Next Article in Journal
Human Fall Detection Using 3D Multi-Stream Convolutional Neural Networks with Fusion
Next Article in Special Issue
Wear Management of Colored Foils for the Assessment of Sleep Bruxism Patterns—A Prospective, Randomized Crossover Study
Previous Article in Journal
Maternal Copy Number Imbalances in Non-Invasive Prenatal Testing: Do They Matter?
Previous Article in Special Issue
Complete Pseudo-Anodontia in an Adult Woman with Pseudo-Hypoparathyroidism Type 1a: A New Additional Nonclassical Feature?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diagnostics
Volume 12
Issue 12
10.3390/diagnostics12123058
diagnostics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Six microRNAs as Potential Biomarkers for Pemphigus Vulgaris: From Diagnosis to Pathogenesis

by
Wenxiu He
1,
Yixiao Xing
1,2,
Chunlei Li
1,
Peiru Zhou
1,
Xiaosheng Hu
1,
Hong Hua
1,* and
Pan Wei
1,*
1
Department of Oral Medicine, Peking University School and Hospital of Stomatology & National Center of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology & Research Center of Engineering and Technology for Computerized Dentistry Ministry of Health & NMPA Key Laboratory for Dental Materials, Beijing 100081, China
2
Department of Stomatology, Zhongshan Hospital, Fudan University, Shanghai 200032, China
*
Authors to whom correspondence should be addressed.
Diagnostics 2022, 12(12), 3058; https://doi.org/10.3390/diagnostics12123058
Submission received: 4 November 2022 / Revised: 21 November 2022 / Accepted: 2 December 2022 / Published: 6 December 2022
(This article belongs to the Special Issue Diagnosis of Dental Diseases)
Browse Figures
Versions Notes

Abstract

:
Background: Pemphigus vulgaris (PV) is a potentially fatal autoimmune bullous disease. The role of microRNA (miRNA, miR) in the diagnosis and pathogenesis of PV remains unknown. This study aims to provide potential miRNA biomarkers for PV diagnosis and therapy options. Methods: Serum samples were obtained from 22 PV patients, 15 mucous membrane pemphigoid (MMP) patients, and 10 normal controls (NC). Total RNA was extracted from the serum samples, and 12 selected miRNAs were detected by quantitative real-time polymerase chain reaction (qRT-PCR). Bioinformatic analyses including target gene prediction and enrichment analysis were performed. Results: Twelve miRNAs were increased in the serum of the PV group compared with the NC group, in which six miRNAs had good efficacy to diagnose PV from MMP with the area under the receiver operator characteristic curves of 0.970 to 0.988. A series test for the combination of miR-584-5p and miR-155-5p reached the sensitivity and specificity of 95.5% and 100%. Bioinformatic analysis revealed target gene enrichment in the cell adhesion pathways, immune-relating pathways, and P38 mitogen-activated protein kinases signaling pathway. Conclusion: The study provides new insights and targets of miRNAs for the precise diagnosis and the exploration of pathogenesis for PV, which may serve as a reference for further research into autoimmune bullous diseases.

1. Introduction

Pemphigus are potentially life-threatening autoimmune bullous disorders, in which pemphigus vulgaris (PV) accounts for up to 65% [1]. The prevalence for PV varies from 52 to 95 per million individuals according to ethnicity and regions, and there is a female predominance, with a male-to-female ratio of 1:1.7 to 1:1.1 [2,3]. The pathogenesis of PV is that autoantibodies mainly disrupt desmoglein (Dsg) 3 and Dsg1, leading to the loss of cell adhesion and inducing acantholysis [4]. First-line treatment including corticosteroids and anti-CD20 antibody rituximab have achieved good therapeutic effects for PV [5,6]. However, some adverse effects are associated with the process of long-term therapy, such as Cushing syndrome, infections, and acute infusion reactions, which may even lead to death in severe cases [7,8]. Therefore, it is essential to investigate the biomarkers for concise diagnosis and potential underlying therapeutic targets for a more precise treatment strategy for PV.
MicroRNAs (miRNAs) are single stranded endogenous noncoding RNAs with the length of about 22 nucleotides and serve as the potential regulator of more than 60% coding genes [9]. In the human genome, there are 2654 mature miRNAs according to the miRNA databases miRBase 22.1. MiRNAs bind to the target messenger RNAs (mRNAs) to induce mRNAs’ degradation or translational suppression and subsequently regulate various biological processes and pathways including apoptosis, cell differentiation, intercellular communication, and immune homeostasis [10]. In autoimmune diseases, miRNA dysregulation plays a significant role in disease development. MiRNAs participate in the autoimmune pathogenesis through promoting T cell autoreactivity, activating inflammatory pathways and cytokine production, regulating the activation of autoreactive B cells, and inducing cell apoptosis [11,12]. For rheumatoid arthritis (RA), serum expression levels of miR-194, miR-210, and miR-432-5p have significant differences between the active patients and those in remission. In addition, serum miR-432-5p level is much higher in the RA patients relapsed and the serum level of miR-155 expression is associated with the disease activity of RA. The miRNAs in RA have provided some new biomarkers for the diagnosis and monitoring options of autoimmune diseases [13]. Some studies have revealed miRNAs’ expression profiles in autoimmune blistering diseases. For example, miR-424-5p is overexpressed in the peripheral blood mononuclear cells of pemphigus patients; miR-99, miR-125b, and miR-181 are increased in the keratinocytes of Hailey–Hailey disease (HHD) lesions; some miRNAs, including miR-27a-5p, miR-223, miR-379, miR-423-5p, and miR-1291, are significantly altered in pemphigoid diseased [14]. However, the studies have mainly focused on pemphigus foliaceus, paraneoplastic pemphigus, HHD or pemphigoid diseases, and there are some knowledge gaps regarding miRNAs in PV, especially in the mucosal-dominant variant.
Therefore, this study was designed to provide potential biomarkers to assist PV diagnosis, to investigate the biological significance of miRNAs, and to provide pathogenesis insights for PV.

