholar] [CrossRef]
- Lane, K.B.; Machado, R.D.; Pauciulo, M.W.; Thomson, J.R.; Phillips, J.A.; Loyd, J.E.; Nichols, W.C.; Trembath, R.C. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat. Genet. 2000, 26, 82–84. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.D.; Girerd, B.; Montani, D.; Wang, X.J.; Galiè, N.; Austin, E.D.; Elliott, G.; Asano, K.; Grünig, E.; Yan, Y.; et al. BMPR2 mutations and survival in pulmonary arterial hypertension: An individual participant data meta-analysis. Lancet Respir. Med. 2016, 4, 129–137. [Google Scholar] [CrossRef] [PubMed]
- Pfarr, N.; Fischer, C.; Ehlken, N.; Becker-Grünig, T.; López-González, V.; Gorenflo, M.; Hager, A.; Hinderhofer, K.; Miera, O.; Nagel, C.; et al. Hemodynamic and genetic analysis in children with idiopathic, heritable, and congenital heart disease associated pulmonary arterial hypertension. Respir. Res. 2013, 14, 3–12. [Google Scholar] [CrossRef] [PubMed]
- Gräf, S.; Haimel, M.; Bleda, M.; Hadinnapola, C.; Southgate, L.; Li, W.; Hodgson, J.; Liu, B.; Salmon, R.M.; Southwood, M.; et al. Identification of rare sequence variation underlying heritable pulmonary arterial hypertension. Nat. Commun. 2018, 1, 1416. [Google Scholar] [CrossRef] [PubMed]
- Eichstaedt, C.A.; Sassmannshausen, Z.; Shaukat, M.; Cao, D.; Xanthouli, P.; Gall, H.; Sommer, N.; Ghofrani, H.A.; Seyfarth, H.J.; Lerche, M.; et al. Gene panel diagnostics reveals new pathogenic variants in pulmonary arterial hypertension. Respir. Res. 2022, 1, 74. [Google Scholar] [CrossRef] [PubMed]
- Machado, R.D.; Welch, C.L.; Haimel, M.; Bleda, M.; Colglazier, E.; Coulson, J.D.; Debeljak, M.; Ekstein, J.; Fineman, J.R.; Golden, W.C.; et al. Biallelic variants of ATP13A3 cause dose-dependent childhood-onset pulmonary arterial hypertension characterised by extreme morbidity and mortality. J. Med. Genet. 2022, 9, 906–911. [Google Scholar] [CrossRef] [PubMed]
- Montani, D.; Girerd, B.; Jaïs, X.; Laveneziana, P.; Lau, E.M.T.; Bouchachi, A.; Hascoët, S.; Günther, S.; Godinas, L.; Parent, F.; et al. Screening for pulmonary arterial hypertension in adults carrying a BMPR2 mutation. Eur. Respir. J. 2021, 1, 2004229. [Google Scholar] [CrossRef] [PubMed]
- Badlam, J.B.; Badesch, D.B.; Austin, E.D.; Benza, R.L.; Chung, W.K.; Farber, H.W.; Feldkircher, K.; Frost, A.E.; Poms, A.D.; Lutz, K.A.; et al. United States Pulmonary Hypertension Scientific Registry: Baseline Characteristics. Chest 2021, 1, 311–327. [Google Scholar] [CrossRef] [PubMed]
- Southgate, L.; Machado, R.D.; Gräf, S.; Morrell, N.W. Molecular genetic framework underlying pulmonary arterial hypertension. Nat. Rev. Cardiol. 2020, 17, 85–95. [Google Scholar] [CrossRef] [PubMed]
- Condon, D.F.; Nickel, N.P.; Anderson, R.; Mirza, S.; de Jesus Perez, V.A. The 6th world symposium on pulmonary hypertension: What’s old is new. F1000Research 2019, 8, 888. [Google Scholar] [CrossRef] [PubMed]
