Rapid Detection of the Varicella-Zoster Virus Using a Recombinase-Aided Amplification-Lateral Flow System
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Description and DNA Extraction
2.2. Primer and Probe Design
2.3. RealTime-PCR (qPCR)
2.4. Recombinase-Aided Amplification–Lateral Flow
2.5. Assay Sensitivity and Specificity
3. Results
3.1. Sampling Information
3.2. Primer Validation
3.3. Assay Sensitivity and Specificity
3.4. VZV Detection in Clinical Samples with qPCR and RAA-LF
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Arvin, A.M. Varicella-zoster virus. Clin. Microbiol. Rev. 1996, 9, 361–381. [Google Scholar] [CrossRef] [PubMed]
- Kennedy, P.G.E.; Gershon, A.A. Clinical Features of Varicella-Zoster Virus Infection. Viruses 2018, 10, 609. [Google Scholar] [CrossRef] [PubMed]
- Sauerbrei, A. Diagnosis, antiviral therapy, and prophylaxis of varicella-zoster virus infections. Eur. J. Clin. Microbiol. Infect. Dis. 2016, 35, 723–734. [Google Scholar] [CrossRef] [PubMed]
- Andrei, G.; Snoeck, R. Advances and Perspectives in the Management of Varicella-Zoster Virus Infections. Molecules 2021, 26, 1132. [Google Scholar] [CrossRef] [PubMed]
- Gershon, A.A.; Breuer, J.; Cohen, J.I.; Cohrs, R.J.; Gershon, M.D.; Gilden, D.; Grose, C.; Hambleton, S.; Kennedy, P.G.; Oxman, M.N.; et al. Varicella zoster virus infection. Nat. Rev. Dis. Prim. 2015, 1, 15016. [Google Scholar] [CrossRef]
- Varicella and herpes zoster vaccines: WHO position paper, June 2014—Recommendations. Vaccine 2016, 34, 198–199. [CrossRef]
- Gershon, A.A.; Gershon, M.D. Pathogenesis and current approaches to control of varicella-zoster virus infections. Clin. Microbiol. Rev. 2013, 26, 728–743. [Google Scholar] [CrossRef]
- Jezek, Z.; Szczeniowski, M.; Paluku, K.M.; Mutombo, M.; Grab, B. Human monkeypox: Confusion with chickenpox. Acta Trop. 1988, 45, 297–307. [Google Scholar]
- Berthet, N.; Descorps-Declère, S.; Besombes, C.; Curaudeau, M.; Meyong, A.A.N.; Selekon, B.; Labouba, I.; Gonofio, E.C.; Ouilibona, R.S.; Tchetgna, H.D.S.; et al. Genomic history of human monkey pox infections in the Central African Republic between 2001 and 2018. Sci. Rep. 2021, 11, 13085. [Google Scholar] [CrossRef]
- Moore, M.J.; Rathish, B.; Zahra, F. Monkeypox. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2022. [Google Scholar]
- McCollum, A.M.; Damon, I.K. Human monkeypox. Clin. Infect. Dis. 2014, 58, 260–267. [Google Scholar] [CrossRef]
- MacNeil, A.; Reynolds, M.G.; Carroll, D.S.; Karem, K.; Braden, Z.; Lash, R.; Moundeli, A.; Mombouli, J.V.; Jumaan, A.O.; Schmid, D.S.; et al. Monkeypox or varicella? Lessons from a rash outbreak investigation in the Republic of the Congo. Am. J. Trop. Med. Hyg. 2009, 80, 503–507. [Google Scholar] [CrossRef]
- Petersen, E.; Abubakar, I.; Ihekweazu, C.; Heymann, D.; Ntoumi, F.; Blumberg, L.; Asogun, D.; Mukonka, V.; Lule, S.A.; Bates, M.; et al. Monkeypox-Enhancing public health preparedness for an emerging lethal human zoonotic epidemic threat in the wake of the smallpox post-eradication era. Int. J. Infect. Dis. 2019, 78, 78–84. [Google Scholar] [CrossRef]
