Profiling of Differentially Expressed MicroRNAs in Human Umbilical Vein Endothelial Cells Exposed to Hyperglycemia via RNA Sequencing
Abstract
1. Introduction
2. Materials and Methods
2.1. HUVEC Isolation, Culture, and Treatment
2.2. Total RNA Extraction
2.3. miRNA Expression Profiling
2.4. Validation of the Selected miRNAs with Stem-Loop Reverse-Transcription–Quantitative Polymerase Chain Reaction
2.5. Bioinformatics Analysis
2.6. Prediction and Analysis of the Potential Target Genes of Differentially Expressed miRNAs
2.7. Statistical Analysis
3. Results
3.1. RNA Sequencing Identified Differentially Expressed miRNAs in Hyperglycemia-Induced HUVECs
3.2. Validation of Novel miR-1133 and miR-1225 via Stem-Loop qPCR
3.3. GO Analysis
3.4. KEGG Pathway Analysis
3.5. Target Prediction and Analysis of Candidate for Differentially Expressed miRNAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ugusman, A.; Kumar, J.; Aminuddin, A. Endothelial Function and Dysfunction: Impact of Sodium-Glucose Cotransporter 2 Inhibitors. Pharmacol. Ther. 2021, 224, 107832. [Google Scholar] [CrossRef] [PubMed]
- Jubaidi, F.F.; Zainalabidin, S.; Taib, I.S.; Hamid, Z.A.; Budin, S.B. The Potential Role of Flavonoids in Ameliorating Diabetic Cardiomyopathy via Alleviation of Cardiac Oxidative Stress, Inflammation and Apoptosis. Int. J. Mol. Sci. 2021, 22, 5094. [Google Scholar] [CrossRef] [PubMed]
- Simsek, S.; Van Den Oever, I.A.M.; Raterman, H.G.; Nurmohamed, M.T. Endothelial Dysfunction, Inflammation, and Apoptosis in Diabetes Mellitus. Mediat. Inflamm. 2010, 2010, 792393. [Google Scholar] [CrossRef]
- Patel, H.; Chen, J.; Das, K.C.; Kavdia, M. Hyperglycemia Induces Differential Change in Oxidative Stress at Gene Expression and Functional Levels in HUVEC and HMVEC. Cardiovasc. Diabetol. 2013, 12, 142. [Google Scholar] [CrossRef] [PubMed]
- Jin, Q.H.; Hu, X.J.; Zhao, H.Y. Curcumin Activates Autophagy and Attenuates High Glucose-Induced Apoptosis in HUVECs through the ROS/NF-ΚB Signaling Pathway. Exp. Ther. Med. 2022, 24, 596. [Google Scholar] [CrossRef]
- Volpe, C.M.O.; Villar-Delfino, P.H.; Dos Anjos, P.M.F.; Nogueira-Machado, J.A. Cellular Death, Reactive Oxygen Species (ROS) and Diabetic Complications Review-Article. Cell Death Dis. 2018, 9, 119. [Google Scholar] [CrossRef]
- Bhatti, J.S.; Sehrawat, A.; Mishra, J.; Sidhu, I.S.; Navik, U.; Khullar, N.; Kumar, S.; Bhatti, G.K.; Reddy, P.H. Oxidative Stress in the Pathophysiology of Type 2 Diabetes and Related Complications: Current Therapeutics Strategies and Future Perspectives. Free Radic. Biol. Med. 2022, 184, 114–134. [Google Scholar] [CrossRef]