- Galiè, N.; McLaughlin, V.V.; Rubin, L.J.; Simonneau, G. An overview of the 6th World Symposium on Pulmonary Hypertension. Eur. Respir. J. 2019, 1, 1802148. [Google Scholar] [CrossRef]
- Prins, K.W.; Thenappan, T. World Health Organization Group I Pulmonary Hypertension: Epidemiology and Pathophysiology. Cardiol. Clin. 2016, 34, 363–374. [Google Scholar] [CrossRef] [PubMed]
- Andruska, A.; Spiekerkoetter, E. Consequences of BMPR2 deficiency in the pulmonary vasculature and beyond: Contributions to pulmonary arterial hypertension. Int. J. Mol. Sci. 2018, 9, 2499. [Google Scholar] [CrossRef] [PubMed]
- Jang, A.Y.; Kim, B.G.; Kwon, S.; Seo, J.; Kim, H.K.; Chang, H.J.; Chang, S.A.; Cho, G.Y.; Rhee, S.J.; Jung, H.O.; et al. Prevalence and clinical features of bone morphogenetic protein receptor type 2 mutation in Korean idiopathic pulmonary arterial hypertension patients: The PILGRIM explorative cohort. PLoS ONE 2020, 15, e0238698. [Google Scholar] [CrossRef] [PubMed]
- Morisaki, H.; Nakanishi, N.; Kyotani, S.; Takashima, A.; Tomoike, H.; Morisaki, T. BMPR2 mutations found in Japanese patients with familial and sporadic primary pulmonary hypertension. Hum. Mutat. 2004, 23, 632. [Google Scholar] [CrossRef] [PubMed]
- Liang, K.W.; Chang, S.K.; Chen, Y.W.; Lin, W.W.; Tsai, W.J.; Wang, K.Y. Whole Exome Sequencing of Patients with Heritable and Idiopathic Pulmonary Arterial Hypertension in Central Taiwan. Front. Cardiovasc. Med. 2022, 9, 911649. [Google Scholar] [CrossRef] [PubMed]
- Pfarr, N.; Szamalek-Hoegel, J.; Fischer, C.; Hinderhofer, K.; Nagel, C.; Ehlken, N.; Tiede, H.; Olschewski, H.; Reichenberger, F.; Ghofrani, A.H.; et al. Hemodynamic and clinical onset in patients with hereditary pulmonary arterial hypertension and BMPR2 mutations. Respir. Res. 2011, 12, 99. [Google Scholar] [CrossRef] [PubMed]
- Austin, E.D.; Phillips, J.A.; Cogan, J.D.; Hamid, R.; Yu, C.; Stanton, K.C.; Phillips, C.A.; Wheeler, L.A.; Robbins, I.M.; Newman, J.H.; et al. Truncating and missense BMPR2 mutations differentially affect the severity of heritable pulmonary arterial hypertension. Respir. Res. 2009, 10, 87. [Google Scholar] [CrossRef]
- Wang, M.T.; Weng, K.P.; Chang, S.K.; Huang, W.C.; Chen, L.W. Hemodynamic and Clinical Profiles of Pulmonary Arterial Hypertension Patients with GDF2 and BMPR2 Variants. Int. J. Mol. Sci. 2024, 5, 2734. [Google Scholar] [CrossRef]
- Pousada, G.; Baloira, A.; Vilariño, C.; Cifrian, J.M.; Valverde, D. Novel mutations in BMPR2, ACVRL1 and KCNA5 genes and hemodynamic parameters in patients with pulmonary arterial hypertension. PLoS ONE 2014, 9, e100261. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Kaplan–Meier survival curves according to BMPR2 mutation status. Total patients.
Figure 2.
Kaplan–Meier survival curves according to BMPR2 mutation status among female patients.
Table 1.
Type 2 bone morphogenetic protein receptor primers.