2. Materials and Methods

2.1. Study Design and Ethics

This study was designed based on the Standards for Reporting Diagnostic Accuracy (STARD) statement [15]. Ethical approval for this study was obtained from the Ethics Committee of the Peking University School of Stomatology (PKUSSIRB-202162030). All participants provided informed consent before they participated in this study.

2.2. Diagnostic Criteria

PV was diagnosed by the Japanese guidelines (2014) based on the clinical features, histopathological presentations, and serologic tests of an enzyme-linked immunosorbent assay (ELISA) or indirect immunofluorescence [1]. Mucous membrane pemphigoid (MMP) was diagnosed based on the histopathological features and positive results of BP180/BP230 by the ELISA tests [16].

2.3. Inclusion and Exclusion Criteria

Adult patients (aged 18–75 years) who met the above diagnostic criteria were included in the group of PV or MMP, as determined by experts in oral medicine. Normal controls (NC) were adults without systemic diseases or medication history. Participants were excluded if (A) they had history of topical/systemic use of corticosteroids or immunosuppressors; (B) they were pregnant or lactating females; or (C) they could not cooperate for any reason. According to the inclusion and exclusion criteria, serum samples were collected from 10, 15, and 22 normal controls, confirmed MMP patients, and confirmed PV patients, respectively, from April 2018 to January 2022.

2.4. Serum Sample Collection and Processing

Peripheral blood samples from PV and MMP patients and the NC group were obtained by venipuncture and were immediately processed by centrifugation at 1000× g for 5 min at 4 °C. The collected serum samples were transported to the laboratory and stored at −80 °C until use.

2.5. RNA Extraction, Reverse Transcription, and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

We extracted total RNA from serum samples using the miRNeasy Serum/Plasma Kit (Qiagen, Germany) according to the manufacturer′s instructions. RNA yield was determined with a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA), and integrity was determined using agarose gel electrophoresis with ethidium bromide staining.
There was a total volume of 10 μL for each reverse transcription (RT) reaction, consisting of 0.5 μg RNA, 5 μL of 2 × TS miRNA Reaction Mix, and 0.5 μL of TransScrip miRNA RT Enzyme Mix. We carried out the reactions in GeneAmp PCR System 9700 (Applied Biosystems, Carlsbad, CA, USA) at 37 °C for 60 min, followed by RT heat inactivation at 85 °C for 5 s. At −20 °C, 10 μL of the RT reaction mix was diluted 10 times in nuclease-free water. LightCycler 480 II (Roche, Swiss) was used for real-time PCR.
The real-time PCR Instrument (Roche, Swiss) consisted of the 10 μL PCR reaction mixture, including 5 μL of 2 × PerfectStartTM Green qPCR SuperMix, 1 μL of cDNA, 0.2 μL of universal primer, 0.2 μL of miRNA-specific primer, and 3.6 μL of nuclease-free water. In a 384-well optical plate (Roche, Swiss), reactions were incubated for 30 s at 94 °C, then by 45 cycles for 5 s at 94 °C and for 30 s at 60 °C. Analyses were performed on each sample in triplicate. For the validation of the specific generation of the expected PCR product, melting curve analysis was performed after each PCR cycle. The miRNA-specific primer sequences were designed and synthesized by TsingKe Biotech (Beijing, China) (Table 1). The expression levels of miRNAs were normalized to 5S rRNA and were calculated using the 2−ΔΔCt method [17].

2.6. Target Gene Enrichment Analysis

The target genes of miRNAs were obtained from four databases including miRDB, miRTarBase, miRWalk, and TargetScan. MiRNA–target mRNA networks and miRNA–target mRNA–pathway networks were conducted using Cytoscape 3.7.1 software (Washington, DC, USA). Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were performed using the GO database and KEGG database [18,19]. The target gene network was mapped using Metascape database [20].

2.7. Statistical Analysis

Statistics were analyzed by the Wilcoxon test or t test for two independent samples and by one-way ANOVA for more than two samples using SPSS 20.0 software (Chicago, IL, USA). Diagnostic parameters, receiver operating characteristic (ROC) curves, and area under the ROC curve (AUC) were performed using SPSS 20.0. p < 0.05 was considered statistically significant.

3. Results

3.1. Demographic and Clinical Characteristics

The demographic and clinical information of the PV group (n = 22), MMP group (n = 15), and NC group (n = 10) were recorded and analyzed, as shown in Table 2. There were no statistically significant differences in sex and age between the three groups (p > 0.05). The 22 patients of the PV group were all mucosal-dominant variant; the mean titers of the Dsg3 and Dsg1 autoantibodies were 148.39 U/mL and 40.29 U/mL, respectively. The Pemphigus Disease Area Index (PDAI) score of the 22 PV patients varied from 1 to 21 points, in which 7 patients had the mild type, and 15 patients had the moderate type. The grading criteria of PDAI were: mild (0–8), moderate (9–24), and severe (≥25) [21].

