Design of a Protocol for Soil-Transmitted Helminths (in Light of the Nematode Toxocara canis) DNA Extraction from Feces by Combining Commercially Available Solutions
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Preparation of T. canis Egg Suspension
Measurement of Toxocara canis Egg Concentration by Microscopy
2.3. Obtaining Model Samples of Feces Contaminated with T. canis Eggs
2.4. Comparison of the Effect of Various Destructive Methods on the Integrity of T. canis Eggs and the Efficiency of DNA Extraction
qPCR
2.5. Study of the Influence of Preliminary Washings and Concentration of Helminth Eggs on the Results of PCR
2.5.1. DNA Extraction
- Approximately 500 mg of feces contaminated with Toxocara eggs at a concentration of 1000 eggs/g was added to the sample collection unit of the Apacor Mini Parasep concentrators.
- The samples were mixed and centrifuged following the manufacturer’s instructions for the concentrators (EU Protocol v3.0 September 2017) (“Apacor Mini Parasep SF EU Protocol”, n.d.).
- A total of 1.5 mL of a 0.1% solution of Tween-20 in PBS was added to the sediments, after which the tubes were vortexed until the feces were completely dissolved.
- The tubes were centrifuged for 5 min at 5000× g, after which the supernatant was merged.
- The sediment was resuspended in 800 µL of CD1 buffer from the QIAamp PowerFecal Pro kit and thenvortexed, after which the contents of the concentrator were transferred to clean PowerBead Pro Tubes from the QIAamp PowerFecal Pro kit.
- Further stages of DNA extraction were carried out according to the manufacturer’s instructions for the QIAamp PowerFecal Pro kit (“QIAamp PowerFecal Pro DNA Kit Handbook”, n.d.), starting from step 3 (the stage of sample centrifugation after homogenization).
2.5.2. qPCR Results Data Processing
2.6. Statistical Data Analysis
3. Results
3.1. Comparison of Methods for Destroying T. canis Eggs Using Microscopy
3.2. Comparison of Various Destructive Methods on the Yield of DNA from T. canis Eggs by PCR
3.3. Effect of Double Prewash on the PCR Results in the Extraction of T. canis DNA from Native Feces
3.4. Influence of Preconcentration of Helminth Eggs on PCR Results in Isolation of T. canis DNA from Native Feces
3.5. Evaluation of the Minimum Detectable Number of Eggs of Toxocara canis in Native Feces by Real-Time PCR Using the Designed Protocol for the Isolation of STHs DNA from Feces
4. Discussion
- Unscrew the lid from the sample collection unit of the Apacor Mini Parasep Concentrator (do not discard the lid!), and add approximately 500 mg of fecal sample (1 spoonful) into the compartment using the spoon at the end of the filter.
- Follow the “Emulsification” and “Centrifugation” sections of the instructions for the Apacor Mini Parasep concentrator kit.
- Gently open the device and discard the top chamber of the concentrator along with the filter.
- Discard the supernatant, add 1.5 mL of a 0.1% solution of Tween-20 in PBS to the sediment, and then close the tube with the lid from the sample collection compartment and resuspend the sediment.
- Centrifuge the tubes for 5 min at 5000× g and discard the supernatant.
- Add 800 µL of CD1 buffer from the QIAamp PowerFecal Pro kit to the sediment and resuspend the sediment on a vortex.
- Transfer the resulting suspension to a clean PowerBead Pro Tube from the QIAamp PowerFecal Pro kit.
- Homogenize the samples on the bead beating homogenizer at maximum speed for 30 min.
- Follow the instructions for the QIAamp PowerFecal Pro kit starting at step 3.