| Gene | Locus | Polymorphism | Primers | 5′-3′ |
|---|---|---|---|---|
| Bone morphogenetic protein receptor type II (BMPR2) | p13 chr 2 | rs1061157 | rs1061157-F | CCGAACTAATTCCAATAAC |
| rs1061157-R | CTCCACTTACTCTGTATAC | |||
| FAM-rs1061157-G | FAM-AGAGCACAGAGGCCTAATTCTC-BHQ1 | |||
| ROX-rs1061157-A | ROX-AGAAGAGCACAGAGACCTAATTCTC-BHQ2 | |||
| BMPR2 | P2 chr 37 | rs2228545 | rs2228545-F | CTGCATTGATTGTATTCATC |
| rs2228545-R | TTCCCAAGAGACCTACTA | |||
| FAM-rs2228545-C | FAM-AAGTTTGATTTGTGCTTGCTGCC-BHQ1 | |||
| ROX-rs2228545-T | ROX-CAAGTTTGATTTGTGCTTGTTGCCA-BHQ2 | |||
| BMPR2 | P2 chr 38 | rs17199249 | rs17199249-F | CCACGTTTTGTGTTTTATTG |
| rs17199249-R | GGCAAGAGAACTAAGTGA | |||
| FAM-rs17199249-T | FAM-CCCTTTTCTTTATTCAGCCCCTTA-BHQ1 | |||
| ROX-rs17199249-G | ROX-CCCTTTTCTTGATTCAGCCCCTT-BHQ2 | |||
| BMPR2 | P2 chr 38 | rs113305949 | rs113305949-F | TGACCTAAAACACTGTGA |
| rs113305949-R | GTTGCTCACATATCAAAGA | |||
| FAM-rs113305949-C | FAM-CATGCCAAGTCCCTATGAAGGAA-BHQ1 | |||
| ROX-rs113305949-A | ROX-CATGCCAAGTACCTATGAAGGAA-BHQ2 |
Table 2.
Distribution of BMPR2 genotypes and alleles in IPAH and non-PAH groups.
| BMPR2 | Group | Genotype | Allele | MAF (Global1000G) | x2 | HWE p | ||
|---|---|---|---|---|---|---|---|---|
| G/G | G/A | A/A | ||||||
| rs1061157 (G > A) | IPAH (n = 51) | 34 (63.8%) | 10 (21.3%) | 7 (14.9%) | G = 83 (81.37%), A = 19 (18.63%), MAF—0.2353 | A = 0.11269/20,267 | 0.044 | 0.834 |
| Non-IPAH (n = 117) | 64 (54.7%) | 35 (29.9%) | 18 (15.4%) | |||||
| G/G | G/A | A/A | ||||||
| rs2228545 (G > A | IPAH (n = 52) | 3 (5.8%) | 30 (57.7%) | 19 (36.5%) | G = 51 (49.04%), A = 53(50.96%), MAF—0.6538 | A = 0.033121/8480 | 12.517 | <0.001 |
| Non-IPAH (n = 125) | 7 | 102 | 16 | |||||
| T/T | T/G | G/G | ||||||
| rs17199249 | IPAH (n = 53) | 30 (54.0%) | 15 (30.0%) | 8 (16.0%) | T = 75 (70.75%), G = 31 (29.24%), MAF—0.2925 | G = 0.125136/38,507 | 0.001 | 0.975 |
| Non-IPAH (n = 125) | 77 (61.6%) | 29 (23.2%) | 19 (15.2%) | |||||
| C/C | C/A | A/A | ||||||
| rs113305949 | IPAH (n = 51) | 39 (76.5%) | 10 (19.6%) | 2 (3.9%) | C = 88 (86.27), A = 14 (13.73) MAF—0.1375 | A = 0.027411/846 | 0.002 | 0.962 |
| Non-IPAH (n = 124) | 97 (78.2%) | 22 (17.7%) | 5 (4.1%) | |||||
Note: Values are shown as number (n) and %. MAF—minor allele frequency. HWE—the Hardy–Weinberg equilibrium.
Table 3.
Clinical characteristics of the study participants at the time of diagnosis.
