Efficient Tracing of the SARS-CoV-2 Omicron Variants in Santa Barbara County Using a Rapid Quantitative Reverse Transcription PCR Assay
Abstract
1. Introduction
2. Materials and Methods
2.1. Primer Design
2.2. Sample Collection and RNA Extraction
2.3. RT-qPCR
2.4. Data Interpretation
2.5. Amplicon Library Generation, Next Generation Sequencing, Phylogenetic Analysis
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Thomas, S. Status of COVID-19 Pandemic Before the Administration of Vaccine. Methods Mol. Biol. 2022, 2410, 93–108. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Huang, J.; Zhang, L.; Chen, S.; Gao, J.; Jiao, H. The Global Transmission of New Coronavirus Variants. Environ. Res. 2022, 206, 112240. [Google Scholar] [CrossRef] [PubMed]
- Eyre, D.W.; Taylor, D.; Purver, M.; Chapman, D.; Fowler, T.; Pouwels, K.B.; Walker, A.S.; Peto, T.E.A. Effect of Covid-19 Vaccination on Transmission of Alpha and Delta Variants. N. Engl. J. Med. 2022, 386, 744–756. [Google Scholar] [CrossRef] [PubMed]
- Gobeil, S.M.-C.; Janowska, K.; McDowell, S.; Mansouri, K.; Parks, R.; Stalls, V.; Kopp, M.F.; Manne, K.; Li, D.; Wiehe, K.; et al. Effect of Natural Mutations of SARS-CoV-2 on Spike Structure, Conformation and Antigenicity. Science 2021, 373, eabi6226. [Google Scholar] [CrossRef]
- Escalera, A.; Gonzalez-Reiche, A.S.; Aslam, S.; Mena, I.; Laporte, M.; Pearl, R.L.; Fossati, A.; Rathnasinghe, R.; Alshammary, H.; van de Guchte, A.; et al. Mutations in SARS-CoV-2 Variants of Concern Link to Increased Spike Cleavage and Virus Transmission. Cell Host. Microbe 2022, 30, 373–387.e7. [Google Scholar] [CrossRef]
- Li, Q.; Wu, J.; Nie, J.; Zhang, L.; Hao, H.; Liu, S.; Zhao, C.; Zhang, Q.; Liu, H.; Nie, L.; et al. The Impact of Mutations in SARS-CoV-2 Spike on Viral Infectivity and Antigenicity. Cell 2020, 182, 1284–1294.e9. [Google Scholar] [CrossRef]
- Tracking SARS-CoV-2 Variants. Available online: https://www.who.int/activities/tracking-SARS-CoV-2-variants (accessed on 19 May 2022).
- du Plessis, L.; McCrone, J.T.; Zarebski, A.E.; Hill, V.; Ruis, C.; Gutierrez, B.; Raghwani, J.; Ashworth, J.; Colquhoun, R.; Connor, T.R.; et al. Establishment and Lineage Dynamics of the SARS-CoV-2 Epidemic in the UK. Science 2021, 371, 708–712. [Google Scholar] [CrossRef] [PubMed]
- Mercer, T.R.; Salit, M. Testing at Scale during the COVID-19 Pandemic. Nat. Rev. Genet. 2021, 22, 415–426. [Google Scholar] [CrossRef] [PubMed]
- Sam, I.; Chong, Y.M.; Abdullah, A.; Fu, J.Y.L.; Hasan, M.S.; Jamaluddin, F.H.; Kamarulzaman, A.; Lim, K.K.; Mohd Nor, M.A.; Pang, Y.K.; et al. Changing Predominant SARS-CoV-2 Lineages Drives Successive COVID-19 Waves in Malaysia, February 2020 to March 2021. J. Med. Virol. 2021, 94, 1146–1153. [Google Scholar] [CrossRef] [PubMed]
- Oude Munnink, B.B.; Worp, N.; Nieuwenhuijse, D.F.; Sikkema, R.S.; Haagmans, B.; Fouchier, R.A.M.; Koopmans, M. The next Phase of SARS-CoV-2 Surveillance: Real-Time Molecular Epidemiology. Nat. Med. 2021, 27, 1518–1524. [Google Scholar] [CrossRef] [PubMed]
- Thakur, V.; Ratho, R.K. OMICRON (B.1.1.529): A New SARS-CoV-2 Variant of Concern Mounting Worldwide Fear. J. Med. Virol. 2022, 94, 1821–1824. [Google Scholar] [CrossRef]
- Classification of Omicron (B.1.1.529): SARS-CoV-2 Variant of Concern. Available online: https://www.who.int/news/item/26-11-2021-classification-of-omicron-(b.1.1.529)-sars-cov-2-variant-of-concern (accessed on 19 May 2022).
