Efficacy of Loop-Mediated Isothermal Amplification for H. pylori Detection as Point-of-Care Testing by Noninvasive Sampling
Abstract
:1. Introduction
2. Materials and Methods
2.1. H. pylori Strains and Clinical Samples
2.2. Validation and Verification of the LAMP Method
2.3. Evaluation of Noninvasive Sampling for Detection of H. pylori Using LAMP
3. Results
3.1. Analysis of the Performance of LAMP and LAMP-RFLP
3.2. Results of an Endoscopy-Based Study Comparing Different Sampling Methods to Detect H. pylori by LAMP
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bravo, D.; Hoare, A.; Soto, C.; Valenzuela, M.A.; Quest, A.F. Helicobacter pylori in human health and disease: Mechanisms for local gastric and systemic effects. World J. Gastroenterol. 2018, 24, 3071–3089. [Google Scholar] [CrossRef]
- Moss, S.F. The clinical evidence linking Helicobacter pylori to gastric cancer. Cell. Mol. Gastroenterol. Hepatol. 2016, 3, 183–191. [Google Scholar] [CrossRef] [Green Version]
- Ramis, I.B. Molecular methods for detection of Helicobacter pylori infection: Could they be the gold standard? J. Bras. Patol. Med. Lab. 2017, 53, 4. [Google Scholar] [CrossRef]
- Miftahussurur, M.; Yamaoka, Y. Diagnostic methods of Helicobacter pylori infection for epidemiological studies: Critical importance of indirect test validation. BioMed. Res. Int. 2016, 2016, 4819423. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.K.; Kuo, F.C.; Liu, C.J.; Wu, M.C.; Shih, H.Y.; Wang, S.S.; Wu, J.Y.; Kuo, C.H.; Huang, Y.K.; Wu, D.C. Diagnosis of Helicobacter pylori infection: Current options and developments. World. J. Gastroenterol. 2015, 21, 11221–11235. [Google Scholar] [CrossRef]
- Notomi, T.; Mori, Y.; Tomita, N.; Kanda, H. Loop mediated isothermal amplification (LAMP): Principle, features, and future prospects. J. Microbiol. 2015, 53, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Piazuelo, M.B.; Camargo, M.C.; Mera, R.M.; Delgado, A.G.; Peek, R.M., Jr.; Correa, H.; Schneider, B.G.; Sicinschi, L.A.; Mora, Y.; Bravo, L.E.; et al. Eosinophils and mast cells in chronic gastritis: Possible implications in carcinogenesis. Hum. Pathol. 2008, 39, 1360–1369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ye, W.; Ekstrom, A.M.; Hansson, L.E.; Bergstrom, R.; Nyren, O. Tobacco, alcohol and the risk of gastric cancer by subsite and histologic type. Int. J. Cancer. 1999, 83, 223–229. [Google Scholar] [CrossRef]
- Gigek, C.O.; Chen, E.S.; Calcagno, D.Q.; Wisnieski, F.; Burbano, R.R.; Smith, M.A.C. Epigenetic mechanisms in gastric cancer. Epigenomics 2012, 4, 279–294. [Google Scholar] [CrossRef] [PubMed]
- Schneider, B.G.; Peng, D.F.; Camargo, M.C.; Piazuelo, M.B.; Sicinschi, L.A.; Mera, R.; Romero-Gallo, J.; Delgado, A.G.; Bravo, L.E.; Wilson, K.T.; et al. Promoter DNA hypermethylation in gastric biopsies from subjects at high and low risk for gastric cancer. Int. J. Cancer 2010, 127, 2588–2597. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bakhtiari, S.; Hasanvand, B.; Pajavand, H.; Alvandi, A.; Abiri, R. Rapid and accurate detection of Helicobacter pylori from biopsy specimens using loop-mediated isothermal amplification. APMIS 2019, 127, 510–514. [Google Scholar] [CrossRef]
- Bakhtiari, S.; Alvandi, A.; Pajavand, H.; Navabi, J.; Najafi, F.; Abiri, R. Development and diagnostic evaluation of loop-mediated isothermal amplification using a new gene target for rapid detection of Helicobacter pylori. Jundishapur J. Microbiol. 2016, 9, e28831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Espinoza, M.G.; Vazquez, R.G.; Mendez, I.M.; Vargas, C.R.; Cerezo, S.G. Detection of the glmM gene in Helicobacter pylori isolates with a novel primer by PCR. J. Clin. Microbiol. 2011, 49, 1650–1652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nahm, J.H.; Kim, W.K.; Kwon, Y.; Kim, H. Detection of Helicobacter pylori with clarithromycin resistance-associated mutations using peptide nucleic acid probe-based melting point analysis. Helicobacter 2019, 24, e12634. [Google Scholar] [CrossRef] [PubMed]
- Janzon, A.; Sjöling, A.; Lothigius, A.; Ahmed, D.; Qadri, F.; Svennerholm, A.M. Failure to detect Helicobacter pylori DNA in drinking and environmental water in Dhaka, Bangladesh, using highly sensitive real-time PCR assays. Appl. Environ. Microbiol. 2009, 75, 3039–3044. [Google Scholar] [CrossRef] [Green Version]
- Champathai, T.; Gonlachanvit, S.; Chaichanawongsaroj, N. Detection of A2143G mutation in 23S rRNA gene associated with clarithromycin resistant Helicobacter pylori by Loop mediated isothermal amplification. J. Chem. Pharmaceutical. Res. 2014, 6, 148–155. [Google Scholar]
- Kumar, S.; Metz, D.C.; Ellenberg, S.; Kaplan, D.E.; Goldberg, D.S. Risk factors and incidence of gastric cancer after detection of helicobacter pylori infection: A large cohort study. Gastroenterology 2019, 158, 527–536. [Google Scholar] [CrossRef] [Green Version]
- Lopes, A.I.; Vale, F.F.; Oleastro, M. Helicobacter pylori infection—Recent developments in diagnosis. World J. Gastroenterol. 2014, 20, 9299–9313. [Google Scholar] [CrossRef] [Green Version]
- de Brito, B.B.; da Silva, F.A.F.; Soares, A.S.; Pereira, V.A.; Santos, M.L.C.; Sampaio, M.M.; Neves, P.H.M.; de Melo, F.F. Pathogenesis and clinical management of Helicobacter pylori gastric infection. World. J. Gastroenterol. 2019, 25, 5578–5589. [Google Scholar] [CrossRef]
- Aro, P.; Storskrubb, T.; Ronkainen, J.; Bolling-Sternevald, E.; Engstrand, L.; Vieth, M.; Stolte, M.; Talley, N.J.; Agréus, L. Peptic ulcer disease in a general adult population: The Kalixanda study: A random population-based study. Am. J. Epidemiol. 2006, 163, 1025–1034. [Google Scholar] [CrossRef] [Green Version]
- Nicholson, B.D.; Abel, L.M.; Turner, P.J.; Price, C.P.; Heneghan, C.; Hayward, G. Point-of-care Helicobacter pylori testing primary care technology update. Br. J. Gen. Pract. 2017, 67, 576–577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yari, F.; Abiri, R.; Aryan, E.; Ahmadi, J.T.; Navabi, J.; Alvandi, A. Loop-Mediated Isothermal Amplification as Fast Noninvasive Method of Helicobacter pylori Diagnosis. J. Clin. Lab. Anal. 2016, 30, 464–470. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Liu, K.; Li, Z.; Wang, P. Point of care testing for infectious diseases. Clin. Chim. Acta 2019, 493, 138–147. [Google Scholar] [CrossRef] [PubMed]
- Nicholson, B.D.; Spencer, E.A.; Abel, L.; Price, C.P.; Heneghan, C.; Hayward, G.; Pluddemann, A. Point-of-Care Testing for Helicobacter pylori Infection. Available online: https://www.community.healthcare.mic.nihr.ac.ukreports-and-resourceshorizon-scanning-reportspoint-of-care-testing-for-heliobactor-pylori-infection (accessed on 20 September 2019).



| Primers Name | Sequence (5′ > 3′) |
|---|---|
| ureC-FIP | GCA TAT CAT TTT TAG CGA TTA CGC TCA CTA ACG CGC TCACTT G |
| ureC-BIP | CTC GCC TCC AAA ATT GGC TTG CGA TTG GGG ATA AGTTTG |
| ureC-F3 | GCT TAC CTG CTT GCT TTC |
| ureC-B3 | TCC CAA GAT TTG GAA TTG AAG |
| ureC-LF | CAG GCG ATG GTT TGG TGT G |
| ureC-LB | TCA ATT GCA TGC ATT CGC TCA |
| GlmM-F | GCT CACTAAAG CGTTTTC TACCATAT AG |
| GlmM-R | ATTGCTGCCGGATTGTATTTTAA |
| 23r-F | TCAAACTACCCACCAAGCATTGTCC |
| 23r-R | CGAAGGTTAAGAGAATGCGTCAGTC |
| F3 | ACCGACCTG CATGAATGG |
| B3 | AGCCAAAGCCCTTACTTCAA |
| LF | CCTCCACTACAATTTCACTGAATCT |
| LB | ACAACTTAGCACTGCTAATGGGAAT |
| FIP | GCCGCGGGTAGGAGGAATTTTCGTAACGAGATGGGAGCTGTC |
| BIP/Wild type | CGGAAAGACCCCGTGGACCTAGCCTCCCACCTATCCTG |
| BIP/Mutant | ACCCCGTGGACCTTTACAGCCTCCCACCTATCCTG |
| HP Result by Noninvasive Sampling | H. pylori Detected by Gold Standard Sampling (Antrum/Corpus) | Analytical Performance (95% CI) | ||
|---|---|---|---|---|
| HP Positive | HP Negative | Total | ||
| Saliva (HP Positive) | 18 | 3 | 21 | 3 PPV: 85.7 (70.8–100) |
| Saliva (HP Negative) | 13 | 16 | 29 | 4 NPV: 55.2 (37.1–73.3) |
| Total | 31 | 19 | 50 | |
| Analytical Performance (95% CI) | 1 Sen: 58.1 (41.7–75.4) | 2 Spe: 84.2 (67.8–100) | Accuracy: 68% | |
| Oral Brushing (HP Positive) | 19 | 8 | 27 | PPV: 70.4 (53.2–87.6) |
| Oral Brushing (HP Negative) | 12 | 11 | 23 | NPV: 47.8 (27.4–68.2) |
| Total | 31 | 19 | 50 | |
| Analytical Performance (95% CI) | Sen: 61.3 (44.1–78.4) | Spe: 57.9 (35.7–80.1) | Accuracy: 60% | |
| Fecal (HP Positive) | 9 | 5 | 14 | PPV: 64.3 (39.2–89.4) |
| Fecal (HP Negative) | 18 | 10 | 28 | NPV: 35.7 (18.0–53.5) |
| Total | 27 | 15 | 42 | |
| Analytical Performance (95% CI) | Sen: 33.3 (15.6–51.1) | Spe: 66.7 (42.8–90.5) | Accuracy: 45.3% | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sohrabi, A.; Franzen, J.; Tertipis, N.; Zagai, U.; Li, W.; Zheng, Z.; Ye, W. Efficacy of Loop-Mediated Isothermal Amplification for H. pylori Detection as Point-of-Care Testing by Noninvasive Sampling. Diagnostics 2021, 11, 1538. https://doi.org/10.3390/diagnostics11091538
Sohrabi A, Franzen J, Tertipis N, Zagai U, Li W, Zheng Z, Ye W. Efficacy of Loop-Mediated Isothermal Amplification for H. pylori Detection as Point-of-Care Testing by Noninvasive Sampling. Diagnostics. 2021; 11(9):1538. https://doi.org/10.3390/diagnostics11091538
Chicago/Turabian StyleSohrabi, Amir, Joar Franzen, Nikolaos Tertipis, Ulrika Zagai, Wanxin Li, Zongli Zheng, and Weimin Ye. 2021. "Efficacy of Loop-Mediated Isothermal Amplification for H. pylori Detection as Point-of-Care Testing by Noninvasive Sampling" Diagnostics 11, no. 9: 1538. https://doi.org/10.3390/diagnostics11091538
APA StyleSohrabi, A., Franzen, J., Tertipis, N., Zagai, U., Li, W., Zheng, Z., & Ye, W. (2021). Efficacy of Loop-Mediated Isothermal Amplification for H. pylori Detection as Point-of-Care Testing by Noninvasive Sampling. Diagnostics, 11(9), 1538. https://doi.org/10.3390/diagnostics11091538

