A CRISPR Test for Rapidly and Sensitively Detecting Circulating EGFR Mutations
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Preparation of EGFR Mutation Reference Standards
2.3. Clinical Specimens
2.4. Extracted DNA Preparation
2.5. Polymerase Chain Reaction (PCR)
2.6. Fluorescent Readout of CRISPR-Cas12a Activity by Using FAM-Quencher (FQ) Reporters
3. Results
3.1. The CRISPR-Cas12a System Has a Higher Sensitivity for Detecting the EGFR Mutations Compared with ddPCR Assay
3.2. The CRISPR-Cas12a System Can Rapidly Detect the EGFR Mutations in the Crude Preparation of Cell-Cultured Supernatant
3.3. The CRISPR-Cas12a System Can Sensitively and Rapidly Detect EGFR Mutations in Plasma of Lung Cancer Patients
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ettinger, D.S.; Aisner, D.L.; Wood, D.E.; Akerley, W.; Bauman, J.; Chang, J.Y.; Chirieac, L.R.; D’Amico, T.A.; Dilling, T.J.; Dobelbower, M.; et al. NCCN Guidelines Insights: Non-Small Cell Lung Cancer, Version 5.2018. J. Natl. Compr. Canc. Netw. 2018, 16, 807–821. [Google Scholar] [CrossRef] [PubMed]
- Genova, C.; Rossi, G.; Tagliamento, M.; Rijavec, E.; Biello, F.; Cerbone, L.; Zullo, L.; Grossi, F. Targeted therapy of oncogenic-driven advanced non-small cell lung cancer: Recent advances and new perspectives. Expert. Rev. Respir. Med. 2020, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Oxnard, G.R.; Paweletz, C.P.; Kuang, Y.; Mach, S.L.; O’Connell, A.; Messineo, M.M.; Luke, J.J.; Butaney, M.; Kirschmeier, P.; Jackman, D.M.; et al. Noninvasive detection of response and resistance in EGFR-mutant lung cancer using quantitative next-generation genotyping of cell-free plasma DNA. Clin. Cancer Res. 2014, 20, 1698–1705. [Google Scholar] [CrossRef] [PubMed]
- Rolfo, C.; Mack, P.C.; Scagliotti, G.V.; Baas, P.; Barlesi, F.; Bivona, T.G.; Herbst, R.S.; Mok, T.S.; Peled, N.; Pirker, R.; et al. Liquid Biopsy for Advanced Non-Small Cell Lung Cancer (NSCLC): A Statement Paper from the IASLC. J. Thorac. Oncol. 2018, 13, 1248–1268. [Google Scholar] [CrossRef]
- Russo, A.; De Miguel Perez, D.; Gunasekaran, M.; Scilla, K.; Lapidus, R.; Cooper, B.; Mehra, R.; Adamo, V.; Malapelle, U.; Rolfo, C. Liquid biopsy tracking of lung tumor evolutions over time. Expert. Rev. Mol. Diagn. 2019, 19, 1099–1108. [Google Scholar] [CrossRef]
- Gootenberg, J.S.; Abudayyeh, O.O.; Kellner, M.J.; Joung, J.; Collins, J.J.; Zhang, F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 2018, 360, 439–444. [Google Scholar] [CrossRef]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef]
- Abudayyeh, O.O.; Gootenberg, J.S.; Essletzbichler, P.; Han, S.; Joung, J.; Belanto, J.J.; Verdine, V.; Cox, D.B.T.; Kellner, M.J.; Regev, A.; et al. RNA targeting with CRISPR-Cas13. Nature 2017, 550, 280–284. [Google Scholar] [CrossRef]
- Tsou, J.H.; Leng, Q.; Jiang, F. A CRISPR Test for Detection of Circulating Nuclei Acids. Transl. Oncol. 2019, 12, 1566–1573. [Google Scholar] [CrossRef]
- Jiang, X.W.; Liu, W.; Zhu, X.Y.; Xu, X.X. Evaluation of EGFR mutations in NSCLC with highly sensitive droplet digital PCR assays. Mol. Med. Rep. 2019, 20, 593–603. [Google Scholar] [CrossRef]
- Ma, J.; Li, N.; Guarnera, M.; Jiang, F. Quantification of Plasma miRNAs by Digital PCR for Cancer Diagnosis. Biomark Insights 2013, 8, 127–136. [Google Scholar] [CrossRef]
- Chertow, D.S. Next-generation diagnostics with CRISPR. Science 2018, 360, 381–382. [Google Scholar] [CrossRef]
- Goto, K.; Satouchi, M.; Ishii, G.; Nishio, K.; Hagiwara, K.; Mitsudomi, T.; Whiteley, J.; Donald, E.; McCormack, R.; Todo, T. An evaluation study of EGFR mutation tests utilized for non-small-cell lung cancer in the diagnostic setting. Ann. Oncol. 2012, 23, 2914–2919. [Google Scholar] [CrossRef]
- Douillard, J.Y.; Ostoros, G.; Cobo, M.; Ciuleanu, T.; McCormack, R.; Webster, A.; Milenkova, T. First-line gefitinib in Caucasian EGFR mutation-positive NSCLC patients: A phase-IV, open-label, single-arm study. Br. J. Cancer 2014, 110, 55–62. [Google Scholar] [CrossRef]
- Lindeman, N.I.; Cagle, P.T.; Aisner, D.L.; Arcila, M.E.; Beasley, M.B.; Bernicker, E.H.; Colasacco, C.; Dacic, S.; Hirsch, F.R.; Kerr, K.; et al. Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment With Targeted Tyrosine Kinase Inhibitors: Guideline From the College of American Pathologists, the International Association for the Study of Lung Cancer, and the Association for Molecular Pathology. J. Thorac. Oncol. 2018, 13, 323–358. [Google Scholar] [CrossRef]
- Pennell, N.A.; Neal, J.W.; Chaft, J.E.; Azzoli, C.G.; Janne, P.A.; Govindan, R.; Evans, T.L.; Costa, D.B.; Wakelee, H.A.; Heist, R.S.; et al. SELECT: A Phase II Trial of Adjuvant Erlotinib in Patients With Resected Epidermal Growth Factor Receptor-Mutant Non-Small-Cell Lung Cancer. J. Clin. Oncol. 2019, 37, 97–104. [Google Scholar] [CrossRef]
- Tan, A.C.; Lai, G.G.Y.; Tan, G.S.; Poon, S.Y.; Doble, B.; Lim, T.H.; Aung, Z.W.; Takano, A.; Tan, W.L.; Ang, M.K.; et al. Utility of incorporating next-generation sequencing (NGS) in an Asian non-small cell lung cancer (NSCLC) population: Incremental yield of actionable alterations and cost-effectiveness analysis. Lung Cancer 2020, 139, 207–215. [Google Scholar] [CrossRef]
- Leighl, N.B.; Page, R.D.; Raymond, V.M.; Daniel, D.B.; Divers, S.G.; Reckamp, K.L.; Villalona-Calero, M.A.; Dix, D.; Odegaard, J.I.; Lanman, R.B.; et al. Clinical Utility of Comprehensive Cell-free DNA Analysis to Identify Genomic Biomarkers in Patients with Newly Diagnosed Metastatic Non-small Cell Lung Cancer. Clin. Cancer Res. 2019, 25, 4691–4700. [Google Scholar] [CrossRef]
- Ramalingam, S.S.; Yang, J.C.; Lee, C.K.; Kurata, T.; Kim, D.W.; John, T.; Nogami, N.; Ohe, Y.; Mann, H.; Rukazenkov, Y.; et al. Osimertinib As First-Line Treatment of EGFR Mutation-Positive Advanced Non-Small-Cell Lung Cancer. J. Clin. Oncol. 2018, 36, 841–849. [Google Scholar] [CrossRef]
- Brown, B.P.; Zhang, Y.K.; Westover, D.; Yan, Y.; Qiao, H.; Huang, V.; Du, Z.; Smith, J.A.; Ross, J.S.; Miller, V.A.; et al. On-target Resistance to the Mutant-Selective EGFR Inhibitor Osimertinib Can Develop in an Allele-Specific Manner Dependent on the Original EGFR-Activating Mutation. Clin. Cancer Res. 2019, 25, 3341–3351. [Google Scholar] [CrossRef]
- Le, X.; Puri, S.; Negrao, M.V.; Nilsson, M.B.; Robichaux, J.; Boyle, T.; Hicks, J.K.; Lovinger, K.L.; Roarty, E.; Rinsurongkawong, W.; et al. Landscape of EGFR-Dependent and -Independent Resistance Mechanisms to Osimertinib and Continuation Therapy Beyond Progression in EGFR-Mutant NSCLC. Clin. Cancer Res. 2018, 24, 6195–6203. [Google Scholar] [CrossRef]
- Dagogo-Jack, I.; Azzolli, C.G.; Fintelmann, F.; Mino-Kenudson, M.; Farago, A.F.; Gainor, J.F.; Jiang, G.; Piotrowska, Z.; Heist, R.S.; Lennes, I.T.; et al. Clinical Utility of Rapid EGFR Genotyping in Advanced Lung Cancer. Jco. Precis. Oncol. 2018, 2018. [Google Scholar] [CrossRef]
Primer’s Name | Sequences (5′–3′) |
---|---|
EGFR790_F | TCACCTCCACCGTGCATTTCATCA |
EGFR790_R | TTGCGATCTGCACACACCAGTTGA |
EGFR858_F | GTCAAGATCACAGATTTTGGGC |
EGFR858_R | GCCTCCTTCTGCATGGTATT |
Guide RNA’s Name | Sequence (5′->3′) |
---|---|
LbCas12a crRNA-EGFR790-C | UAAUUUCUACUAAGUGUAGAUAUCACGCAGCUCAUGCC |
LbCas12a crRNA-EGFR790-T | UAAUUUCUACUAAGUGUAGAUAUCAUGCAGCUCAUGCC |
LbCas12a crRNA-EGFR858-T | UAAUUUCUACUAAGUGUAGAUGGCUGGCCAAACUGCUG |
LbCas12a crRNA-EGFR858-G | UAAUUUCUACUAAGUGUAGAUGGCGGGCCAAACUGCUG |
Substrate’s name | Sequence (5′->3′) |
ssDNA-FQ reporter | /56-FAM/TTATT/3IABKFQ/ |
Detecting Method | CRISPR-Cas12a | ddPCR | ||||
---|---|---|---|---|---|---|
DNA Preparation | 20 µL of liquid materials were diluted 1:3 in PBS containing 0.53% Triton X-100 to the final volume of 60 µL, and boiled to 95 °C for 6 min. | 200 µL of liquid materials were extracted by using the Qiagen DNeasy® Blood and Tissue kit per each manufacturer’s instruction, and the final volume was 20 µL. Total processing time was 30 min. | ||||
Amplification Signal | 5 µLDNA was added into the final volume of 50 µL for PCR and total processing time was 1 h and 30 min. | 5 µLDNA was added into the final volume of 20 µL for droplet formation and PCR. Total processing time was 2 h. | ||||
PCR Condition | Volume of DNA | 5.0 | Volume of DNA | 5.0 | ||
Nuclease-free water | 15.2 | Nuclease-free water | 4.5 | |||
10 M EGFR F primer | 2.4 | 40× Taqman Liquid Biopsy dPCRAssay (Probe and primers) | 0.5 | |||
10 M EGFR R primer | 2.4 | 2× ddPCR™ Supermix for Probes, No AmpErase UNG/ dUTP | 10 | |||
TaqMan 2× Universal PCR Master Mix, no AmpErase UNG | 25 | Total volume per reaction | 20 | |||
Total volume per reaction | 50 | |||||
95.0 °C | 10 min | 1 cycle | 95.0 °C | 10 min | 1 cycle | |
95.0 °C | 10 sec | 40–45 cycles | 94.0 °C | 30 sec | 40 cycles | |
54.7 °C | 10 sec | 60.0 °C | 1 min | |||
72.0 °C | 30 sec | 98.0 °C | 10 min | 1 cycle | ||
72.0 °C | 10 min | 1 cycle | 4.0 °C | 1 cycle | ||
4.0 °C | 1 cycle | |||||
Volume of Detection | 5 µL from a 50 of µL PCR mixture was added directly to the pre-assembled mixture in total 20 µL volumes for fluorescence detection. | Whole 20 µL of ddPCR mixture was applied for copy numbers detection | ||||
Pre-Assembled Mixture | 250 nM of LbCas12a, 500 nM of targeting crRNA and 500 nM of ssDNA-FQ reporter. | No. | ||||
Specificity From | 1. Primer pairs. 2. LbCas12a and targeting crRNA. | 1. Primer pairs. 2. Taqman probe. | ||||
Specific amplification of the product with specific CRISPR-Cas12a target binding. | Specific amplification of the product with labeling a target-specific hydrolysis probe. | |||||
Specific CRISPR-Cas12a target binding activates collateral activity to unleash indiscriminate single-stranded DNA (ssDNA) cleavage activity and further amplify the detection signal. | If the target sequence is present, the probe anneals and is cleaved as the primer is extended. This cleavage of the probe separates the reporter dye from quencher dye, increasing the reporter dye signal. | |||||
Time for Detection | From 30 min up to 1 h. | At least 1h and 30 min. |
28 Lung Cancer Patients * | 20 Cancer-Free Individuals | |
---|---|---|
Median age, years (min, max) | 65 (37, 79) | 66 (36, 79) |
Sex, n (%) | ||
Male | 7 (25%) | 5 (25%) |
Female | 21 (75%) | 15 (75%) |
Race, n (%) | ||
White | 20 (71.4%) | 14 (70.0%) |
Black | 3 (10.7%) | 2 (10.0%) |
Asia | 5 (17.9%) | 4 (20.0%) |
Smoking status | ||
Yes | 12 | 8 |
No | 13 | 9 |
Unknown | 3 | 2 |
Histology | Adenocarcinoma. | |
TNM Stage I | ||
III | 5 (17.9) | |
IV | 23 (82.1) |
Patient | Mutations Detected in Tissues | Mutations Detected in Plasma by the CRISPR | Mutations Detected in Plasma by ddPCR |
---|---|---|---|
1 | T790M | T790M (Mean fluorescence intensity: 100000) | |
2 | T790M | ||
3 | L858R | L858R (Mean fluorescence intensity: 99493) | L858R (10.13/µL) |
4 | T790M, L858R | L858R (Mean fluorescence intensity: 31419) | L858R (2 copes/µL) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsou, J.-H.; Leng, Q.; Jiang, F. A CRISPR Test for Rapidly and Sensitively Detecting Circulating EGFR Mutations. Diagnostics 2020, 10, 114. https://doi.org/10.3390/diagnostics10020114
Tsou J-H, Leng Q, Jiang F. A CRISPR Test for Rapidly and Sensitively Detecting Circulating EGFR Mutations. Diagnostics. 2020; 10(2):114. https://doi.org/10.3390/diagnostics10020114
Chicago/Turabian StyleTsou, Jen-Hui, Qixin Leng, and Feng Jiang. 2020. "A CRISPR Test for Rapidly and Sensitively Detecting Circulating EGFR Mutations" Diagnostics 10, no. 2: 114. https://doi.org/10.3390/diagnostics10020114
APA StyleTsou, J.-H., Leng, Q., & Jiang, F. (2020). A CRISPR Test for Rapidly and Sensitively Detecting Circulating EGFR Mutations. Diagnostics, 10(2), 114. https://doi.org/10.3390/diagnostics10020114