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- de Silva, N.R.; Brooker, S.; Hotez, P.J.; Montresor, A.; Engels, D.; Savioli, L. Soil-Transmitted Helminth Infections: Updating the Global Picture. Trends Parasitol. 2003, 19, 547–551. [Google Scholar] [CrossRef] [PubMed]
- Pullan, R.L.; Smith, J.L.; Jasrasaria, R.; Brooker, S.J. Global Numbers of Infection and Disease Burden of Soil Transmitted Helminth Infections in 2010. Parasit. Vectors 2014, 7, 37. [Google Scholar] [CrossRef] [Green Version]
- Nokes, C.; Grantham-McGregor, S.M.; Sawyer, A.W.; Cooper, E.S.; Robinson, B.A.; Bundy, D.A. Moderate to Heavy Infections of Trichuris trichiura Affect Cognitive Function in Jamaican School Children. Parasitology 1992, 104 Pt 3, 539–547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Savioli, L.; Bundy, D.; Tomkins, A. Intestinal Parasitic Infections: A Soluble Public Health Problem. Trans. R. Soc. Trop. Med. Hyg. 1992, 86, 353–354. [Google Scholar] [CrossRef] [Green Version]
- Cools, P.; Vlaminck, J.; Albonico, M.; Ame, S.; Ayana, M.; José Antonio, B.P.; Cringoli, G.; Dana, D.; Keiser, J.; Maurelli, M.P.; et al. Diagnostic Performance of a Single and Duplicate Kato-Katz, Mini-FLOTAC, FECPAKG2 and QPCR for the Detection and Quantification of Soil-Transmitted Helminths in Three Endemic Countries. PLoS Negl. Trop. Dis. 2019, 13, e0007446. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Endris, M.; Tekeste, Z.; Lemma, W.; Kassu, A. Comparison of the Kato-Katz, Wet Mount, and Formol-Ether Concentration Diagnostic Techniques for Intestinal Helminth Infections in Ethiopia. ISRN Parasitol. 2013, 2013, 180439. [Google Scholar] [CrossRef] [Green Version]
- Mengist, H.M.; Demeke, G.; Zewdie, O.; Belew, A. Diagnostic Performance of Direct Wet Mount Microscopy in Detecting Intestinal Helminths among Pregnant Women Attending Ante-Natal Care (ANC) in East Wollega, Oromia, Ethiopia. BMC Res. Notes 2018, 11, 276. [Google Scholar] [CrossRef] [Green Version]
- Calderaro, A.; Montecchini, S.; Rossi, S.; Gorrini, C.; De Conto, F.; Medici, M.C.; Chezzi, C.; Arcangeletti, M.C. Intestinal Parasitoses in a Tertiary-Care Hospital Located in a Non-Endemic Setting during 2006–2010. BMC Infect. Dis. 2014, 14, 264. [Google Scholar] [CrossRef] [Green Version]
- Benjamin-Chung, J.; Pilotte, N.; Ercumen, A.; Grant, J.R.; Maasch, J.R.M.A.; Gonzalez, A.M.; Ester, A.C.; Arnold, B.F.; Rahman, M.; Haque, R.; et al. Comparison of Multi-Parallel QPCR and Double-Slide Kato-Katz for Detection of Soil-Transmitted Helminth Infection among Children in Rural Bangladesh. PLoS Negl. Trop. Dis. 2020, 14, e0008087. [Google Scholar] [CrossRef]
- Liu, C.; Lu, L.; Zhang, L.; Bai, Y.; Medina, A.; Rozelle, S.; Smith, D.S.; Zhou, C.; Zang, W. More Poop, More Precision: Improving Epidemiologic Surveillance of Soil-Transmitted Helminths with Multiple Fecal Sampling Using the Kato–Katz Technique. Am. J. Trop. Med. Hyg. 2017, 97, 870–875. [Google Scholar] [CrossRef]
- Bärenbold, O.; Raso, G.; Coulibaly, J.T.; N’Goran, E.K.; Utzinger, J.; Vounatsou, P. Estimating Sensitivity of the Kato-Katz Technique for the Diagnosis of Schistosoma mansoni and Hookworm in Relation to Infection Intensity. PLoS Negl. Trop. Dis. 2017, 11, e0005953. [Google Scholar] [CrossRef]