3.2. MiRNAs Expression Profiles

Twelve miRNAs (miR-125b-5p, miR-146a-5p, miR-148a-3p, miR-150-5p, miR-155-5p, miR-181a-5p, miR-181b-5p, miR-326, miR-338-3p, miR-423-5p, miR-424-5p, and miR-584-5p) were selected based on recent studies about autoimmune diseases and miRNAs [14,22,23]. The 12 miRNAs were detected by qRT-PCR in the PV and NC groups. As illustrated in Figure A1, all 12 miRNAs showed significant upregulation in the PV group (p < 0.001), in which the 6 miRNAs with the highest relative expression (miR-125b-5p, miR-155-5p, miR-181a-5p, miR181b-5p, miR-326, and miR-584-5p) were selected for further investigation by qRT-PCR in the MMP group. The expression levels of the six miRNAs were significantly increased in the PV group compared with the MMP group (p < 0.001) (Figure 1A). In addition, the difference in miR-326 expression between the mild and moderate PV patients was found to be statistically significant (p < 0.05) (Figure 1B).

3.3. Diagnostic Efficacy

For the diagnosis of PV, the sensitivity and specificity of miR-125b-5p, miR-155-5p, miR-181a-5p, miR181b-5p, miR-326, and miR-584-5p were 81.8% to 100% and 86.7% to 100%, respectively. The parameters reflecting the diagnostic efficacies are listed in Table 3. The ROC curves of the six miRNAs (Figure 2A) were close to the upper left corner, and the calculated AUC and cutoff values are shown in Table 3, which indicated the good diagnostic efficacy of the miRNAs. To further improve the diagnostic accuracy, the combining of multiple test series was applied. The series test for the combination of miR-584-5p with miR-155-5p reached a sensitivity and specificity of 95.5% and 100%, respectively; the combination of miR-584-5p with miR181b-5p reached a sensitivity and specificity of 100% and 93.3%, respectively. The ROC curves of the series test are shown in Figure 2B.

3.4. Targets Prediction for miRNAs

Four databases, miRDB, miRTarBase, miRWalk, and TargetScan, were used to predict the target genes of miR-125b-5p, miR-155-5p, miR-181a-5p, miR181b-5p, miR-326, and miR-584-5p, and the intersectant results of several databases were used as the candidate target genes of the miRNAs. When the target genes were not detected by both databases, the prediction results from the miRTarBase were used (Table 4). In total, 3411 candidate target genes of the six miRNAs were obtained using the above four databases. The potential PV-relating target mRNAs found by the screening are shown in the network in Figure A2.

3.5. GO Analysis

GO analysis provided significant enrichments of 235 terms in the molecular function category, 195 terms in the cellular component category, and 2267 terms in the biological process category. Figure A3 shows the top ten terms of each category (p < 0.05). As for the cellular component, the target genes were markedly enriched in the transcription factor complex, the cell–substrate junction, and focal adhesion. The top two enrichments were DNA-binding transcription factor binding and ubiquitin-like protein ligase binding in the molecular function with peptidyl-serine phosphorylation and peptidyl-serine modification in the biological process. In addition, we integrated 133 desmosomes and cell–cell junctions-related target genes of the miRNAs and mapped the enrichment. The results showed the top three enriched terms were the regulation of the cell junction assembly, the cell junction organization, and the regulation of cell adhesion. Circle nodes with different colors in Figure 3A,B represent the various terms and the p values, where size is proportional to the number of input genes that fell under that term. Terms with a similarity score of >0.3 were linked by an edge, and the thickness of the edge represents the similarity scores.

3.6. KEGG Analysis

Enrichment analysis of the KEGG analysis included 132 KEGG pathways (p < 0.05), from which the top 30 terms are shown in Figure A4. In organismal systems, the enriched pathways were the prolactin signaling pathway and the T cell receptor signaling pathway. In the category of environmental information processing, the top three processes of the target genes were the signaling pathways regulating the pluripotency of stem cells, HIF-1 signaling pathways, and cellular senescence. Figure 4 shows the network of the miRNAs–target genes pathways, in which the target mRNAs of the six upregulated miRNAs were remarkably enriched in the pathways relating to the immune system and cell–cell junctions, as well as adhesions, in which the most significant enrichment pathways were the T cell receptor signaling pathway and the p53 signaling pathway.

3.7. Adverse Events

There were no severe adverse events in this study.