- Outbreak. Info. Available online: https://outbreak.info/ (accessed on 23 May 2022).
- Ren, S.-Y.; Wang, W.-B.; Gao, R.-D.; Zhou, A.-M. Omicron Variant (B.1.1.529) of SARS-CoV-2: Mutation, Infectivity, Transmission, and Vaccine Resistance. World J. Clin. Cases 2022, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Iketani, S.; Liu, L.; Guo, Y.; Liu, L.; Chan, J.F.-W.; Huang, Y.; Wang, M.; Luo, Y.; Yu, J.; Chu, H.; et al. Antibody Evasion Properties of SARS-CoV-2 Omicron Sublineages. Nature 2022, 604, 553–556. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Beltran, W.F.; St. Denis, K.J.; Hoelzemer, A.; Lam, E.C.; Nitido, A.D.; Sheehan, M.L.; Berrios, C.; Ofoman, O.; Chang, C.C.; Hauser, B.M.; et al. MRNA-Based COVID-19 Vaccine Boosters Induce Neutralizing Immunity against SARS-CoV-2 Omicron Variant. Cell 2022, 185, 457–466.e4. [Google Scholar] [CrossRef] [PubMed]
- Cele, S.; Jackson, L.; Khoury, D.S.; Khan, K.; Moyo-Gwete, T.; Tegally, H.; San, J.E.; Cromer, D.; Scheepers, C.; Amoako, D.; et al. SARS-CoV-2 Omicron Has Extensive but Incomplete Escape of Pfizer BNT162b2 Elicited Neutralization and Requires ACE2 for Infection. medRxiv 2021. [Google Scholar] [CrossRef]
- Saxena, S.K.; Kumar, S.; Ansari, S.; Paweska, J.T.; Maurya, V.K.; Tripathi, A.K.; Abdel-Moneim, A.S. Characterization of the Novel SARS-CoV-2 Omicron (B.1.1.529) Variant of Concern and Its Global Perspective. J. Med. Virol. 2022, 94, 1738–1744. [Google Scholar] [CrossRef]
- Lusvarghi, S.; Pollett, S.D.; Neerukonda, S.N.; Wang, W.; Wang, R.; Vassell, R.; Epsi, N.J.; Fries, A.C.; Agan, B.K.; Lindholm, D.A.; et al. SARS-CoV-2 Omicron Neutralization by Therapeutic Antibodies, Convalescent Sera, and Post-MRNA Vaccine Booster. bioRxiv 2021. [Google Scholar] [CrossRef]
- Kumar, S.; Karuppanan, K.; Subramaniam, G. Omicron (BA.1) and Sub-Variants (BA.1, BA.2 and BA.3) of SARS-CoV-2 Spike Infectivity and Pathogenicity: A Comparative Sequence and Structural-Based Computational Assessment. J. Med. Virol. 2022, 94, 4780–4791. [Google Scholar] [PubMed]
- Chen, J.; Wei, G.-W. Omicron BA.2 (B.1.1.529.2): High Potential to Becoming the next Dominating Variant. arXiv 2022, arXiv:2202.05031v1. [Google Scholar]
- Chen, J.; Wang, R.; Gilby, N.B.; Wei, G.-W. Omicron Variant (B.1.1.529): Infectivity, Vaccine Breakthrough, and Antibody Resistance. J. Chem. Inf. Model. 2022, 2, 412–422. [Google Scholar] [CrossRef]
- Li, J.; Gao, Z.; Chen, J.; Cheng, R.; Niu, J.; Zhang, J.; Yang, Y.; Yuan, X.; Xia, J.; Mao, G.; et al. Development of a Panel of Three Multiplex Allele-Specific QRT-PCR Assays for Quick Differentiation of Recombinant Variants and Omicron Subvariants of SARS-CoV-2. Front. Cell. Infect. Microbiol. 2022, 12, 953027. [Google Scholar] [PubMed]