- O’Connell, E.M.; Nutman, T.B. Molecular Diagnostics for Soil-Transmitted Helminths. Am. J. Trop. Med. Hyg. 2016, 95, 508–513. [Google Scholar] [CrossRef] [PubMed]
- Knopp, S.; Salim, N.; Schindler, T.; Karagiannis Voules, D.A.; Rothen, J.; Lweno, O.; Mohammed, A.S.; Singo, R.; Benninghoff, M.; Nsojo, A.A.; et al. Diagnostic Accuracy of Kato–Katz, FLOTAC, Baermann, and PCR Methods for the Detection of Light-Intensity Hookworm and Strongyloides stercoralis Infections in Tanzania. Am. J. Trop. Med. Hyg. 2014, 90, 535–545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diawara, A.; Drake, L.J.; Suswillo, R.R.; Kihara, J.; Bundy, D.A.P.; Scott, M.E.; Halpenny, C.; Stothard, J.R.; Prichard, R.K. Assays to Detect β-Tubulin Codon 200 Polymorphism in Trichuris trichiura and Ascaris lumbricoides. PLoS Negl. Trop. Dis. 2009, 3, e397. [Google Scholar] [CrossRef] [Green Version]
- Al-Soud, W.A.; Ouis, I.-S.; Li, D.-Q.; Ljungh, S.; Wadström, T. Characterization of the PCR Inhibitory Effect of Bile to Optimize Real-Time PCR Detection of Helicobacter Species. FEMS Immunol. Med. Microbiol. 2005, 44, 177–182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Repetto, S.A.; Alba Soto, C.D.; Cazorla, S.I.; Tayeldin, M.L.; Cuello, S.; Lasala, M.B.; Tekiel, V.S.; González Cappa, S.M. An Improved DNA Isolation Technique for PCR Detection of Strongyloides stercoralis in Stool Samples. Acta Trop. 2013, 126, 110–114. [Google Scholar] [CrossRef]
- Sharifdini, M.; Mirhendi, H.; Ashrafi, K.; Hosseini, M.; Mohebali, M.; Khodadadi, H.; Kia, E.B. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples. Am. J. Trop. Med. Hyg. 2015, 93, 1285–1291. [Google Scholar] [CrossRef]
- Leles, D.; Araújo, A.; Vicente, A.C.P.; Iñiguez, A.M. Molecular Diagnosis of Ascariasis from Human Feces and Description of a New Ascaris Sp. Genotype in Brazil. Vet. Parasitol. 2009, 163, 167–170. [Google Scholar] [CrossRef]
- Sultana, Y.; Jeoffreys, N.; Watts, M.R.; Gilbert, G.L.; Lee, R. Real-Time Polymerase Chain Reaction for Detection of Strongyloides stercoralis in Stool. Am. J. Trop. Med. Hyg. 2013, 88, 1048–1051. [Google Scholar] [CrossRef] [Green Version]
- Verweij, J.J.; Stensvold, C.R. Molecular Testing for Clinical Diagnosis and Epidemiological Investigations of Intestinal Parasitic Infections. Clin. Microbiol. Rev. 2014, 27, 371–418. [Google Scholar] [CrossRef] [Green Version]
- Zou, Y.; Zheng, W.-B.; He, J.-J.; Elsheikha, H.M.; Zhu, X.-Q.; Lu, Y.-X. Toxocara canis Differentially Affects Hepatic MicroRNA Expression in Beagle Dogs at Different Stages of Infection. Front. Vet. Sci. 2020, 7, 587273. [Google Scholar] [CrossRef]
- Mkandawire, T.T.; Grencis, R.K.; Berriman, M.; Duque-Correa, M.A. Hatching of Parasitic Nematode Eggs: A Crucial Step Determining Infection. Trends Parasitol. 2022, 38, 174–187. [Google Scholar] [CrossRef] [PubMed]
- Wharton, D. Nematode Egg-Shells. Parasitology 1980, 81, 447–463. [Google Scholar] [CrossRef]
- QIAamp PowerFecal Pro DNA Kit Handbook. Available online: https://www.qiagen.com/us/Resources/ResourceDetail?id=8896817a-253f-4952-b845-0aab796813ce&lang=en (accessed on 31 August 2022).
- NCBI Primer-Blast Primer Designing Tool. Available online: https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 12 September 2022).
- Home—Nucleotide—NCBI. Available online: https://www.ncbi.nlm.nih.gov/nuccore (accessed on 12 September 2022).
- van Pelt-Verkuil, E.; van Belkum, A.; Hays, J.P. Principles and Technical Aspects of PCR Amplification; Springer: Dordrecht, The Netherlands, 2008; ISBN 978-1-4020-6240-7. [Google Scholar]
- Basu, C. PCR Primer Design; Methods in Molecular Biology; Springer: New York, NY, USA, 2015; Volume 1275, ISBN 978-1-4939-2364-9. [Google Scholar]
- The Mfold Web Server. Available online: http://www.unafold.org/mfold/applications/dna-folding-form.php (accessed on 2 August 2022).
- Garcia, L.S. Diagnostic Medical Parasitology, 5th ed.; American Society of Microbiology: Washington, DC, USA, 2007; ISBN 9781555813802. [Google Scholar]
- Mikaeili, F.; Kia, E.B.; Sharbatkhori, M.; Sharifdini, M.; Jalalizand, N.; Heidari, Z.; Zarei, Z.; Stensvold, C.R.; Mirhendi, H. Comparison of Six Simple Methods for Extracting Ribosomal and Mitochondrial DNA from Toxocara and Toxascaris Nematodes. Exp. Parasitol. 2013, 134, 155–159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andersen, L.O.; Röser, D.; Nejsum, P.; Nielsen, H.V.; Stensvold, C.R. Is Supplementary Bead Beating for DNA Extraction from Nematode Eggs by Use of the NucliSENS EasyMag Protocol Necessary? J. Clin. Microbiol. 2013, 51, 1345–1347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- George, S.; Geldhof, P.; Albonico, M.; Ame, S.M.; Bethony, J.M.; Engels, D.; Mekonnen, Z.; Montresor, A.; Hem, S.; Tchuem-Tchuenté, L.-A.; et al. The Molecular Speciation of Soil-Transmitted Helminth Eggs Collected from School Children across Six Endemic Countries. Trans. R. Soc. Trop. Med. Hyg. 2017, 110, 657–663. [Google Scholar] [CrossRef] [Green Version]
- Cunningham, L.J.; Odoom, J.; Pratt, D.; Boatemaa, L.; Asante-Ntim, N.; Attiku, K.; Banahene, B.; Osei-Atweneboana, M.; Verweij, J.J.; Molyneux, D.; et al. Expanding Molecular Diagnostics of Helminthiasis: Piloting Use of the GPLN Platform for Surveillance of Soil Transmitted Helminthiasis and Schistosomiasis in Ghana. PLoS Negl. Trop. Dis. 2018, 12, e0006129. [Google Scholar] [CrossRef]
- Ayana, M.; Cools, P.; Mekonnen, Z.; Biruksew, A.; Dana, D.; Rashwan, N.; Prichard, R.; Vlaminck, J.; Verweij, J.J.; Levecke, B. Comparison of Four DNA Extraction and Three Preservation Protocols for the Molecular Detection and Quantification of Soil-Transmitted Helminths in Stool. PLoS Negl. Trop. Dis. 2019, 13, e0007778. [Google Scholar] [CrossRef] [Green Version]
- Khademvatan, S.; Abdizadeh, R.; Tavalla, M. Molecular Characterization of Toxocara Spp. from Soil of Public Areas in Ahvaz Southwestern Iran. Acta Trop. 2014, 135, 50–54. [Google Scholar] [CrossRef]
- ForensicGEM Sperm Product Overview. Available online: https://microgembio.com/product/forensicgem-sperm-dna-extraction-kit/#s-overview (accessed on 31 August 2022).
- Collender, P.A.; Kirby, A.E.; Addiss, D.G.; Freeman, M.C.; Remais, J. V Methods for Quantification of Soil-Transmitted Helminths in Environmental Media: Current Techniques and Recent Advances. Trends Parasitol. 2015, 31, 625–639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- QIAamp PowerFecal Pro DNA Kits For the Isolation of Microbial DNA from Stool and Gut Samples. Available online: https://www.qiagen.com/us/products/discovery-and-translational-research/dna-rna-purification/dna-purification/genomic-dna/qiaamp-powerfecal-pro-dna-kit/ (accessed on 4 August 2022).