| Variable | All Patients (n = 53) | Patients with BMPR2 Mutation (n = 17) | Patients Without BMPR2 Mutation (n = 36) | p-Value |
|---|---|---|---|---|
| Age, years | 45.0 (35.0–51.0) | 46.0 (39.0–51.5) | 44.0 (35.0–50.8) | 0.333 |
| Sex | ||||
| Female | 46 (86.8%) | 14 (82.4%) | 32 (88.9%) | 0.040 * |
| Male | 7 (13.2%) | 3 (17.6%) | 4 (11.1%) | |
| Age at diagnosis IPAH, years | 40.0 (32.0–48.0) | 42.0 (35.5–49.5) | 40.0 (28.5–45.0) | 0.221 |
| Family history of PAH | ||||
| Yes | 47 (88.6%) | 15 (100.0%) | 32 (84.2%) | 0.263 |
| No | 3 (5.7%) | 0 (0.0%) | 3 (7.9%) | |
| Unknown | 3 (5.7%) | 0 (0.0%) | 3 (7.9%) | |
| 6 MWD (6 min walk distance), m | 328.26 (64.32) | 333.53 (53.27) | 326.18 (68.74) | 0.712 |
| NYHA | ||||
| I | 4 (7.6%) | 1 (6.7%) | 3 (7.9%) | 0.922 |
| II | 19 (35.8%) | 6 (40.0%) | 13 (34.2%) | |
| III | 30 (56.6%) | 8 (53.3%) | 22 (57.9%) | |
| sPO2, % | 95.0 (93.0–97.0) | 95.0 (93.5–97.0) | 95.0 (92.3–96.0) | 0.564 |
| Echocardiography | ||||
| LVEF, % | 58.7 (57.0–63.0) | 57.1 (56.0–58.2) | 60.4 (57.8–64.0) | 0.017 * |
| Pulmonary artery systolic pressure (PASP), mmHg | 78.0 (66.0–90.0) | 80.0 (63.5–92.0) | 77.5 (66.0–89.5) | 0.969 |
| Early diastolic pulmonary regurgitation velocity, m/s | 2.0 (1.9–2.7) | 2.0 (1.9–2.4) | 2.0 (1.8–2.8) | 0.968 |
| Fractional area contraction RV, (FAC), % | 33.0 (30.0–35.0) | 34.0 (31.5–35.5) | 33.0 (29.3–34.0) | 0.239 |
| Tricuspid annulus plane excursion (TAPSE), mm | 1.7 (1.6–1.9) | 1.7 (1.6–1.8) | 1.7 (1.6–1.9) | 0.765 |
| Right atrium area (end-systole), cm2 | 20.0 (17.0–26.0) | 19.0 (18.0–25.5) | 21.0 (17.0–26.0) | 0.968 |
| Pulmonary artery diameter, cm | 2.8 (2.3–3.1) | 2.6 (2.4–2.9) | 2.8 (2.3–3.3) | 0.313 |
| Pleural effusion | ||||
| Yes | 42 (79.2%) | 14 (93.3%) | 28 (73.7%) | 0.122 |
| No | 11 (20.8%) | 1 (6.7%) | 10 (26.3%) | |
| Hemodynamic at diagnosis | ||||
| mRAP, mmHg | 5.0 (4.0–6.0) | 5.0 (4.0–6.0) | 5.0 (4.0–6.0) | 0.703 |
| mPAP, mmHg | 44.0 (36.0–52.0) | 40.0 (37.0–51.0) | 44.0 (36.3–51.3) | 0.642 |
| Fick CI, L/min per m2 | 2.3 (1.9–2.7) | 2.2 (1.9–2.6) | 2.6 (2.3–3.1) | 0.027 * |
| PVR, WU | 8.9 (6.0–13.6) | 10.8 (8.7–14.9) | 8.6 (5.9–12.6) | 0.038 * |
| PVR I | 15.0 (9.6–22.1) | 16.2 (9.8–25.7) | 13.9 (9.7–21.1) | 0.413 |
| SVR I | 31.8 (25.6–36.4) | 29.7 (26.0–34.6) | 32.7 (24.2–36.6) | 0.867 |
| SvO2, % | 67.3 (62.5–69.3) | 66.3 (60.9–68.0) | 67.5 (63.0–70.2) | 0.291 |
| Vasodilator responder | ||||
| Positive | 27 (50.9%) | 9 (60.0%) | 18 (47.4%) | 0.176 |
| Negative | 6 (11.3%) | 3 (20.0%) | 3 (7.9%) | |
| Not performed | 20 (37.8%) | 3 (20.0%) | 17 (44.7%) | |
| Laboratories | ||||
| NT–proBNP, pg/mL | 670.0 (258.0–1214.0) | 670.0 (282.2–1031.0) | 665.5 (237.0–1341.3) | 0.992 |
Note: Results are presented as M (SD), Mdn (IQR), and n (%). * p < 0.05.
Table 4.