4. Discussion

Pemphigus vulgaris is a potentially fatal autoimmune bullous disease. With the availability and wide use of corticosteroids, the mortality rate of PV has decreased greatly; however, the mortality risk of PV patients is 2.4 to 3.3 times higher compared with that of the general population [24,25,26]. Another first-line treatment of PV is the anti-CD20 monoclonal antibody rituximab, which depletes CD20+ B cells and eliminates the immunoglobulin G (IgG) autoantibodies of PV, reaching disease remission effectively [5,27]. Although the target treatment of rituximab has good efficiency for PV, it brings rituximab-related adverse events including acute infusion reactions (12%), infections (10%), and acute pneumonitis (1%), which may lead to death in severe cases [8]. Thus, the accurate diagnosis, precise therapy, and long-term follow-up are of great significance for PV. This study was designed to evaluate the diagnostic values of miRNAs for PV and explore the bioinformatic predictions of the potential pathways of the differentially expressed miRNAs.
In this study, the sensitivity and specificity of the combination of miR-584-5p and miR-155-5p for the series diagnosis reached 95.5% and 100%, respectively, and the combination of miR-584-5p and miR181b-5p reached 100% and 93.3%, respectively; the AUC of the six miRNAs including miR-125b-5p, miR-155-5p, miR-181a-5p, miR181b-5p, miR-326, and miR-584-5p were 0.970 to 0.988, which indicated the high diagnostic values of miRNAs for PV. As one of the most common techniques in the laboratory, measuring the expression of miRNAs using the qRT-PCR method could be considered to serve as a serologic test for PV diagnosis in clinical practice. In addition, 20–22.7% of the confirmed PV patients were negative for anti-Dsg3 or 1 autoantibodies detected by ELISA [28]. Whether the miRNAs can serve as the complementary approach to ELISA for PV diagnosis and as long-term monitoring biomarkers or not both deserve further research in the future. Currently, there are no well-recognized indicators to monitor the disease activity for PV in long-term follow-up. For miR-326, the expression was much higher in the moderate compared to the mild type for PV, which reflected the disease severity. With the limitation of the small sample size of 7 mild and 15 moderate PV patients, miR-326 could be the potential biomarker for clinical long-term monitoring for PV, while its reliability and stability need further validations with large samples.
To explore the miRNAs’ functions in the pathogenesis of PV, the target mRNAs were predicted using the four databases of TargetScan, miRanda, CLIP-seq, and miRDB. For the hundreds of target genes of the six upregulated miRNAs, NOTCH1, SOCS3, and BCL2 may have significant integration with the pathogenesis of PV. NOTCH1 is the shared target mRNA of miR-181a-5p and miR-326 and is a crucial mediator for the homeostasis of keratinocytes, which was found to be suppressed by miR-125b and decreased in Hailey–Hailey disease [29,30]. The decreased level of NOTCH1 was related to the oxidative stress of keratinocytes, which contributed to the disease activity of pemphigus vulgaris [31]. SOCS3 plays an important role in immune homeostasis. A recent study by Lin et al. showed that the decreased expression of SOCS3 in CD4+ T cells exacerbated the disease severity of PV, and the upregulation of SOCS3 achieved disease remission in turn [32]. BCL2 is the potential target of miR-125b-5p, miR-181a-5p, and miR-181b-5p, is essential for maintaining epithelial integrity, and suppresses Th17 cells [33]. Bcl-2 proteins decreased after PV-IgG treatment in vitro, which contributed to cell death and blister formation [33,34]. Therefore, the six high expressed miRNAs may be involved in the pathogenesis and progression of PV by regulating the target genes’ expression profiles.
The bioinformatic analysis showed the target genes of the miRNAs enriched in the pathways of cell adhesion molecules and some extracellular junctions. In addition to the well-recognized autoantigens of the extracellular domain of Dsg 3 and 1, there are other potential autoantigens belonging to desmosomes including Dsg 2 and 4, desmocollins, plakophilin, E-cadherin, and plakoglobin [35,36]. Some studies have reported antigens of the adherens junction components such as α-catenin, suggesting that the early triggering of acantholysis in PV was mediated by non-Dsg autoantibodies, and the pathogenesis of PV was contributed to by Dsg 1/3 and non-Dsg antibodies together [37]. Bioinformatic analysis also indicated the enrichment of immune-relating pathways such as Th1, Th2, and Th17 cell differentiation. The increased reactivity of Th1 and Th2 cells were both detected in PV pathogenesis [38]. Autoreactive Th2 cells were crucial for the production of anti-Dsg3 antibodies in vivo, which contributed to the pathogenic autoantibody secretion of B cells, and were related to the disease activity of PV [39,40]. The level of Th17 cells were detected as increased in both the circulation and PBMCs, as well as the lesions of PV patients [41,42,43,44]. In addition, the inflammatory cytokines of IL-10 and IL-17 associated with Th2 and Th17 cells showed marked elevation in PV serum, which participate in the pathogenesis and activation of PV [45]. T cell subsets play key roles in immune regulations and may induce some future therapeutic options for PV, which agreed with our bioinformatics analysis. P38 mitogen-activated protein kinases (MAPK) signaling, one of the significant enrichment pathways in our bioinformatic results, has been reported to be activated in PV pathogenesis and plays an important role in intercellular adhesion [46,47]. The p38MAPK activation process induced by PV autoantibodies was regulated by keratin filaments, indicating the complicated cell adhesion networks involved in the pathways and disease pathogenesis [46]. Currently, there is no p38MAPK targeted inhibition therapy available for the management of PV; the therapeutic targets of p38MAPK may deserve further investigation and exploration [48,49].
There were several limitations in the present study. Firstly, as an exploratory study, the sample size was small and without follow-up observation. The current results and the values of follow-up biomarkers for the miRNAs need to be confirmed by further studies with larger groups and long-term monitoring. Secondly, further experiments are necessary to confirm the results predicted by the bioinformatics analysis. In conclusion, this study filled the gap about miRNAs in PV diagnosis and pathogenesis. The results provided new insights for precise diagnosis and new targets for the pathogenesis of PV, which may serve as references for the future research of PV and autoimmune bullous diseases.

Author Contributions

Conceptualization, H.H. and P.W.; data curation, Y.X. and W.H.; formal analysis, W.H.; funding acquisition, P.W.; investigation, C.L. and W.H.; methodology, H.H.; project administration, H.H. and P.W.; resources, P.Z.; software, W.H. and X.H.; supervision, P.W.; validation, H.H.; visualization, W.H. and Y.X.; writing—original draft preparation, W.H.; writing—review and editing, H.H. and P.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Program for Multidisciplinary Cooperative Treatment on Major Diseases (PKUSS-NMP-202019).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of the Peking University School of Stomatology on 7th July 2021 (PKUS-SIRB-202162030).