- Ippoliti, C.; De Maio, F.; Santarelli, G.; Marchetti, S.; Vella, A.; Santangelo, R.; Sanguinetti, M.; Posteraro, B. Rapid Detection of the Omicron (B.1.1.529) SARS-CoV-2 Variant Using a COVID-19 Diagnostic PCR Assay. Microbiol. Spectr. 2022, 10, e00990-22. [Google Scholar] [CrossRef]
- Corbisier, P.; Petrillo, M.; Marchini, A.; Querci, M.; Buttinger, G.; Bekliz, M.; Spiess, K.; Polacek, C.; Fomsgaard, A.; Van den Eede, G. A Qualitative RT-PCR Assay for the Specific Identification of the SARS-CoV-2 B.1.1.529 (Omicron) Variant of Concern. J. Clin. Virol. 2022, 152, 105191. [Google Scholar] [CrossRef] [PubMed]
- Mills, M.G.; Hajian, P.; Bakhash, S.M.; Xie, H.; Mantzke, D.; Zhu, H.; Perchetti, G.A.; Huang, M.-L.; Pepper, G.; Jerome, K.R.; et al. Rapid and Accurate Identification of SARS-CoV-2 Omicron Variants Using Droplet Digital PCR (RT-DdPCR). J. Clin. Virol. 2022, 154, 105218. [Google Scholar] [CrossRef] [PubMed]
- Koshikawa, T.; Miyoshi, H. High-Resolution Melting Analysis to Discriminate between the SARS-CoV-2 Omicron Variants BA.1 and BA.2. Biochem. Biophys. Rep. 2022, 31, 101306. [Google Scholar] [CrossRef]
- Aoki, A.; Adachi, H.; Mori, Y.; Ito, M.; Sato, K.; Okuda, K.; Sakakibara, T.; Okamoto, Y.; Jinno, H. Discrimination of SARS-CoV-2 Omicron Sub-Lineages BA.1 and BA.2 Using a High-Resolution Melting-Based Assay: A Pilot Study. bioRxiv 2022. [Google Scholar] [CrossRef]
- Yan, T.; Xu, Y.; Zheng, R.; Zeng, X.; Chen, Z.; Lin, S.; Xia, Z.; Liao, Y.; Zhang, Y.; Li, Q. Accessible and Adaptable Multiplexed Real-Time PCR Approaches to Identify SARS-CoV-2 Variants of Concern. Microbiol. Spectr. 2022, 10, e03222-22. [Google Scholar] [CrossRef]
- Clark, A.E.; Wang, Z.; Ostman, E.; Zheng, H.; Yao, H.; Cantarel, B.; Kanchwala, M.; Xing, C.; Chen, L.; Irwin, P.; et al. Multiplex Fragment Analysis for Flexible Detection of All SARS-CoV-2 Variants of Concern. Clin. Chem. 2022, 68, 1042–1052. [Google Scholar] [CrossRef]
- Hernandez, M.M.; Banu, R.; Shrestha, P.; Gonzalez-Reiche, A.S.; van de Guchte, A.; Farrugia, K.; Sebra, R.; Mount Sinai PSP Study Group; Gitman, M.R.; Nowak, M.D.; et al. A Robust, Highly Multiplexed Mass Spectrometry Assay to Identify SARS-CoV-2 Variants. Microbiol. Spectr. 2022, 10, e01736-22. [Google Scholar] [CrossRef] [PubMed]
- Gerdol, M.; Dishnica, K.; Giorgetti, A. Emergence of a Recurrent Insertion in the N-Terminal Domain of the SARS-CoV-2 Spike Glycoprotein. Virus Res. 2022, 310, 198674. [Google Scholar] [CrossRef] [PubMed]
- CoVariants: 21K (Omicron). Available online: https://covariants.org/variants/21K.Omicron (accessed on 23 May 2022).
- CoVariants: 21L (Omicron). Available online: https://covariants.org/variants/21L.Omicron (accessed on 23 May 2022).