Bivariate association between BMPR2 mRNA and patients’ hemodynamic characteristics.
| mRAP (mmHg) | mPAP (mmHg) | Fick CI (L/min per m2) | PVR (WU) | SVR (I) | |
|---|---|---|---|---|---|
| rs1061157 | |||||
| Mutation | 4.0 (2.0; 5.0) | 43.14 (15.67) | 2.50 (2.30; 2.90) | 9,40 (5.20; 13.95) | 30.29 (8.28) |
| No mutation | 5.0 (4.0; 6.0) | 44.54 (11.54) | 2.20 (1.90; 2.68) | 8,85 (6.25; 13.01) | 31.41 (8.31) |
| p | 0.58 | 0.770 | 0.137 | 0.793 | 0.741 |
| rs17199249 | |||||
| Mutation | 4.50 (3.75; 5.25) | 38.25 (8.57) | 2.58 (0.78) | 5.90 (4.93; 9.33) | 31.43 (8.79) |
| No mutation | 5.0 (4.0; 6.0) | 45.55 (11.99) | 2.34 (0.53) | 10.04 (7.25; 14.3) | 31.60 (7.93) |
| p | 0.470 | 0.107 | 0.277 | 0.035 | 0.956 |
| rs113305949 | |||||
| Mutation | 5.0 (4.0; 6.0) | 46.0 (2.83) | 2.30 (2.05; 2.55) | 6.60 (6.0; 7.20) | 24.70 (19.65; 29.75) |
| No mutation | 4.0 (4.0; 4.0) | 44.36 (11.99) | 2.30 (1.90; 2.68) | 9.25 (6.25; 13.80) | 32.15 (25.95; 36.64) |
| p | 0.440 | 0.849 | 0.853 | 0.478 | 0.437 |
Note: Results are presented as M (SD) for symmetrical continuous data, Mdn (P25; P75) for non-symmetrical continuous data, and n (%) for categorical data.
Table 5.
Hazard ratios of mortality associated with BMPR2 mutation in total, female, and male patients.
Table 5.
Hazard ratios of mortality associated with BMPR2 mutation in total, female, and male patients.
| BMPR2 Mutation | p-Value | ||
|---|---|---|---|
| Carrier | Non-Carrier | ||
| Total | |||
| n | 17 | 36 | 0.022 |
| Deaths, n (%) | 12 (70.6%) | 8 (22.2%) | |
| HR (95%CI) | 2.869 (1.165–7.065) | REF | |
| Female patients | |||
| n | 14 | 32 | 0.019 |
| Deaths (n, %) | 11 (78.6%) | 7 (21.9%) | |
| HR (95%CI) | 3.142 (1.212–8.143) | REF | |
| Male patients | |||
| n | 3 | 4 | 0.806 |
| Deaths (n, %) | 1 (33.3%) | 1 (25%) | |
| HR (95%CI) | 1.414 (0.088–22.64) | REF | |
Note: HR—hazard ratio; 95%CI—95% confidence interval.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Taizhanova, D.; Nurpissova, T.; Abildinova, G.; Martynyuk, T.; Kulmyrzayeva, N.; Zholdybayeva, E. Hemodynamic and Genetic Associations with the Risk of Idiopathic Pulmonary Arterial Hypertension Development in an Ethnic Cohort of Kazakhs. Diagnostics 2024, 14, 2687. https://doi.org/10.3390/diagnostics14232687
AMA Style
Taizhanova D, Nurpissova T, Abildinova G, Martynyuk T, Kulmyrzayeva N, Zholdybayeva E. Hemodynamic and Genetic Associations with the Risk of Idiopathic Pulmonary Arterial Hypertension Development in an Ethnic Cohort of Kazakhs. Diagnostics. 2024; 14(23):2687. https://doi.org/10.3390/diagnostics14232687
Chicago/Turabian StyleTaizhanova, Dana, Togzhan Nurpissova, Gulshara Abildinova, Tamilla Martynyuk, Nazgul Kulmyrzayeva, and Elena Zholdybayeva. 2024. "Hemodynamic and Genetic Associations with the Risk of Idiopathic Pulmonary Arterial Hypertension Development in an Ethnic Cohort of Kazakhs" Diagnostics 14, no. 23: 2687. https://doi.org/10.3390/diagnostics14232687
APA StyleTaizhanova, D., Nurpissova, T., Abildinova, G., Martynyuk, T., Kulmyrzayeva, N., & Zholdybayeva, E. (2024). Hemodynamic and Genetic Associations with the Risk of Idiopathic Pulmonary Arterial Hypertension Development in an Ethnic Cohort of Kazakhs. Diagnostics, 14(23), 2687. https://doi.org/10.3390/diagnostics14232687
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