Informed Consent Statement

All individuals included in this section have consented to the acknowledgement.

Data Availability Statement

The data presented in this study are available on request from the corresponding authors.

Acknowledgments

The authors thank all participants for their effort and collaboration.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Diagnostics 12 03058 g0a1 550
Figure A1. Relative expressions of 12 miRNAs in the PV and NC groups. *** p < 0.001.
Figure A1. Relative expressions of 12 miRNAs in the PV and NC groups. *** p < 0.001.
Diagnostics 12 03058 g0a1
Diagnostics 12 03058 g0a2 550
Figure A2. miRNAs–target mRNAs networks of the six upregulated miRNAs in PV.
Figure A2. miRNAs–target mRNAs networks of the six upregulated miRNAs in PV.
Diagnostics 12 03058 g0a2
Diagnostics 12 03058 g0a3 550
Figure A3. GO enrichment of molecular function, cellular component, and biological process corresponding to the three colors. The vertical axis represents the terms; the horizontal axis represents the −log10 (p value) and the number of genes.
Figure A3. GO enrichment of molecular function, cellular component, and biological process corresponding to the three colors. The vertical axis represents the terms; the horizontal axis represents the −log10 (p value) and the number of genes.
Diagnostics 12 03058 g0a3
Diagnostics 12 03058 g0a4 550
Figure A4. The top 30 terms of the KEGG pathway analysis of the target genes. The vertical axis represents the terms; the horizontal axis represents the −log10 (p value) and the number of genes.
Figure A4. The top 30 terms of the KEGG pathway analysis of the target genes. The vertical axis represents the terms; the horizontal axis represents the −log10 (p value) and the number of genes.
Diagnostics 12 03058 g0a4