- Callahan, H.; Nieciecki, V.; Deforce, E.; Adams, E.W. Nucleic Acid Isolation and Inhibitor Removal from Complex Samples. U.S. Patent 17/049,742, 17 April 2019. [Google Scholar]
- Maddocks, S.; Jenkins, R. Quantitative PCR. In Understanding PCR; Elsevier: Amsterdam, The Nederlands, 2017; pp. 45–52. [Google Scholar]
- Do the Levels of Relative Fluorescence Units (RFUs) for a QPCR Reaction Have an Impact on My Data?|Bio-Rad. Available online: https://www.bio-rad.com/ru-ru/faq/Do-levels-of-RFUs-fo_1384541547/normalization-of-real-time-pcr-fluorescence-data-with-rox-passive-reference-dye (accessed on 4 August 2022).
- Sidstedt, M.; Rådström, P.; Hedman, J. PCR Inhibition in QPCR, DPCR and MPS—Mechanisms and Solutions. Anal. Bioanal. Chem. 2020, 412, 2009–2023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sidstedt, M.; Jansson, L.; Nilsson, E.; Noppa, L.; Forsman, M.; Rådström, P.; Hedman, J. Humic Substances Cause Fluorescence Inhibition in Real-Time Polymerase Chain Reaction. Anal. Biochem. 2015, 487, 30–37. [Google Scholar] [CrossRef] [Green Version]
- Mewara, A.; Khurana, S.; Gupta, S.; Munda, V.S.; Singh, S.; Sehgal, R. Diagnostic Performance of Mini Parasep® Solvent-Free Foecal Parasite Concentrator for the Diagnosis of Intestinal Parasitic Infections. Indian J. Med. Microbiol. 2019, 37, 381–386. [Google Scholar] [CrossRef] [PubMed]
- Adugna, S.; Kebede, T.; Mekonnen, Z.; Degarege, A.; Liang, S.; Erko, B. Diagnostic Performance of Mini Parasep® Solvent-Free Faecal Parasite Concentrator Relative to Kato-Katz and McMaster for the Diagnosis of Intestinal Parasitic Infections. Trans. R. Soc. Trop. Med. Hyg. 2017, 111, 572–578. [Google Scholar] [CrossRef]
- Phadungsil, W.; Pumpa, S.; Sirisabhabhorn, K.; Geadkaew-Krenc, A.; Grams, R.; Mungthin, M.; Ruang-Areerate, T.; Adisakwattana, P.; Labbunruang, N.; Martviset, P. Efficiency of the Stool-PCR Test Targeting NADH Dehydrogenase (Nad) Subunits for Detection of Opisthorchis viverrini Eggs. J. Trop. Med. 2021, 2021, 3957545. [Google Scholar] [CrossRef]
- Wang, N.; Wang, Y.; Ye, Q.; Yang, Y.; Wan, J.; Guo, C.; Zhan, J.; Gu, X.; Lai, W.; Xie, Y.; et al. Development of a Direct PCR Assay to Detect Taenia multiceps Eggs Isolated from Dog Feces. Vet. Parasitol. 2018, 251, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Zarlenga, D.S.; Barry Chute, M.; Gasbarre, L.C.; Boyd, P.C. A Multiplex PCR Assay for Differentiating Economically Important Gastrointestinal Nematodes of Cattle. Vet. Parasitol. 2001, 97, 199–209. [Google Scholar] [CrossRef]
- Amoah, I.D.; Singh, G.; Troell, K.; Reddy, P.; Stenström, T.A.; Bux, F. Comparative Assessment of DNA Extraction Procedures for Ascaris Spp. Eggs. J. Helminthol. 2020, 94, e78. [Google Scholar] [CrossRef]
- Coklin, T.; Farber, J.M.; Parrington, L.J.; Kingombe, C.I.B.; Ross, W.H.; Dixon, B.R. Immunomagnetic Separation Significantly Improves the Sensitivity of Polymerase Chain Reaction in Detecting Giavdia duodenalis and Cryptosporidium spp. in Dairy Cattle. J. Vet. Diagnostic Investig. 2011, 23, 260–267. [Google Scholar] [CrossRef] [Green Version]