- Borillo, G.A.; Kagan, R.M.; Marlowe, E.M. Rapid and Accurate Identification of SARS-CoV-2 Variants Using Real Time PCR Assays. Front. Cell. Infect. Microbiol. 2022, 12, 894613. [Google Scholar] [CrossRef]
- Vega-Magaña, N.; Sánchez-Sánchez, R.; Hernández-Bello, J.; Venancio-Landeros, A.A.; Peña-Rodríguez, M.; Vega-Zepeda, R.A.; Galindo-Ornelas, B.; Díaz-Sánchez, M.; García-Chagollán, M.; Macedo-Ojeda, G.; et al. RT-QPCR Assays for Rapid Detection of the N501Y, 69-70del, K417N, and E484K SARS-CoV-2 Mutations: A Screening Strategy to Identify Variants With Clinical Impact. Front. Cell. Infect. Microbiol. 2021, 11, 672562. [Google Scholar] [PubMed]
- Oh, C.; Sashittal, P.; Zhou, A.; Wang, L.; El-Kebir, M.; Nguyen, T.H. Design of SARS-CoV-2 Variant-Specific PCR Assays Considering Regional and Temporal Characteristics. Appl. Environ. Microbiol. 2022, 88, e02289-21. [Google Scholar] [CrossRef] [PubMed]
- Martinez, D.; Miyasaki, T.; Chow, E. UCSF CAT COVID-19 Tailed 275bp v3 ARTIC Protocol V1. protocols.io. Available online: https://protocols.io/view/ucsf-cat-covid-19-tailed-275bp-v3-artic-protocol-v-bsfknbkw (accessed on 13 April 2021).
- Hadfield, J.; Megill, C.; Bell, S.M.; Huddleston, J.; Potter, B.; Callender, C.; Sagulenko, P.; Bedford, T.; Neher, R.A. Nextstrain: Real-Time Tracking of Pathogen Evolution. Bioinformatics 2018, 34, 4121–4123. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Smith, D.K.; Zhu, H.; Guan, Y.; Lam, T.T.-Y. Ggtree: An r Package for Visualization and Annotation of Phylogenetic Trees with Their Covariates and Other Associated Data. Methods Ecol. Evol. 2017, 8, 28–36. [Google Scholar] [CrossRef]
- Santa Barbara County Community Data Dashboard. Available online: https://sbcphd.maps.arcgis.com/apps/MapSeries/index.html?appid=55b1e071669c46c1b939126e1c265bae (accessed on 26 May 2022).
- Paul, P.; France, A.M.; Aoki, Y.; Batra, D.; Biggerstaff, M.; Dugan, V.; Galloway, S.; Hall, A.J.; Johansson, M.A.; Kondor, R.J.; et al. Genomic Surveillance for SARS-CoV-2 Variants Circulating in the United States, December 2020–May 2021. Morb. Mortal. Wkly. Rep. 2021, 70, 846–850. [Google Scholar] [CrossRef]
- Cao, Y.; Yisimayi, A.; Jian, F.; Song, W.; Xiao, T.; Wang, L.; Du, S.; Wang, J.; Li, Q.; Chen, X.; et al. BA.2.12.1, BA.4 and BA.5 Escape Antibodies Elicited by Omicron Infection. Nature 2022, 608, 593–602. [Google Scholar] [CrossRef] [PubMed]




| Method | SARS-CoV-2 Variants | Mutations Targeted | Reference |
|---|---|---|---|
| RT-qPCR | Omicron | N:S135R; N:I189V; S:A27S; S:S371L; N:F108L; S:G446S; S:T547K; S:L981F; N:T24I; N:L1266I; S:V213G; S:R408S | Li et al. [24] |
| RT-qPCR | Omicron | N:31Del; N:32Del; N:33Del; N:P13L; N:R203K; N:G204R | Ippoliti et al. [25] |
| RT-qPCR | Omicron | S:E484A; S:Y505H | Corbisier et al. [26] |
| RT-ddPCR | Omicron | S:S477N; S:T478K; S:E484A; S:G496S; S:Q498R; S:N501Y S:Y505H | Mills et al. [27] |