References

  1. Amagai, M.; Tanikawa, A.; Shimizu, T.; Hashimoto, T.; Ikeda, S.; Kurosawa, M.; Niizeki, H.; Aoyama, Y.; Iwatsuki, K.; Kitajima, Y. Japanese guidelines for the management of pemphigus. J. Dermatol. 2014, 41, 471–486. [Google Scholar] [CrossRef] [PubMed]
  2. Hübner, F.; Recke, A.; Zillikens, D.; Linder, R.; Schmidt, E. Prevalence and age distribution of pemphigus and pemphigoid diseases in Germany. J. Investig. Dermatol. 2016, 136, 2495–2498. [Google Scholar] [CrossRef] [Green Version]
  3. Wertenteil, S.; Garg, A.; Strunk, A.; Alloo, A. Prevalence estimates for pemphigus in the United States: A sex- and age-adjusted population analysis. JAMA Dermatol. 2019, 155, 627–629. [Google Scholar] [CrossRef] [PubMed]
  4. Schmidt, E.; Kasperkiewicz, M.; Joly, P. Pemphigus. Lancet 2019, 394, 882–894. [Google Scholar] [CrossRef] [PubMed]
  5. Murrell, D.F.; Peña, S.; Joly, P.; Marinovic, B.; Hashimoto, T.; Diaz, L.A.; Sinha, A.A.; Payne, A.S.; Daneshpazhooh, M.; Eming, R.; et al. Diagnosis and management of pemphigus: Recommendations of an international panel of experts. J. Am. Acad. Dermatol. 2020, 82, 575–585.e571. [Google Scholar] [CrossRef] [PubMed]
  6. Joly, P.; Horvath, B.; Patsatsi, A.; Uzun, S.; Bech, R.; Beissert, S.; Bergman, R.; Bernard, P.; Borradori, L.; Caproni, M.; et al. Updated S2K guidelines on the management of pemphigus vulgaris and foliaceus initiated by the european academy of dermatology and venereology (EADV). J. Eur. Acad. Dermatol. Venereol. 2020, 34, 1900–1913. [Google Scholar] [CrossRef] [PubMed]
  7. Harman, K.E.; Brown, D.; Exton, L.S.; Groves, R.W.; Hampton, P.J.; Mohd, M.M.F.; Setterfield, J.F.; Yesudian, P.D. British Association of Dermatologists’ guidelines for the management of pemphigus vulgaris 2017. Br. J. Derm. 2017, 177, 1170–1201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Nosrati, A.; Hodak, E.; Mimouni, T.; Oren-Shabtai, M.; Levi, A.; Leshem, Y.A.; Mimouni, D. Treatment of Pemphigus with Rituximab: Real-Life Experience in a Cohort of 117 Patients in Israel. Dermatology 2021, 237, 450–456. [Google Scholar] [CrossRef] [PubMed]
  9. Slack, F.J.; Chinnaiyan, A.M. The Role of Non-coding RNAs in Oncology. Cell 2019, 179, 1033–1055. [Google Scholar] [CrossRef]
  10. Treiber, T.; Treiber, N.; Meister, G. Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat. Rev. Mol. Cell. Biol. 2019, 20, 5–20. [Google Scholar] [CrossRef]
  11. Long, H.; Wang, X.; Chen, Y.; Wang, L.; Zhao, M.; Lu, Q. Dysregulation of microRNAs in autoimmune diseases: Pathogenesis, biomarkers and potential therapeutic targets. Cancer Lett. 2018, 428, 90–103. [Google Scholar] [CrossRef]
  12. Miao, C.; Wang, X.; Zhou, W.; Huang, J. The emerging roles of exosomes in autoimmune diseases, with special emphasis on microRNAs in exosomes. Pharm. Res. 2021, 169, 105680. [Google Scholar] [CrossRef] [PubMed]
  13. Evangelatos, G.; Fragoulis, G.E.; Koulouri, V.; Lambrou, G.I. MicroRNAs in rheumatoid arthritis: From pathogenesis to clinical impact. Autoimmun. Rev. 2019, 18, 102391. [Google Scholar] [CrossRef] [PubMed]
  14. Papara, C.; Zillikens, D.; Sadik, C.D.; Baican, A. MicroRNAs in pemphigus and pemphigoid diseases. Autoimmun. Rev. 2021, 20, 102852. [Google Scholar] [CrossRef] [PubMed]
  15. Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; de Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Rashid, H.; Lamberts, A.; Diercks, G.F.H.; Pas, H.H.; Meijer, J.M.; Bolling, M.C.; Horváth, B. Oral Lesions in Autoimmune Bullous Diseases: An Overview of Clinical Characteristics and Diagnostic Algorithm. Am. J. Clin. Dermatol. 2019, 20, 847–861. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  18. The Gene Ontology Resource. Available online: http://geneontology.org (accessed on 3 November 2022).
  19. GenomeNet Database Resources. Available online: http://www.genome.jp (accessed on 3 November 2022).
  20. Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
  21. Shimizu, T.; Takebayashi, T.; Sato, Y.; Niizeki, H.; Aoyama, Y.; Kitajima, Y.; Iwatsuki, K.; Hashimoto, T.; Yamagami, J.; Werth, V.P.; et al. Grading criteria for disease severity by pemphigus disease area index. J. Derm. 2014, 41, 969–973. [Google Scholar] [CrossRef]
  22. Xiao, C.; Nemazee, D.; Gonzalez-Martin, A. MicroRNA control of B cell tolerance, autoimmunity and cancer. Semin. Cancer Biol. 2020, 64, 102–107. [Google Scholar] [CrossRef]
  23. Pauley, K.M.; Cha, S.; Chan, E.K. MicroRNA in autoimmunity and autoimmune diseases. J. Autoimmun. 2009, 32, 189–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Bystryn, J.C.; Steinman, N.M. The adjuvant therapy of pemphigus. An update. Arch. Dermatol. 1996, 132, 203–212. [Google Scholar] [CrossRef] [PubMed]
  25. Huang, Y.-H.; Kuo, C.-F.; Chen, Y.-H.; Yang, Y.-W. Incidence, mortality, and causes of death of patients with pemphigus in Taiwan: A nationwide population-based study. J. Investig. Dermatol. 2012, 132, 92–97. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Langan, S.M.; Smeeth, L.; Hubbard, R.; Fleming, K.M.; Smith, C.J.P.; West, J. Bullous pemphigoid and pemphigus vulgaris--incidence and mortality in the UK: Population based cohort study. BMJ 2008, 337, a180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Frampton, J.E. Rituximab: A Review in Pemphigus Vulgaris. Am. J. Clin. Derm. 2020, 21, 149–156. [Google Scholar] [CrossRef]
  28. Yang, A.; Xuan, R.; Melbourne, W.; Tran, K.; Murrell, D.F. Validation of the BIOCHIP test for the diagnosis of bullous pemphigoid, pemphigus vulgaris and pemphigus foliaceus. J. Eur. Acad. Dermatol. Venereol. 2020, 34, 153–160. [Google Scholar] [CrossRef]
  29. Cialfi, S.; Oliviero, C.; Ceccarelli, S.; Marchese, C.; Barbieri, L.; Biolcati, G.; Uccelletti, D.; Palleschi, C.; Barboni, L.; De Bernardo, C.; et al. Complex multipathways alterations and oxidative stress are associated with Hailey-Hailey disease. Br. J. Derm. 2010, 162, 518–526. [Google Scholar] [CrossRef]
  30. Li, X.; Zhang, D.; Ding, J.; Li, L.; Wang, Z. Identification of ATP2C1 mutations in the patients of Hailey-Hailey disease. BMC Med. Genet. 2020, 21, 120. [Google Scholar] [CrossRef]
  31. Shah, A.A.; Dey-Rao, R.; Seiffert-Sinha, K.; Sinha, A.A. Increased oxidative stress in pemphigus vulgaris is related to disease activity and HLA-association. Autoimmunity 2016, 49, 248–257. [Google Scholar] [CrossRef]
  32. Lin, X.; Chen, M.; Li, X.; Wang, H.; Bao, Y. Low SOCS3 expression in CD4(+) T cells from pemphigus vulgaris patients enhanced Th1- and Th17-cell differentiation and exacerbated acantholysis via STAT activation. Mol. Immunol. 2022, 150, 114–125. [Google Scholar] [CrossRef]
  33. Mizushima, T.; Arakawa, S.; Sanada, Y.; Yoshino, I.; Miyazaki, D.; Urushima, H.; Tsujimoto, Y.; Ito, T.; Shimizu, S. Inhibition of epithelial cell death by Bcl-2 improved chronic colitis in IL-10 KO mice. Am. J. Pathol. 2013, 183, 1936–1944. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, X.; Brégégère, F.; Frusić-Zlotkin, M.; Feinmesser, M.; Michel, B.; Milner, Y. Possible apoptotic mechanism in epidermal cell acantholysis induced by pemphigus vulgaris autoimmunoglobulins. Apoptosis 2004, 9, 131–143. [Google Scholar] [CrossRef] [PubMed]
  35. Amber, K.T.; Valdebran, M.; Grando, S.A. Non-Desmoglein Antibodies in Patients With Pemphigus Vulgaris. Front. Immunol. 2018, 9, 1190. [Google Scholar] [CrossRef] [PubMed]