- Vitošević, K.; Todorović, M.; Varljen, T.; Slović, Ž.; Matić, S.; Todorović, D. Effect of Formalin Fixation on Pcr Amplification of DNA Isolated from Healthy Autopsy Tissues. Acta Histochem. 2018, 120, 780–788. [Google Scholar] [CrossRef]
- Sowemimo, O.A. Prevalence and Intensity of Toxocara canis (Werner, 1782) in Dogs and Its Potential Public Health Significance in Ile-Ife, Nigeria. J. Helminthol. 2007, 81, 433–438. [Google Scholar] [CrossRef] [PubMed]
- Bizhga, B.; Boçar, A.; Shehdula, D.; Shabani, E.; Rugji, J.; Roko, X.; Kosova, R. Toxocara canis in Stray Dogs of Tirana and Related Public Health Risks. Paripex—Indian J. Res. 2014, 3, 105–107. [Google Scholar]
- Montresor, A.; Crompton, D.W.T.; Hall, A.; Bundy, D.A.P.; Savioli, L. Guidelines for the Evaluation of Soil-Transmitted Helminthiasis and Schistosomiasis at Community Level: A Guide for Managers of Control Programmes; World Health Organization: Geneva, Switzerland, 1998. [Google Scholar]
Sample * | Protocols for Assessing Egg Integrity | Protocols for Evaluating the Efficiency of DNA Extraction |
---|---|---|
Susp |
| The study was not carried out |
CD1 |
|
|
Frz-ht |
|
|
Enzs |
|
|
BB |
|
|
Primer/Probe | Sequence (5′–3′) | Length |
---|---|---|
Fwd | TTTGCACGTATGCGTGAGCC | 20 |
Rev | GCCTTTCTAACTTGCCCAGC | 20 |
Probe | FAM-CGTCACCCATTTCCCCTCAACAC-BHQ1 | 23 |
Group * | Protocol |
---|---|
Pure (n = 10) |
|
Fec (n = 10) |
|
W (n = 10) |
|
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Devyatov, A.A.; Davydova, E.E.; Luparev, A.R.; Karseka, S.A.; Shuryaeva, A.K.; Zagainova, A.V.; Shipulin, G.A. Design of a Protocol for Soil-Transmitted Helminths (in Light of the Nematode Toxocara canis) DNA Extraction from Feces by Combining Commercially Available Solutions. Diagnostics 2023, 13, 2156. https://doi.org/10.3390/diagnostics13132156
Devyatov AA, Davydova EE, Luparev AR, Karseka SA, Shuryaeva AK, Zagainova AV, Shipulin GA. Design of a Protocol for Soil-Transmitted Helminths (in Light of the Nematode Toxocara canis) DNA Extraction from Feces by Combining Commercially Available Solutions. Diagnostics. 2023; 13(13):2156. https://doi.org/10.3390/diagnostics13132156
Chicago/Turabian StyleDevyatov, Alexander A., Ekaterina E. Davydova, Andrey R. Luparev, Sofia A. Karseka, Anna K. Shuryaeva, Angelica V. Zagainova, and German A. Shipulin. 2023. "Design of a Protocol for Soil-Transmitted Helminths (in Light of the Nematode Toxocara canis) DNA Extraction from Feces by Combining Commercially Available Solutions" Diagnostics 13, no. 13: 2156. https://doi.org/10.3390/diagnostics13132156
APA StyleDevyatov, A. A., Davydova, E. E., Luparev, A. R., Karseka, S. A., Shuryaeva, A. K., Zagainova, A. V., & Shipulin, G. A. (2023). Design of a Protocol for Soil-Transmitted Helminths (in Light of the Nematode Toxocara canis) DNA Extraction from Feces by Combining Commercially Available Solutions. Diagnostics, 13(13), 2156. https://doi.org/10.3390/diagnostics13132156