- Yong, S.E.F.; Ng, O.T.; Ho, Z.J.M.; Mak, T.M.; Marimuthu, K.; Vasoo, S.; Yeo, T.W.; Ng, Y.K.; Cui, L.; Ferdous, Z.; et al. Imported Monkeypox, Singapore. Emerg. Infect. Dis. 2020, 26, 1826–1830. [Google Scholar] [CrossRef]
- Guarner, J.; Del Rio, C.; Malani, P.N. Monkeypox in 2022-What Clinicians Need to Know. JAMA 2022, 328, 139–140. [Google Scholar] [CrossRef]
- Thornhill, J.P.; Barkati, S.; Walmsley, S.; Rockstroh, J.; Antinori, A.; Harrison, L.B.; Palich, R.; Nori, A.; Reeves, I.; Habibi, M.S.; et al. Monkeypox Virus Infection in Humans across 16 Countries—April–June 2022. N. Engl. J. Med. 2022, 387, 679–691. [Google Scholar] [CrossRef]
- Petersen, E.; Kantele, A.; Koopmans, M.; Asogun, D.; Yinka-Ogunleye, A.; Ihekweazu, C.; Zumla, A. Human Monkeypox: Epidemiologic and Clinical Characteristics, Diagnosis, and Prevention. Infect. Dis. Clin. N. Am. 2019, 33, 1027–1043. [Google Scholar] [CrossRef]
- Maksyutov, R.A.; Gavrilova, E.V.; Shchelkunov, S.N. Species-specific differentiation of variola, monkeypox, and varicella-zoster viruses by multiplex real-time PCR assay. J. Virol. Methods 2016, 236, 215–220. [Google Scholar] [CrossRef]
- Hoff, N.A.; Morier, D.S.; Kisalu, N.K.; Johnston, S.C.; Doshi, R.H.; Hensley, L.E.; Okitolonda-Wemakoy, E.; Muyembe-Tamfum, J.J.; Lloyd-Smith, J.O.; Rimoin, A.W. Varicella Coinfection in Patients with Active Monkeypox in the Democratic Republic of the Congo. Ecohealth 2017, 14, 564–574. [Google Scholar] [CrossRef]
- Hughes, C.M.; Liu, L.; Davidson, W.B.; Radford, K.W.; Wilkins, K.; Monroe, B.; Metcalfe, M.G.; Likafi, T.; Lushima, R.S.; Kabamba, J.; et al. A Tale of Two Viruses: Coinfections of Monkeypox and Varicella Zoster Virus in the Democratic Republic of Congo. Am. J. Trop. Med. Hyg. 2020, 104, 604–611. [Google Scholar] [CrossRef]
- Reynolds, M.G.; McCollum, A.M.; Nguete, B.; Lushima, R.S.; Petersen, B.W. Improving the Care and Treatment of Monkeypox Patients in Low-Resource Settings: Applying Evidence from Contemporary Biomedical and Smallpox Biodefense Research. Viruses 2017, 9, 380. [Google Scholar] [CrossRef]
- Espy, M.J.; Cockerill, F.R., III; Meyer, R.F.; Bowen, M.D.; Poland, G.A.; Hadfield, T.L.; Smith, T.F. Detection of smallpox virus DNA by LightCycler PCR. J. Clin. Microbiol. 2002, 40, 1985–1988. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Wilkins, K.; Mccollum, A.M.; Osadebe, L.; Kabamba, J.; Nguete, B.; Likafi, T.; Balilo, M.P.; Lushima, R.S.; Malekani, J.; et al. Evaluation of the GeneXpert for Human Monkeypox Diagnosis. Am. J. Trop. Med. Hyg. 2017, 96, 405–410. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Olson, V.A.; Laue, T.; Laker, M.T.; Damon, I.K. Detection of monkeypox virus with real-time PCR assays. J. Clin. Virol. 2006, 36, 194–203. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhao, H.; Wilkins, K.; Hughes, C.; Damon, I.K. Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA. J. Virol. Methods 2010, 169, 223–227. [Google Scholar] [CrossRef]
- Olson, V.A.; Laue, T.; Laker, M.T.; Babkin, I.V.; Drosten, C.; Shchelkunov, S.; Niedrig, M.; Damon, I.K.; Meyer, H. Real-time PCR system for detection of orthopoxviruses and simultaneous identification of smallpox virus. J. Clin. Microbiol. 2004, 42, 1940–1946. [Google Scholar] [CrossRef] [PubMed]
- Ropp, S.L.; Jin, Q.; Knight, J.C.; Massung, R.F.; Esposito, J.J. PCR strategy for identification and differentiation of small pox and other orthopoxviruses. J. Clin. Microbiol. 1995, 33, 2069–2076. [Google Scholar] [CrossRef]
- Shchelkunov, S.N.; Shcherbakov, D.N.; Maksyutov, R.A.; Gavrilova, E.V. Species-specific identification of variola, monkeypox, cowpox, and vaccinia viruses by multiplex real-time PCR assay. J. Virol. Methods 2011, 175, 163–169. [Google Scholar] [CrossRef]
- Davi, S.D.; Kissenkötter, J.; Faye, M.; Böhlken-Fascher, S.; Stahl-Hennig, C.; Faye, O.; Faye, O.; Sall, A.A.; Weidmann, M.; Ademowo, O.G.; et al. Recombinase polymerase amplification assay for rapid detection of Monkeypox virus. Diagn. Microbiol. Infect. Dis. 2019, 95, 41–45. [Google Scholar] [CrossRef]
- Dumont, C.; Irenge, L.M.; Magazani, E.K.; Garin, D.; Muyembe, J.-J.T.; Bentahir, M.; Gala, J.-L. Simple technique for in field samples collection in the cases of skin rash illness and subsequent PCR detection of orthopoxviruses and varicella zoster virus. PLoS ONE 2014, 9, e96930. [Google Scholar] [CrossRef]
- Iizuka, I.; Saijo, M.; Shiota, T.; Ami, Y.; Suzaki, Y.; Nagata, N.; Hasegawa, H.; Sakai, K.; Fukushi, S.; Mizutani, T.; et al. Loop-mediated isothermal amplification-based diagnostic assay for monkeypox virus infections. J. Med. Virol. 2009, 81, 1102–1108. [Google Scholar] [CrossRef]
- Lynch, J.M.; Kenyon, T.K.; Grose, C.; Haya, J.; Ruyechan, W.T. Physical and functional interaction between the varicella zoster virus IE63 and IE62 proteins. Virology 2002, 302, 71–82. [Google Scholar] [CrossRef][Green Version]
- Cohen, J.I.; Cox, E.; Pesnicak, L.; Srinivas, S.; Krogmann, T. The varicella-zoster virus open reading frame 63 latency-associated protein is critical for establishment of latency. J. Virol. 2004, 78, 11833–11840. [Google Scholar] [CrossRef]
- Mueller, N.H.; Walters, M.S.; Marcus, R.A.; Graf, L.L.; Prenni, J.; Gilden, D.; Silverstein, S.J.; Cohrs, R.J. Identification of phosphorylated residues on varicella-zoster virus immediate-early protein ORF63. J. Gen. Virol. 2010, 91 Pt 5, 1133–1137. [Google Scholar] [CrossRef]
- Debrus, S.; Sadzot-Delvaux, C.; Nikkels, A.F.; Piette, J.; Rentier, B. Varicella-zoster virus gene 63 encodes an immediate-early protein that is abundantly expressed during latency. J. Virol. 1995, 69, 3240–3245. [Google Scholar] [CrossRef]
- Besombes, C.; Gonofio, E.; Konamna, X.; Selekon, B.; Grant, R.; Gessain, A.; Berthet, N.; Manuguerra, J.-C.; Fontanet, A.; Nakouné, E. Intrafamily Transmission of Monkeypox Virus, Central African Republic, 2018. Emerg. Infect. Dis. 2019, 25, 1602–1604. [Google Scholar] [CrossRef]
- Khodakevich, L.; Widy-Wirski, R.; Arita, I.; Marennikova, S.S.; Nakano, J.; Meunier, D. Monkey pox virus infection in humans in the Central African Republic. Bull. Soc. Pathol. Exot. Fil. 1985, 78, 311–320. [Google Scholar]
- Nakoune, E.; Lampaert, E.; Ndjapou, S.G.; Janssens, C.; Zuniga, I.; Van Herp, M.; Fongbia, J.P.; Koyazegbe, T.D.; Selekon, B.; Komoyo, G.F.; et al. A Nosocomial Outbreak of Human Monkeypox in the Central African Republic. Open Forum Infect. Dis. 2017, 4, ofx168. [Google Scholar] [CrossRef]
- Mao, L.; Ying, J.; Selekon, B.; Gonofio, E.; Wang, X.; Nakoune, E.; Wong, G.; Berthet, N. Development and Characterization of Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of Monkeypox Virus. Viruses 2022, 14, 2112. [Google Scholar] [CrossRef]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef]
- Cordray, M.S.; Richards-Kortum, R.R. A paper and plastic device for the combined isothermal amplification and lateral flow detection of Plasmodium DNA. Malar. J. 2015, 14, 472. [Google Scholar] [CrossRef]
- Georgoutsou-Spyridonos, M.; Filippidou, M.; Kaprou, G.D.; Mastellos, D.C.; Chatzandroulis, S.; Tserepi, A. Isothermal Recombinase Polymerase Amplification (RPA) of E. coli gDNA in Commercially Fabricated PCB-Based Microfluidic Platforms. Micromachines 2021, 12, 1387. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Ma, B.; Fang, J.; Zhi, A.; Chen, E.; Xu, Y.; Yu, X.; Sun, C.; Zhang, M. Recombinase Polymerase Amplification (RPA) Combined with Lateral Flow Immunoassay for Rapid Detection of Salmonella in Food. Foods 2019, 9, 27. [Google Scholar] [CrossRef]
- McQuillan, J.S.; Wilson, M.W. Recombinase polymerase amplification for fast, selective, DNA-based detection of faecal indicator Escherichia coli. Lett. Appl. Microbiol. 2021, 72, 382–389. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhao, P.; Si, X.; Li, J.; Dai, X.; Zhang, K.; Gao, S.; Dong, J. Rapid and Specific Detection of Listeria monocytogenes with an Isothermal Amplification and Lateral Flow Strip Combined Method That Eliminates False-Positive Signals From Primer-Dimers. Front. Microbiol. 2019, 10, 2959. [Google Scholar] [CrossRef]
- Wu, H.; Zhao, P.; Yang, X.; Li, J.; Zhang, J.; Zhang, X.; Zeng, Z.; Dong, J.; Gao, S.; Lu, C. A Recombinase Polymerase Amplification and Lateral Flow Strip Combined Method That Detects Salmonella enterica Serotype Typhimurium with No Worry of Primer-Dependent Artifacts. Front. Microbiol. 2020, 11, 1015. [Google Scholar] [CrossRef]
- Sadaoka, T.; Depledge, D.P.; Rajbhandari, L.; Venkatesan, A.; Breuer, J.; Cohen, J.I. In vitro system using human neurons demonstrates that varicella-zoster vaccine virus is impaired for reactivation, but not latency. Proc. Natl. Acad. Sci. USA 2016, 113, E2403–E2412. [Google Scholar] [CrossRef] [PubMed]
- Tommasi, C.; Breuer, J. The Biology of Varicella-Zoster Virus Replication in the Skin. Viruses 2022, 14, 982. [Google Scholar] [CrossRef]
- Rentier, B.; Piette, J.; Baudoux, L.; Debrus, S.; Defechereux, P.; Merville, M.-P.; Sadzot-Delvaux, C.; Schoonbroodt, S. Lessons to be learned from varicella-zoster virus. Vet. Microbiol. 1996, 53, 55. [Google Scholar] [CrossRef]
- Azarkh, Y.; Gilden, D.; Cohrs, R.J. Molecular characterization of varicella zoster virus in latently infected human ganglia: Physical state and abundance of VZV DNA, Quantitation of viral transcripts and detection of VZV-specific proteins. Curr. Top. Microbiol. Immunol. 2010, 342, 229–241. [Google Scholar]
- Kennedy, P.G.; Grinfeld, E.; Gow, J.W. Latent varicella-zoster virus is located predominantly in neurons in human trigeminal ganglia. Proc. Natl. Acad. Sci. USA 1998, 95, 4658–4662. [Google Scholar] [CrossRef]
- Cohen, J.I.; Krogmann, T.; Bontems, S.; Sadzot-Delvaux, C.; Pesnicak, L. Regions of the varicella-zoster virus open reading frame 63 latency-associated protein important for replication in vitro are also critical for efficient establishment of latency. J. Virol. 2005, 79, 5069–5077. [Google Scholar] [CrossRef]
- Depledge, D.P.; Sadaoka, T.; Ouwendijk, W.J.D. Molecular Aspects of Varicella-Zoster Virus Latency. Viruses 2018, 10, 349. [Google Scholar] [CrossRef]
- Kennedy, P.G.E.; Mogensen, T.H.; Cohrs, R.J. Recent Issues in Varicella-Zoster Virus Latency. Viruses 2021, 13, 2018. [Google Scholar] [CrossRef]
- Eshleman, E.; Shahzad, A.; Cohrs, R.J. Varicella zoster virus latency. Future Virol. 2011, 6, 341–355. [Google Scholar] [CrossRef]




| Sample | Year | Location | Type | Age 1 | Gender 2 |
|---|---|---|---|---|---|
| 1 | 2018 | Rafaï | crust | 29 y.o. | M |
| 2 | Rafaï | crust | 8 m.o. | M | |
| 3 | Bangui | crust | 34 y.o. | M | |
| 4 | Bangui | pus | 13 y.o. | M | |
| 5 | Bangassou | crust | unspecified | M | |
| 6 | Bangassou | crust | unspecified | unspecified | |
| 7 | Bangassou | crust | unspecified | F | |
| 8 | Bangassou | crust | unspecified | F | |
| 9 | Bangui | pus | 41 y.o. | M | |
| 10 | 2019 | Bimbo | crust | 45 y.o. | M |
| 11 | unspecified | crust | 21 y.o. | F | |
| 12 | Bangui | crust | 3 m.o. | M | |
| 13 | Mbaïki | pus | 28 y.o. | M | |
| 14 | Bria | pus | 36 y.o. | M | |
| 15 | 2020 | Boda | crust | 11 y.o. | F |
| 16 | Mbaïki | pus | 27 y.o. | M | |
| 17 | Nola | crust | 45 y.o. | M | |
| 18 | 2021 | Bimbo | crust | 5 y.o. | F |
| 19 | Bimbo | crust | 5 y.o. | M | |
| 20 | Bimbo | crust | 10 y.o. | M |
| Name | Sequence (5′–3′) |
|---|---|
| qPCR F | CGCGTTTTGTACTCCGGG |
| qPCR R | CGGTTGATGTCCTCAACGAG |
| qPCR P | FAM-TGGGAGATCCACCCGGCCAG-TAMRA |
| RAA-LF F1 | GATGTTAACGGAAAGATGGAATATGGATCTGC |
| RAA-LF R1 | Biotin-CGACCCATTAGATAAAAGTCGAGGCATATG |
| RAA-LF P1 | FAM-GTACTCCGGGTTGGGAGATCCACCCGGCCAGGCTC /idSp/GTTGAGGACATCAACCG-C3Sp |
| Method | Positive | Negative | Total | PPV 1 | NPV 2 |
|---|---|---|---|---|---|
| RT-PCR | 19 | 1 | 20 | 1 | 1 |
| RAA-LF | 19 | 1 | 20 | 1 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bienes, K.M.; Mao, L.; Selekon, B.; Gonofio, E.; Nakoune, E.; Wong, G.; Berthet, N. Rapid Detection of the Varicella-Zoster Virus Using a Recombinase-Aided Amplification-Lateral Flow System. Diagnostics 2022, 12, 2957. https://doi.org/10.3390/diagnostics12122957
Bienes KM, Mao L, Selekon B, Gonofio E, Nakoune E, Wong G, Berthet N. Rapid Detection of the Varicella-Zoster Virus Using a Recombinase-Aided Amplification-Lateral Flow System. Diagnostics. 2022; 12(12):2957. https://doi.org/10.3390/diagnostics12122957
Chicago/Turabian StyleBienes, Kathrina Mae, Lingjing Mao, Benjamin Selekon, Ella Gonofio, Emmanuel Nakoune, Gary Wong, and Nicolas Berthet. 2022. "Rapid Detection of the Varicella-Zoster Virus Using a Recombinase-Aided Amplification-Lateral Flow System" Diagnostics 12, no. 12: 2957. https://doi.org/10.3390/diagnostics12122957
APA StyleBienes, K. M., Mao, L., Selekon, B., Gonofio, E., Nakoune, E., Wong, G., & Berthet, N. (2022). Rapid Detection of the Varicella-Zoster Virus Using a Recombinase-Aided Amplification-Lateral Flow System. Diagnostics, 12(12), 2957. https://doi.org/10.3390/diagnostics12122957