  36. Kurzen, H.; Brenner, S. Significance of autoimmunity to non-desmoglein targets in pemphigus. Autoimmunity 2006, 39, 549–556. [Google Scholar] [CrossRef] [PubMed]
  37. Chernyavsky, A.I.; Arredondo, J.; Kitajima, Y.; Sato-Nagai, M.; Grando, S.A. Desmoglein versus non-desmoglein signaling in pemphigus acantholysis: Characterization of novel signaling pathways downstream of pemphigus vulgaris antigens. J. Biol. Chem. 2007, 282, 13804–13812. [Google Scholar] [CrossRef] [Green Version]
  38. Fang, H.; Li, Q.; Wang, G. The role of T cells in pemphigus vulgaris and bullous pemphigoid. Autoimmun. Rev. 2020, 19, 102661. [Google Scholar] [CrossRef] [PubMed]
  39. Zhu, H.; Chen, Y.; Zhou, Y.; Wang, Y.; Zheng, J.; Pan, M. Cognate Th2-B cell interaction is essential for the autoantibody production in pemphigus vulgaris. J. Clin. Immunol. 2012, 32, 114–123. [Google Scholar] [CrossRef]
  40. Rizzo, C.; Fotino, M.; Zhang, Y.; Chow, S.; Spizuoco, A.; Sinha, A.A. Direct characterization of human T cells in pemphigus vulgaris reveals elevated autoantigen-specific Th2 activity in association with active disease. Clin. Exp. Derm. 2005, 30, 535–540. [Google Scholar] [CrossRef]
  41. Asothai, R.; Anand, V.; Das, D.; Antil, P.S.; Khandpur, S.; Sharma, V.K.; Sharma, A. Distinctive Treg associated CCR4-CCL22 expression profile with altered frequency of Th17/Treg cell in the immunopathogenesis of Pemphigus Vulgaris. Immunobiology 2015, 220, 1129–1135. [Google Scholar] [CrossRef]
  42. Xu, R.C.; Zhu, H.Q.; Li, W.P.; Zhao, X.Q.; Yuan, H.J.; Zheng, J.; Pan, M. The imbalance of Th17 and regulatory T cells in pemphigus patients. Eur. J. Derm. 2013, 23, 795–802. [Google Scholar] [CrossRef]
  43. Arakawa, M.; Dainichi, T.; Yasumoto, S.; Hashimoto, T. Lesional Th17 cells in pemphigus vulgaris and pemphigus foliaceus. J. Derm. Sci. 2009, 53, 228–231. [Google Scholar] [CrossRef] [PubMed]
  44. Yuan, H.; Zhou, S.; Liu, Z.; Cong, W.; Fei, X.; Zeng, W.; Zhu, H.; Xu, R.; Wang, Y.; Zheng, J.; et al. Pivotal Role of Lesional and Perilesional T/B Lymphocytes in Pemphigus Pathogenesis. J. Investig. Derm. 2017, 137, 2362–2370. [Google Scholar] [CrossRef] [Green Version]
  45. Kowalski, E.H.; Kneibner, D.; Kridin, K.; Amber, K.T. Serum and blister fluid levels of cytokines and chemokines in pemphigus and bullous pemphigoid. Autoimmun. Rev. 2019, 18, 526–534. [Google Scholar] [CrossRef] [PubMed]
  46. Vielmuth, F.; Walter, E.; Fuchs, M.; Radeva, M.Y.; Buechau, F.; Magin, T.M.; Spindler, V.; Waschke, J. Keratins Regulate p38MAPK-Dependent Desmoglein Binding Properties in Pemphigus. Front. Immunol. 2018, 9, 528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Kasperkiewicz, M.; Ellebrecht, C.T.; Takahashi, H.; Yamagami, J.; Zillikens, D.; Payne, A.S.; Amagai, M. Pemphigus. Nat. Rev. Dis. Primers 2017, 3, 17026. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Bilgic Temel, A.; Murrell, D.F. Pharmacological advances in pemphigus. Curr. Opin Pharm. 2019, 46, 44–49. [Google Scholar] [CrossRef]
  49. Tavakolpour, S. Current and future treatment options for pemphigus: Is it time to move towards more effective treatments? Int. Immunopharmacol. 2017, 53, 133–142. [Google Scholar] [CrossRef]
Diagnostics 12 03058 g001 550
Figure 1. (A) Relative expressions of the six selected miRNAs in the PV and MMP groups. (B) Relative expression of miR-326 in mild and moderate PV patients. The values represent the mean ± SD. * p < 0.05; *** p < 0.001.
Figure 1. (A) Relative expressions of the six selected miRNAs in the PV and MMP groups. (B) Relative expression of miR-326 in mild and moderate PV patients. The values represent the mean ± SD. * p < 0.05; *** p < 0.001.
Diagnostics 12 03058 g001
Diagnostics 12 03058 g002 550
Figure 2. The ROC curves of the miRNAs. (A) The ROC curves of the individual miRNAs. (B) The ROC curves of the combination of miRNAs.
Figure 2. The ROC curves of the miRNAs. (A) The ROC curves of the individual miRNAs. (B) The ROC curves of the combination of miRNAs.
Diagnostics 12 03058 g002
Diagnostics 12 03058 g003 550
Figure 3. The 133 desmosomes and cell–cell junctions-related target genes were integrated in the network, (A) colored by cluster ID, where nodes that share the same cluster ID are typically close to each other, and (B) colored by p value, where terms containing more genes tend to have a more significant p value.
Figure 3. The 133 desmosomes and cell–cell junctions-related target genes were integrated in the network, (A) colored by cluster ID, where nodes that share the same cluster ID are typically close to each other, and (B) colored by p value, where terms containing more genes tend to have a more significant p value.
Diagnostics 12 03058 g003
Diagnostics 12 03058 g004 550
Figure 4. The network of miRNAs–target mRNAs pathways.
Figure 4. The network of miRNAs–target mRNAs pathways.
Diagnostics 12 03058 g004
Table
Table 1. Primer sequences of qRT-PCR.
Table 1. Primer sequences of qRT-PCR.
miRNAsForward Primer Sequence (5′-3′)
hsa-miR-125b-5pCTGAGACCCTAACTTGTGAAA
hsa-miR-146a-5pAGAACTGAATTCCATGGGTTAA
hsa-miR-148a-3pAGTGCACTACAGAACTTTGTAA
hsa-miR-150-5pCCCAACCCTTGTACCAGTG
hsa-miR-155-5pTTAATGCTAATCGTGATAGGGG
hsa-miR-181a-5pTTCAACGCTGTCGGTGAGTAA
hsa-miR181b-5pATTCATTGCTGTCGGTGGGT
hsa-miR-326TGGGCCCTTCCTCCAGAAA
hsa-miR-338-3pCAGCATCAGTGATTTTGTTGAA
hsa-miR-423-5pGGGCAGAGAGCGAGACTTT
hsa-miR-424-5pCAGCAGCAATTCATGTTTTGAA
hsa-miR-584-5pGTTTGCCTGGGACTGAGAAA
5SGGAGACCGCCTGGGAATA
Table
Table 2. Demographic and clinical characteristics.
Table 2. Demographic and clinical characteristics.
GroupSex
(Female/Male)		Age
(Mean ± SD)		ELISA (U/mL)PDAI Score
(Mean ± SD)		Disease Severity
Dsg3
(Mean ± SD)		Dsg1
(Mean ± SD)		Mild (n)Moderate (n)
PV group
(n = 22)		12/1053.23 ± 8.74148.39 ± 33.8440.29 ± 42.7111.09 ± 6.21715
MMP group
(n = 15)		10/558.80 ± 10.65-----
NC group
(n = 10)		6/453.50 ± 9.09-----
Table
Table 3. Diagnostic efficacy of miRNAs for PV.
Table 3. Diagnostic efficacy of miRNAs for PV.
miRNAsAUCCutoffYouden IndexSensitivity (%)Specificity (%)PPV (%)NPV (%)
AreaSE95% CI
miR-125b-5p0.9700.0240.923–1.0008.5750.82295.586.791.392.9
miR-155-5p0.9850.0150.955–1.00039.0250.88895.593.395.593.3
miR-181a-5p0.9800.0180.946–1.00067.1500.81881.810010078.9
miR181b-5p0.9700.0250.922–1.00015.8350.86710086.791.7100
miR-3260.9790.0180.943–1.000178.4400.86486.410010083.3
miR-584-5p0.9880.0140.960–1.00010.4550.93310093.395.7100
miR-155-5p + miR-584-5p0.9770.0260.925–1.000-0.95595.510093.8100
miR-181b-5p + miR-584-5p0.9670.0380.892–1.000-0.93310093.310095.7
Table
Table 4. The numbers of target genes of miR-125b-5p, miR-155-5p, miR-181a-5p, miR181b-5p, miR-326, and miR-584-5p predicted by the four databases (TargetScan, miRanda, CLIP-seq, and miRDB).
Table 4. The numbers of target genes of miR-125b-5p, miR-155-5p, miR-181a-5p, miR181b-5p, miR-326, and miR-584-5p predicted by the four databases (TargetScan, miRanda, CLIP-seq, and miRDB).
miRNAsmiRDBmiRTarBasemiRWalkTargetScanCandidate Target Genes
miR-125b-5p92543261481736622
miR-155-5p701904284232961030
miR-181a-5p140855331063363727
miR181b-5p14083755335290408
miR-32675913879303317391
miR-584-5p4026776702667233
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