| High-Resolution Melting analysis | Omicron | S:G339D; S:N440K; S:G446S; S:D796Y | Koshikawa et al. [28] |
| High-Resolution Melting analysis | BA1.1/BA1.2 | S:R408S; S:G446R; S:447N; S:T448K | Aoki et al. [29] |
| MeltaArray | Alpha, Delta, BA.1, BA.2, BA.3, and BA.4/5 | S:A67V; S:T95I; S:Del69/70; S:G142D; S:Del143/145; S:N211I; S:Del212; S:Ins214EPE; S:G339D; S:S371L; S:S373P; S:S375F; S:K417N; S:N440K; S:G446S; S:S477N; S:T478K; S:E484A; S:Q493R; S:G496S; S:Q498R; S:N501Y; S:Y505H; S:T547K; S:D614G; S:H655Y; S:N679K; S:P681H; S:N764K; S:D796Y; S:N856K; S:Q954H; S:N969K; S:L981F; | Yan et al. [30] |
| Multiplex Fragment Analysis | Delta, Mu, Lambda, Omicron | S:Del69/70; S:Ins146N; S:Del144; S:Del156/157; S:Del143/145; S:Del241/243; S:Ins214EPE; S:Del211; S:Del247/253; S:L452R S:E484K; S:N501Y; ORF1A:Del3675/3677; ORF8:Ins28269/28273; ORF8:Del119/120; ORF8:Del31/33; | Clark et al. [31] |
| Mass Spectrometry | Iota, Alpha, Delta, and Omicron | S:L5F; S:S13I; S:L18F; S:T19R; S:Del69/70; S:D80A; S:D80G; S:T95I; S:Del144; S:W152C; S:D215G; S:Del242/244; S:D253G; S:K417N; S:K417T; S:N439K; S:L452R; S:Y453F; S:S477N; S:T478K; S:E484Q; S:E484K; S:Q493K; S:N501Y; S:N501T; S:A570D; S:D614G; S:Q677H; S:Q677P; S:P681H; S:P681R; S:I692V; | Hernandez et al. [32] |
| Name | Bases (5′–3′) | Target |
|---|---|---|
| S-BA.1/BA.1.1 Fwd | ATTATAGTGCGTGAGCCAGAAGATCT | BA.1/BA.1.1 |
| S-Wu-Hu1 Fwd | ATTAATTTAGTGCGTGATCTCCCT | All Other variants |
| S-Rev | GCAAGTAAAGTTTGAAACCTAGTGATGT | All Variants |
| S-BA.2 Fwd | TCTTATAACCAGAACTCAATCATACACT | BA.2 |
| S-BA.2 Rev | CCATTGGTCCCAGAGACATGTA | BA.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aralis, Z.; Comer, S.; Ansorg, H.; Palmer, C.; Smith, J.; Feinstein, S.C.; Fitzgibbons, L.N.; Arias, C. Efficient Tracing of the SARS-CoV-2 Omicron Variants in Santa Barbara County Using a Rapid Quantitative Reverse Transcription PCR Assay. Diagnostics 2022, 12, 2805. https://doi.org/10.3390/diagnostics12112805
Aralis Z, Comer S, Ansorg H, Palmer C, Smith J, Feinstein SC, Fitzgibbons LN, Arias C. Efficient Tracing of the SARS-CoV-2 Omicron Variants in Santa Barbara County Using a Rapid Quantitative Reverse Transcription PCR Assay. Diagnostics. 2022; 12(11):2805. https://doi.org/10.3390/diagnostics12112805
Chicago/Turabian StyleAralis, Zach, Stewart Comer, Henning Ansorg, Carl Palmer, Jennifer Smith, Stuart C. Feinstein, Lynn N. Fitzgibbons, and Carolina Arias. 2022. "Efficient Tracing of the SARS-CoV-2 Omicron Variants in Santa Barbara County Using a Rapid Quantitative Reverse Transcription PCR Assay" Diagnostics 12, no. 11: 2805. https://doi.org/10.3390/diagnostics12112805
APA StyleAralis, Z., Comer, S., Ansorg, H., Palmer, C., Smith, J., Feinstein, S. C., Fitzgibbons, L. N., & Arias, C. (2022). Efficient Tracing of the SARS-CoV-2 Omicron Variants in Santa Barbara County Using a Rapid Quantitative Reverse Transcription PCR Assay. Diagnostics, 12(11), 2805. https://doi.org/10.3390/diagnostics12112805