- Kuo, C.L.; Ponneri Babuharisankar, A.; Lin, Y.C.; Lien, H.W.; Lo, Y.K.; Chou, H.Y.; Tangeda, V.; Cheng, L.C.; Cheng, A.N.; Lee, A.Y.L. Mitochondrial Oxidative Stress in the Tumor Microenvironment and Cancer Immunoescape: Foe or Friend? J. Biomed. Sci. 2022, 29, 74. [Google Scholar] [CrossRef]
- Erekat, N.S. Programmed Cell Death in Diabetic Nephropathy: A Review of Apoptosis, Autophagy, and Necroptosis. Med. Sci. Monit. 2022, 28, e937766. [Google Scholar] [CrossRef]
- Cai, L.; Li, W.; Wang, G.; Guo, L.; Jiang, Y.; James Kang, Y. Hyperglycemia-Induced Apoptosis in Mouse Myocardium: Mitochondrial Cytochrome c-Mediated Caspase-3 Activation Pathway. Diabetes 2002, 51, 1938–1948. [Google Scholar] [CrossRef]
- Tang, C.; Tan, S.; Zhang, Y.; Dong, L.; Xu, Y. Activation of Keap1-Nrf2 Signaling by 4-Octyl Itaconate Protects Human Umbilical Vein Endothelial Cells from High Glucose. Biochem. Biophys. Res. Commun. 2019, 508, 921–927. [Google Scholar] [CrossRef] [PubMed]
- Sheu, M.L.; Ho, F.M.; Yang, R.S.; Chao, K.F.; Lin, W.W.; Lin-Shiau, S.Y.; Liu, S.H. High Glucose Induces Human Endothelial Cell Apoptosis through a Phosphoinositide 3-Kinase-Regulated Cyclooxygenase-2 Pathway. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 539–545. [Google Scholar] [CrossRef]
- Kocherova, I.; Bryja, A.; Mozdziak, P.; Angelova Volponi, A.; Dyszkiewicz-Konwińska, M.; Piotrowska-Kempisty, H.; Antosik, P.; Bukowska, D.; Bruska, M.; Iżycki, D.; et al. Human Umbilical Vein Endothelial Cells (HUVECs) Co-Culture with Osteogenic Cells: From Molecular Communication to Engineering Prevascularised Bone Grafts. J. Clin. Med. 2019, 8, 1602. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Wang, X. MiRDB: An Online Database for Prediction of Functional MicroRNA Targets. Nucleic Acids Res. 2020, 48, 127–131. [Google Scholar] [CrossRef] [PubMed]
- Azam, I.N.A.; Wahab, N.A.; Mokhtar, M.H.; Shafiee, M.N.; Mokhtar, N.M. Roles of MicroRNAs in Regulating Apoptosis in the Pathogenesis of Endometriosis. Life 2022, 12, 1321. [Google Scholar] [CrossRef]
- Ding, Y.; Sun, X.; Shan, P.F. MicroRNAs and Cardiovascular Disease in Diabetes Mellitus. Biomed. Res. Int. 2017, 2017, 4080364. [Google Scholar] [CrossRef]
- Hamid, A.A.; Aminuddin, A.; Anuar, N.N.M.; Mansor, N.I.; Ahmad, M.F.; Saleh, M.S.M.; Mokhtar, M.H.; Ugusman, A. Persicaria Minor (Huds.) Opiz Prevents In Vitro Atherogenesis by Attenuating Tumor Necrosis Factor-α-Induced Monocyte Adhesion to Human Umbilical Vein Endothelial Cells. Life 2022, 2022, 1462. [Google Scholar] [CrossRef]
- Han, X.; Wang, B.; Sun, Y.; Huang, J.; Wang, X.; Ma, W.; Zhu, Y.; Xu, R.; Jin, H.; Liu, N. Metformin Modulates High Glucose-Incubated Human Umbilical Vein Endothelial Cells Proliferation and Apoptosis Through AMPK/CREB/BDNF Pathway. Front. Pharmacol. 2018, 9, 1266. [Google Scholar] [CrossRef]
- Niu, C.; Chen, Z.; Kim, K.T.; Sun, J.; Xue, M.; Chen, G.; Li, S.; Shen, Y.; Zhu, Z.; Wang, X.; et al. Metformin Alleviates Hyperglycemia-Induced Endothelial Impairment by Downregulating Autophagy via the Hedgehog Pathway. Autophagy 2019, 15, 843–870. [Google Scholar] [CrossRef]
- Li, Q.; Lin, Y.; Wang, S.; Zhang, L.; Guo, L. GLP-1 Inhibits High-Glucose-Induced Oxidative Injury of Vascular Endothelial Cells. Sci. Rep. 2017, 7, 8008. [Google Scholar] [CrossRef]
- Wang, L.P.; Jiang, Y.; Yang, H.; Peng, C.; Zhang, C.; Tao, X.; Xie, H.H. Combination Therapy of Nifedipine and Sulphonylureas Exhibits a Mutual Antagonistic Effect on the Endothelial Cell Dysfunction Induced by Hyperglycemia Linked to Vascular Disease. Cell. Physiol. Biochem. 2016, 38, 2337–2347. [Google Scholar] [CrossRef]
- Dang, T.H.Y.; Tyagi, S.; D’Cunha, G.; Bhave, M.; Crawford, R.; Ivanova, E.P. Computational Prediction of MicroRNAs in Marine Bacteria of the Genus Thalassospira. PLoS ONE 2019, 14, e0212996. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Gu, H.Y.; Zhu, J.; Niu, Y.M.; Zhang, C.; Guo, G.L. Identification of Hub Genes and Key Pathways Associated with Bipolar Disorder Based on Weighted Gene Co-Expression Network Analysis. Front. Physiol. 2019, 10, 1081. [Google Scholar] [CrossRef]
- Yusof, N.L.M.; Tengku Affendi, T.N.T.; Jubaidi, F.F.; Abidin, S.Z.; Budin, S.B. Hibiscus Sabdariffa Linn. (Roselle) Polyphenols-Rich Extract Prevents Hyperglycemia-Induced Cardiac Oxidative Stress and Mitochondrial Damage in Diabetic Rats. Sains Malays. 2020, 49, 2499–2506. [Google Scholar] [CrossRef]
- Ghosh, N.; Saha, I.; Sharma, N.; Sarkar, J.P. Human MiRNAs to Identify Potential Regions of SARS-CoV-2. ACS Omega 2022, 7, 21086–21101. [Google Scholar] [CrossRef]
- Bhakta, A. Micro-RNA Analysis of Extracellular Vesicles Secreted by Alveolar Macrophages and Epithelial Cells in Response to Cadmium. Ph.D. Thesis, University of Texas, Tyler, TX, USA, 2022. [Google Scholar]
- Yizhen, S.; Lisha, L.; Chengzhen, X.; Leimei, X.; Ling, W.; Yisong, C. Advanced Glycation End Products (AGEs) Downregulate the MiR-4429/PTEN Axis to Promote Apoptosis of Fibroblasts in Pelvic Organ Prolapse. Ann. Transl. Med. 2022, 10, 821. [Google Scholar] [CrossRef]
- Wenshuang, X.; Qingyou, C.; Xiaofeng, Z.; Yue, Z.; Shuang, W.; Chao, Y.; Yubao, L.; Lijie, L.; Di, J.; Chaojun, L.; et al. Genipin Protects against Mitochondrial Damage of the Retinal Pigment Epithelium under Hyperglycemia through the AKT Pathway Mediated by the MiR-4429/JAK2 Signaling Axis. Ann. Transl. Med. 2022, 10, 587. [Google Scholar] [CrossRef]
- Shraim, B.A.; Moursi, M.O.; Benter, I.F.; Habib, A.M.; Akhtar, S. The Role of Epidermal Growth Factor Receptor Family of Receptor Tyrosine Kinases in Mediating Diabetes-Induced Cardiovascular Complications. Front. Pharmacol. 2021, 12, 701390. [Google Scholar] [CrossRef] [PubMed]
- Sheng, L.; Bayliss, G.; Zhuang, S. Epidermal Growth Factor Receptor: A Potential Therapeutic Target for Diabetic Kidney Disease. Front. Pharmacol. 2021, 11. [Google Scholar] [CrossRef] [PubMed]
- Xu, K.P.; Li, Y.; Ljubimov, A.V.; Yu, F.S.X. High Glucose Suppresses Epidermal Growth Factor Receptor/ Phosphatidylinositol 3-Kinase/Akt Signaling Pathway and Attenuates Corneal Epithelial Wound Healing. Diabetes 2009, 58, 1077–1085. [Google Scholar] [CrossRef]
- Kobayashi, T.; Taguchi, K.; Yasuhiro, T.; Matsumoto, T.; Kamata, K. Impairment of PI3-K/Akt Pathway Underlies Attenuated Endothelial Function in Aorta of Type 2 Diabetic Mouse Model. Hypertension 2004, 44, 956–962. [Google Scholar] [CrossRef] [PubMed]
- Feng, C.; Jin, Z.; Chi, X.; Zhang, B.; Wang, X.; Sun, L.; Fan, J.; Sun, Q.; Zhang, X. SHBG Expression Is Correlated with PI3K/AKT Pathway Activity in a Cellular Model of Human Insulin Resistance. Gynecol. Endocrinol. 2018, 34, 567–573. [Google Scholar] [CrossRef] [PubMed]
- Liao, L.; Gong, L.; Zhou, M.; Xue, X.; Li, Y.; Peng, C. Leonurine Ameliorates Oxidative Stress and Insufficient Angiogenesis by Regulating the PI3K/Akt-ENOS Signaling Pathway in H2O2-Induced HUVECs. Oxid. Med. Cell Longev. 2021, 2021, 9919466. [Google Scholar] [CrossRef] [PubMed]
- McCall, M.N.; Kent, O.A.; Yu, J.; Fox-Talbot, K.; Zaiman, A.L.; Halushka, M.K. MicroRNA Profiling of Diverse Endothelial Cell Types. BMC Med. Genom. 2011, 4, 78. [Google Scholar] [CrossRef] [PubMed]
Target miRNA | Primer Sequence (5′-3′) | PCR Product Size (bp) | |
---|---|---|---|
1133 | Forward | GCTGGGCGGCTTGCTGG | 72 |
Reverse | GTAGGATGCCGCTCTCAG | ||
1125 | Forward | GATCTGCTGCAGTGCTC | 72 |
Reverse | GTAGGATGCCGCTCTCAG | ||
U6 | Forward | CTCGCTTCGGCAGCACA | 94 |
Reverse | AACGCTTCACGAATTTGCGT | ||
Stem-loop miR-1133 | GTTGGCTCTGGTAGGATGCCGCTCTCAGGGCATCCTACCAGAGCCAAACCGAGCC | ||
Stem-loop miR-1225 | GTTGGCTCTGGTAGGATGCCGCTCTCAGGGCATCCTACCAGAGCCAAACGGCTCA |
miRNA | Fold Change | Type of Regulation | p-Value |
---|---|---|---|
Novel miRNA-1133 | 5.656155105 | Ups | 0.003556 |
Novel miRNA-710 | 5.138058047 | Ups | 0.011192 |
hsa-miR-10526-3p | 4.97619696 | Ups | 0.014895 |
Novel miRNA-90 | 4.867705436 | Ups | 0.017918 |
hsa-miR-5009-5p | −4.27746075 | Down | 0.043118 |
hsa-miR-4429 | −4.27746075 | Down | 0.043118 |
Novel miRNA-1259 | −4.342495533 | Down | 0.039524 |
hsa-miR-4709-3p | −4.43050579 | Down | 0.034903 |
Novel miRNA-950 | −4.445521443 | Down | 0.041609 |
hsa-miR-7854-3p | −4.64142907 | Down | 0.025308 |
Novel miRNA-556 | −4.769735545 | Down | 0.020703 |
hsa-miR-6803-3p | −4.897376412 | Down | 0.015674 |
NovelmiRNA-1226 | −4.995100139 | Down | 0.0142 |
Novel miRNA-28 | −5.397699054 | Down | 0.00595 |
Novel miRNA-363 | −5.535195224 | Down | 0.005111 |
Novel miRNA-658 | −5.715530062 | Down | 0.003519 |
Novel miRNA-1225 | −7.810394044 | Down | 5.63 × 10−6 |
Upregulated miRNA | Number | Downregulated miRNA | Number |
---|---|---|---|
hsa-miR-10526-3p | 591 | hsa-miR-4429 | 1047 |
miR-90 | 447 | miR-28 | 769 |
miR-710 | 214 | hsa-miR-4709-3p | 759 |
miR-1133 | 132 | miR-1226 | 668 |
hsa-miR-7854-3p | 596 | ||
miR-1259 | 593 | ||
miR-556 | 551 | ||
miR-363 | 524 | ||
miR-1225 | 381 | ||
hsa-miR-5009-5p | 338 | ||
miR-950 | 263 | ||
miR-658 | 45 | ||
hsa-miR-6803-3p | 38 | ||
Total | 1384 | Total | 6572 |
Upregulated miRNAs | Downregulated miRNAs | ||
---|---|---|---|
Gene Symbol | Degree | Gene Symbol | Degree |
EGFR | 121 | CTNNB1 | 487 |
HSP90AA1 | 110 | EGFR | 422 |
ESR1 | 98 | PTEN | 320 |
MAPK1 | 79 | VEGFA | 263 |
PIK3CA | 72 | HSPA4 | 259 |
SIRT1 | 71 | CDH1 | 255 |
AR | 64 | CREBBP | 253 |
CDH1 | 64 | CCND1 | 245 |
HIF1A | 61 | BRCA1 | 241 |
FOXO3 | 57 | HIF1A | 238 |
SRSF1 | 56 | MAPK1 | 224 |
PTK2 | 56 | PIK3CA | 222 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Othman, N.S.; Aminuddin, A.; Zainal Abidin, S.; Syafruddin, S.E.; Ahmad, M.F.; Mohd Mokhtar, N.; Kumar, J.; Hamid, A.A.; Ugusman, A. Profiling of Differentially Expressed MicroRNAs in Human Umbilical Vein Endothelial Cells Exposed to Hyperglycemia via RNA Sequencing. Life 2023, 13, 1296. https://doi.org/10.3390/life13061296
Othman NS, Aminuddin A, Zainal Abidin S, Syafruddin SE, Ahmad MF, Mohd Mokhtar N, Kumar J, Hamid AA, Ugusman A. Profiling of Differentially Expressed MicroRNAs in Human Umbilical Vein Endothelial Cells Exposed to Hyperglycemia via RNA Sequencing. Life. 2023; 13(6):1296. https://doi.org/10.3390/life13061296
Chicago/Turabian StyleOthman, Nur Syakirah, Amilia Aminuddin, Shahidee Zainal Abidin, Saiful Effendi Syafruddin, Mohd Faizal Ahmad, Norfilza Mohd Mokhtar, Jaya Kumar, Adila A. Hamid, and Azizah Ugusman. 2023. "Profiling of Differentially Expressed MicroRNAs in Human Umbilical Vein Endothelial Cells Exposed to Hyperglycemia via RNA Sequencing" Life 13, no. 6: 1296. https://doi.org/10.3390/life13061296
APA StyleOthman, N. S., Aminuddin, A., Zainal Abidin, S., Syafruddin, S. E., Ahmad, M. F., Mohd Mokhtar, N., Kumar, J., Hamid, A. A., & Ugusman, A. (2023). Profiling of Differentially Expressed MicroRNAs in Human Umbilical Vein Endothelial Cells Exposed to Hyperglycemia via RNA Sequencing. Life, 13(6), 1296. https://doi.org/10.3390/life13061296