He, W.; Xing, Y.; Li, C.; Zhou, P.; Hu, X.; Hua, H.; Wei, P. Identification of Six microRNAs as Potential Biomarkers for Pemphigus Vulgaris: From Diagnosis to Pathogenesis. Diagnostics 2022, 12, 3058. https://doi.org/10.3390/diagnostics12123058

AMA Style

He W, Xing Y, Li C, Zhou P, Hu X, Hua H, Wei P. Identification of Six microRNAs as Potential Biomarkers for Pemphigus Vulgaris: From Diagnosis to Pathogenesis. Diagnostics. 2022; 12(12):3058. https://doi.org/10.3390/diagnostics12123058

Chicago/Turabian Style

He, Wenxiu, Yixiao Xing, Chunlei Li, Peiru Zhou, Xiaosheng Hu, Hong Hua, and Pan Wei. 2022. "Identification of Six microRNAs as Potential Biomarkers for Pemphigus Vulgaris: From Diagnosis to Pathogenesis" Diagnostics 12, no. 12: 3058. https://doi.org/10.3390/diagnostics12123058

APA Style

He, W., Xing, Y., Li, C., Zhou, P., Hu, X., Hua, H., & Wei, P. (2022). Identification of Six microRNAs as Potential Biomarkers for Pemphigus Vulgaris: From Diagnosis to Pathogenesis. Diagnostics, 12(12), 3058. https://doi.org/10.3390/diagnostics12123058

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop