Next Article in Journal
Cold-Stimulus Headache in Children and Adolescents
Next Article in Special Issue
Molecular Prevalence and Genetic Diversity Based on Msp1a Gene of Anaplasma ovis in Goats from Türkiye
Previous Article in Journal
Therapeutic Efficiency of Humic Acids in Intoxications
Previous Article in Special Issue
Molecular Detection of Rickettsia and Other Bacteria in Ticks and Birds in an Urban Fragment of Tropical Dry Forest in Magdalena, Colombia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 13
Issue 4
10.3390/life13040972
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity of Borreliaceae Species Detected in Natural Populations of Ixodes ricinus Ticks in Northern Poland

by
Beata Wodecka
* and
Valentyna Kolomiiets
Department of Genetics and Genomics, Institute of Biology, Szczecin University, 71-415 Szczecin, Poland
*
Author to whom correspondence should be addressed.
Life 2023, 13(4), 972; https://doi.org/10.3390/life13040972
Submission received: 2 March 2023 / Revised: 30 March 2023 / Accepted: 6 April 2023 / Published: 9 April 2023
(This article belongs to the Special Issue Tick-Transmitted Diseases)
Browse Figures
Versions Notes

Abstract

:
In Europe, Ixodes ricinus tick is the vector of Lyme disease spirochetes and their relatives (Borreliella genus) and Borrelia miyamotoi. However, a newly described tick I. inopinatus with similar biological features and separated from I. ricinus may act as a vector for different Borrelia species. To date, eleven Borreliella species were detected in the natural populations of I. ricinus. Recently, two North American species have been detected in ticks parasitizing bats and red foxes in Europe, i.e., B. lanei and B. californiensis pointing to the necessity for searching for them in natural tick populations. In this study, using the coxI molecular marker only I. ricinus was identified in field-collected ticks with the exception of individual specimens of Haemaphysalis concinna. Using the flaB gene and mag-trnI intergenic spacer as molecular markers 14 Borreliaceae species have been detected with various frequencies in different parts of northern Poland. Among infected ticks, the most frequent were Borreliella (Bl.) afzelii (29.4%) and Bl. garinii (20.0%), followed by Bl. spielmanii, Bl. valaisiana, Bl. lanei, Bl. californiensis, B. miyamotoi, Bl. burgdorferi, Bl. carolinensis, Bl. americana, B. turcica, Bl. lusitaniae, Bl. bissettiae and Bl. finlandensis. Three of the above-mentioned species, i.e., Bl. lanei, Bl. californiensis and B. turcica were detected in this study for the first time in the natural ixodid tick population in Europe. The existence of the newly detected spirochetes increases their total diversity in Europe and points to the necessity of careful identification and establishment of the actual distribution of all Borreliaceae species transmitted by I. ricinus.

1. Introduction

One of the most common tick-borne diseases within the Northern Hemisphere is Lyme borreliosis (LB) caused by spirochetes belonging to Borreliella genus [1,2], formerly Borrelia burgdorferi sensu lato (s.l.) complex, the bacteria belonging to Borreliaceae family [3]. The European incidence of LB consists of more than 200,000 annual cases with considerable regional differences [4]. In Poland, there were over 20,000 LB cases in 2019 [5]. The principal vector of LB spirochetes in Europe is the common tick (Ixodes ricinus) which is found mainly in deciduous and mixed forests willingly treated by humans as recreational places [6].
To date, 14 different species of the Borreliella genus have been reported in Europe, but only eleven have been detected in host seeking I. ricinus, i.e., Borreliella (Bl.) garinii, Bl. afzelii, Bl. burgdorferi, Bl. valaisiana, Bl. lusitaniae, Bl. bissettii, Bl. spielmanii, Bl. bavariensis, Bl. finlandensis, Bl. carolinensis and Bl. americana [7,8,9,10]. The twelfth is Bl. turdi, detected only in I. ricinus collected from birds [9,11,12]. Bl. finlandensis, Bl. carolinensis, Bl. turdi, and Bl. americana are not considered pathogenic for humans [13]. Two other Borreliella species, i.e., Bl. lanei and Bl. californiensis were recently described in ticks collected from bats in Poland and Romania and from red foxes in Poland [14,15].
Borreliella afzelii and Bl. garinii are the most frequent species in ticks and the most causative factors of LB in humans [13,16]. The two mentioned species are associated in Europe with specific clinical manifestations: Bl. garinii with neuroborreliosis and Bl. afzelii with acrodermatitis chronica atrophicans, but also may include less specific symptoms [17]. Bl. burgdorferi seems to be the most causative species in North America with the symptoms of Lyme arthritis and Lyme neuroborreliosis; in Europe, it is the species of less concern [13]. The other five Borreliella species possess pathogenic potential, that is Bl. valaisiana, Bl. lusitaniae, Bl. bissettiae, Bl. spielmanii, and Bl. bavariensis [13].
Additionally, in Europe I. ricinus is also a vector tick for another Borreliaceae family member of the genus Borrelia, i.e., B. miyamotoi, classified as relapsing fever-like spirochetes [18] and causing Borrelia miyamotoi disease, BMD [19]. B. miyamotoi is reported in Europe for the last twenty years [18,20,21,22,23]. The symptoms of BMD consist mainly of relapsing fever and non-specific flu-like illness but less specific neurological symptoms are also reported [24].
Recently, North American studies on the modified serological procedure for the detection of antibodies of LB and relapsing fever (RF) causative agents demonstrated in patients with symptoms of tick-borne diseases, the presence not only of Bl. burgdorferi antibodies but also other pathogenic and non-pathogenic Borreliella and Borrelia species [25]. Among the pathogenic were the European LB species Bl. afzelii, Bl. garinii and Bl. spielmanii but also B. miyamotoi—the relapsing fever-like spirochete causing BMD. Among the non-pathogenic Borreliaceae species detected in patients with tick-borne disease symptoms were Bl. californiensis and B. turcica [25]. Bl. californiensis is the fourteenth LB species detected in Europe but only in ticks infesting foxes and the individual tick infected with B. turcica was also reported in this study [15]. According to above-mentioned data among the 14 Borreliella species detected in Europe Bl. finlandensis, Bl. carolinensis, B. turdi, Bl. lanei, and Bl. americana were not isolated from humans [13,25,26].
The knowledge about the local distribution of Borreliaceae species is crucial for the risk assessment of infection; the study of Fesler et al. [25] mentioned above points to the new species with pathogenic potential. Therefore, the most important aspect in the study of Borreliaceae species distribution in ticks populations is their precise differentiation to make the possible distinction between pathogenic and non-pathogenic species and point to the most prevalent in the studied localities. For this reason, the aim of the study was the assessment of the number and the prevalence of Borreliaceae species in natural populations of ticks in seven recreational localities of northern Poland. Two molecular markers described elsewhere [15] were used to make the identification of Borreliaceae species precise and reliable.

2. Material and Methods

Study sites and collection of Ixodes ricinus. Ticks were collected on seven localities in northern Poland including three voivodships localized in the humid continental climatic zone with warm summers: West Pomerania (five study sites), Pomerania and Warmia-Masuria (one study site each, Figure 1). Study sites in West Pomerania were located inside four forest complexes: Wkrzańska Forest (Bartoszewo and Lubieszyn), Goleniów Forest (Zielonczyn), Ińsko Landscape Park (Ciemnik) and Drawsko Landscape Park (Świerznica, Figure 1). In the Pomerania voivodship, the study site was located in Tricity Landscape Park containing the southern part of Gdańsk. In the Warmia-Masuria voivodship, the locality of the study site was on the west shore of Bełdany Lake (Figure 1). All mentioned localities consisted of mixed forest formed mainly by common oak (Quercus robur), European beech (Fagus sylvatica), Norway spruce (Picea abies), Scots pine (Pinus sylvestris) and a well-developed understory. The localities are also recreational areas for the nearby inhabitants and are often visited by strollers and mushroom pickers.
In total, 2188 specimens of ticks were collected, including 96 females, 132 males, 1524 nymphs and 436 larvae. Ticks were collected once from each study site by sweeping up the vegetation up to 1 m with a flannel flag during the middle of May in the years 2016 (Bartoszewo, Bełdany Lake, Zielonczyn) and 2017 (Ciemnik, Gdańsk, Lubieszyn, Świerznica). Ticks were removed from the flag with tweezers, placed in Eppendorf tubes containing 70% ethanol and stored at −20 °C until the next study.
Morphological tick identification. As morphological identification of adult ticks is easier than immature stages, females and males were determined using the taxonomic keys by Siuda [27] and Estrada-Pena et al. [28]. Molecular procedures were then used for verifying and confirming adult tick morphological identification and for the species determination of immature stages.
DNA extraction. DNA extraction from host-seeking ticks was performed with a phenol-chloroform protocol [29]. All tick individuals (larva, nymph or adult) were crushed through high-speed shaking (50 Hz for 5 min) in plastic tubes with stainless steel suspended in 100 mL of PBS buffer using TissueLyser LT (Qiagen, Hilden, Germany). Next, 500 mL of 29 buffer (0.19 M NH4Cl, 0.011 M KHCO3 and 0.024 M EDTA), 100 mL of Lysis buffer (0.017 M SDS, 0.01 M TRIS, 0.01 M EDTA) and 1 mL of Proteinase K (20 mg/mL) (BioShop, Burlington, ON, Canada) were added. Subsequently, ticks were placed in a 56 °C water bath for 3 h. Following the incubation, 300 mL of phenol (BioShop) was added, and the tube was vortexed for 30 s and centrifuged for 10 min at 9000 rpm. The supernatant was transferred successively to three additional tubes containing 400 mL of phenol–chloroform (1:1) and 300 mL of chloroform (POCH, Gliwice, Poland) (twice), then vortexed for 30 s and centrifuged for 10 min at 9000 rpm. Finally, the supernatant was transferred to the last tube, and DNA was precipitated by adding 500 mL of isopropanol (POCH). The pellet was rinsed with 70% ethanol and air-dried before suspension in Tris–EDTA (TE) buffer (pH 8.0). DNA samples were stored at −70 °C before PCR analyses.
Molecular tick identification. To confirm the accuracy of morphological tick identification according to taxonomic keys, a nested PCR assay based on the mitochondrial cytochrome c oxidase subunit I (coxI) molecular marker and primer sets was used, as described elsewhere [15] (Table 1).
In the first stage, including all tick specimens, molecular identification was performed based on PCR-restriction fragment length polymorphism analysis (PCR-RFLP). PCR-amplified sequences of the coxI gene generated with primers CO1-375F and CO1-1086R were digested with enzyme HpyF3I (Thermo Fisher Scientific, Waltham, MA, USA) to obtain RFLP patterns for different Ixodidae species. In the second stage, to validate the identification conducted by PCR-RFLP analysis of the coxI gene, partial sequencing of Ixodidae DNA of coxI fragments amplified with inner primer sets CO1-375F and CO1-1086R was performed for a subset of amplicons representing different restriction patterns. Sequencing was conducted in Macrogen Europe (Amsterdam, The Netherlands). Representative partial sequences (n = 10) were deposited in GenBank. The coxI sequences are listed as follows: OP882699-OP882707 (I. ricinus), OP882708 (Haemaphysalis concinna).
We conducted the detection of Borreliaceae spirochetes DNA by nested PCR and species identification by the PCR-RFLP procedure and sequence length polymorphism. Nested PCR procedures with two primer sets were used to detect the flaB gene fragments and the intergenic spacer fragments between mag and trnI genes of Borreliaceae spirochetes [15,20] (Table 1). In each PCR run, DNA was isolated from one of the reference strains representing Bl. burgdorferi IRS, Bl. garinii 20047, Bl. afzelii VS461, Bl. valaisiana VS116, Bl. bissettii DN127, Bl. spielmanii PC-Eq17, Bl. californiensis CA446, Bl. carolinensis SCW-22, Bl. lanei CA28, Bl. americana CA8 or B. turcica IST7 (German Collection of Microorganisms and Cell Cultures—DSMZ, Leibniz, Germany) was used as the positive control and TE buffer as a negative control. The PCR products were separated on 1.5% agarose gel (Bioshop, Boston, MA, USA) and archived as described elsewhere [30]. The DNA fragments of the flaB gene amplified with primers 220f and 823r were digested with enzyme HpyF3I (Thermo Fisher Scientific, Waltham, MA, USA) to differentiate the RFLP patterns of Borrelia species as described earlier [31] and one of specified, i.e., PsuI, SatI or VspI (Thermo Fisher Scientific, Table 2). As the modification of using the Ecl136II restriction enzyme [31], PsuI allowed differentiating between Bl. garinii and Bl. bavariensis, SatI enabled distinguishing Bl. burgdorferi not only from Bl. finlandensis but also from Bl. americana and VspI was used to differentiate Bl. californiensis and Bl. turdi (Table 2). The DNA fragments of mag-trnI intergenic spacer amplified with primers glz435f and ile65r represent different lengths of sequence depending on Borreliaceae species (Table 1).
Borreliaceae DNA sequencing, sequences alignment and analysis of genetic diversity. Partial sequencing of flaB gene fragments obtained with primer pairs FL84F/FL976R and FL120F/FL908R and mag-trnI intergenic spacer fragments of Borreliaceae family members (Table 1) was performed for positive amplicons. DNA sequencing was performed in Macrogen Europe (Netherlands). Sequencing analyses revealed distinct patterns representing different species of the Borreliaceae family.
One hundred and one flaB gene sequences and eighty sequences of the mag-trnI intergenic spacer of Borreliaceae spirochetes were deposited in GenBank. The flaB gene sequences are listed as follows: MK604253-MK604264 (Bl. garinii), MK604265-MK604271 (Bl. afzelii), MK604272-MK604273, OP879323-OP879325 (Bl. burgdorferi), MK604274-MK604286, OP879326-OP879329 (Bl. valaisiana), MK604287-MK604288 (Bl. lusitaniae), MK604289-MK604300, OP879330 (Bl. spielmanii), MZ146997-MZ146998 (Bl. bissettiae), MK604301 (Bl. finlandensis), MK604302-MK604304, OP879331 (Bl. californiensis), MK604305-MK604312 (Bl. carolinensis), MK604313-MK604329 (Bl. lanei), MK604330-MK604331 (Bl. americana), MK604332, OP879332-OP879333 (B. turcica), MK604451-MK604458 (B. miyamotoi). The sequences of mag-trnI intergenic spacer are listed as follows: MZ146969-MZ146972, OP879334-OP879336 (Bl. garinii), MZ146928-MZ149941 (Bl. afzelii), MZ146947-MZ146951, OP879337 (Bl. burgdorferi), MK604274-MK604286, OP879338-OP879340 (Bl. valaisiana), MZ146973-MZ146974 (Bl. lusitaniae), MZ146978-MZ146979, OP879341-OP879344 (Bl. spielmanii), MZ146952-MZ146955 (Bl. bissettiae), MZ146965-MZ146968 (Bl. finlandensis), MZ146956-MZ146962 (Bl. californiensis), MZ146963-MZ146964 (Bl. carolinensis), MZ146975-MZ146977 (Bl. lanei), MZ146942-MZ146946 (Bl. americana), MZ146993-MZ146996 (B. turcica), MZ146983-MZ146992 (B. miyamotoi).
The obtained sequences were compared to those of reference strains from GenBank (Table 3). Aligned sequences representing flaB gene fragments and the mag-trnI intergenic spacer of the aforementioned Borreliaceae strains were examined with MEGA 11 software (Molecular Evolutionary Genetics Analysis, version 11) [32]. Relationships between individuals were assessed by distance estimation between sequences as a measure of the number of allelic substitutions on selected loci. They were obtained by dividing the number of nucleotide differences by the total number of nucleotides compared. Distance values were measured as the mean distance within each group representing separate species (a measure of diversity inside a species) and as the mean distance between species (a measure of diversity between two species). Distances were computed with the Tamura 3-parameter model using a maximum likelihood (ML) method [32] with 1000 bootstrap replicates. The MEGA analytic tool of model selection was applied to choose the best model of DNA analysis and the Tamura 3-parameter model was used to compute the distance values and construct ML phylogenetic tree on the basis of the flaB gene or Hasegawa–Kishino–Yano model to construct the tree on the basis of mag-trnI intergenic spacer.
Statistical analyses. Borreliaceae spirochetes prevalence was analyzed in ticks using the chi-square test with Yates’ correction. Differences in mean intensity of tick infestation in the Mann–Whitney U test with p < 0.05 were considered statistically significant. All calculations were conducted using Statistica 8.0 software (StatSoft Inc., Tulsa, OK, USA).

3. Results

Identification of tick species collected in northern Poland. Among 2188 ixodid ticks collected (96 females, 132 males, 1524 nymphs and 436 larvae) 2187 represented I. ricinus species and one nymph Haemaphysalis concinna according to the molecular data obtained on the basis of coxI gene PCR-RFLP analysis and sequencing.
Detection of Borreliaceae DNA in field collected I. ricinus. The DNA of Borreliaceae spirochetes was detected in 416 of 2187 I. ricinus (19.0%) and the DNA of spirochetes was detected at all study sites ranging from 8.3% to 32.6% (Table 4). The infection rate was the lowest in the case of larvae (6.9%), and the highest in the case of imago (24.1%, Table 4). The exception was the infection of larvae at the Lubieszyn study site (53.3%) and nymphs at the Świerznica locality (40.1%, Table 4).
Identification of Borreliaceae species in ticks collected in northern Poland. Digestion of PCR product with enzyme HpyF3I and, if needed, PsuI, SatI or VspI allows for the identification of 14 Borreliaceae species (Table 5). The two most identified species were Bl. afzelii (29.4% of infected I. ricinus, including co-infections) and Bl. garinii (20.0% with co-infections, Table 5). The next was Bl. spielmanii (11.3% with co-infections) followed by Bl. valaisiana (9.4% including co-infections), Bl. lanei (7.7% with co-infections), Bl. californiensis (7.5% including co-infections), B. miyamotoi (6.3% including one co-infection), Bl. burgdorferi (6.0% with co-infections), Bl. carolinensis (3.1% including one co-infection), Bl. americana (1.9%), B. turcica (1.7% with co-infections), Bl. lusitaniae (1.4% including one co-infection), Bl. bissettiae (1.0%) and Bl. finlandensis (1.0% including one co-infection, Table 5). Out of the 415 infected ticks, 31 (7.5%) yielded mixed infections and as much as 23 comprised Bl. garinii and Bl. afzelii or included one of the mentioned species (Table 5).
Among 14 identified Borreliaceae species three were detected at all study sites, i.e., Bl. afzelii, Bl. garinii and Bl. valaisiana. Next, Bl. spielmanii was detected at six study sites, Bl. burgdorferi, Bl. californiensis, Bl. lanei and Bl. miyamotoi were detected at five study sites, whereas Bl. americana and B. turcica were detected at four, Bl. lusitaniae and Bl. carolinensis were detected at three, Bl. finlandensis was detected at two and Bl. bissettiae at individual study sites (Table 5). Out of the 14 identified species, five, Bl. spielmanii, Bl. lanei, Bl. californiensis, Bl. finlandensis and B. turcica were detected for the first time in the natural population of I. ricinus in Poland. Furthermore, Bl. californiensis, Bl. lanei and B. turcica were detected in field-collected I. ricinus for the first time in Europe.
Eight identified spirochete species, i.e., Bl. garinii, Bl. afzelii, Bl. valaisiana, Bl. spielmanii, Bl. californiensis, Bl. lanei, Bl. americana, and B. miyamotoi were detected in each developmental stage including larvae (Table 5). Four species were detected in two stages, i.e., B. turcica in nymphs and individual larva whereas Bl. burgdorferi, Bl. lusitaniae and Bl. finlandensis in imago and nymphs. Bl. bissettiae and Bl. carolinensis were detected only in nymphs (Table 5).
Genetic diversity of Borreliaceae species detected in I. ricinus. Analysis of 101 flaB gene fragment sequences and comparison with reference strains confirmed the genetic identity of each species identified using the PCR-RFLP protocol. The mean genetic distance within identified spirochete species ranged from 0.0 for Bl. americana and Bl. lanei to 0.0119 for B. miyamotoi (Table S1) whereas the distance between spirochete species ranged from 0.008 for Bl. carolinensis and Bl. bissettiae to 0.0711 for Bl. finlandensis and Bl. spielmanii inside the Borreliella genus and from 0.1588 for Bl. valaisiana and B. turcica to 0.1988 for Bl. californiensis and B. miyamotoi when individual Borreliella and Borrelia species were compared (Table S2). The distance between two identified Borrelia species came to 0.146 (Table S2). The highest diversity in the studied species was in B. miyamotoi when compared to strains from different continents (0.0119).
The genetic identity of the detected Borreliaceae species was also confirmed by analysis of 80 sequences of intergenic spacer between mag and trnI genes. The diversity ranges in this analysis including distances inside and between individual species was not comparable with those obtained on the basis of the flaB gene. The mean genetic distance within identified spirochete species ranged from 0.0 for Bl. lusitaniae to 0.0337 for Bl. garinii (Table S3) whereas the distance between spirochete species ranged from 0.032 for Bl. burgdoeferi and Bl. finlandensis to 0.2433 for Bl. afzelii and Bl. bissettiae inside the Borreliella genus and from 0.3754 for Bl. americana and B. turcica to 0.454 Bl. afzelii and B. miyamotoi when individual Borreliella and Borrelia species were compared (Table S4). The distance between two identified Borrelia species came to 0.2674 (Table S4). The highest diversity ever in the present study was in the case of Bl. garinii when compared to strains from Europe and Asia (0.0377).
Phylogenetic analysis carried out on the basis of flaB gene sequences as well as mag-trnI intergenic spacer sequences confirmed the identity of each studied species as they grouped separately from each other giving independent branches on both dendrograms (Figure 2 and Figure 3). All twelve Borreliella species formed separate groups from species of the Borrelia genus, but relations between Borreliella species differed when the flaB gene and mag-trnI intergenic spacer were analyzed. The analysis of flaB gene sequences revealed three subgroups formed inside Borreliella according to their geographic range. Thus, one subgroup comprised three Eurasian species (Bl. garinii, Bl. afzelii, Bl. valaisiana) and one European (Bl. spielmanii), the second—six European and North American species (Bl. burgdorferi, Bl. californiensis, Bl. carolinensis, Bl. bissettiae, Bl. lanei, and Bl. americana) and one European (Bl. finlandensis), and the third Bl. lusitaniae found in Europe and North Africa (Figure 2). In the case of Bl. californiensis detected in this study for the first time in Europe, the obtained sequences represented different genotypes from the reference strain (Figure 2).
Contrary to the flaB gene analysis dendrogram established based on the mag-trnI intergenic spacer revealed different relations between Eurasian Borreliella species. They formed three groups, one comprised of Bl. valaisiana and Bl. lusitaniae, the second was formed separately by Bl. garinii and the third by Bl. afzelii and Bl. spielmanii (Figure 3).

4. Discussion

In Europe, the most frequent tick species and also the main vector of Borreliaceae spirochetes is the common tick I. ricinus. This tick species occurs in deciduous and mixed forests and an increasing number of human residential areas in the vicinity of the natural tick habitat and the continuing warming of the climate promote exposure to tick bites. The distribution range of I. ricinus reaches the north of Africa where a new morphological form of this species was detected with accompanying molecular diversity and classified as new species I. inopinatus [28]. The new species was also found in different European countries, i.e., Germany, Austria, Romania and Switzerland and represented 0.9–7.9% of the tick population [33,34,35,36,37,38,39,40]. Therefore molecular identification of ixodid ticks was the part of present work. The PCR-RFLP and sequencing analysis of mitochondrial coxI gene revealed, however, that except for one specimen of Haemaphysalis concinna nymph, the rest of the examined ticks were identified as I. ricinus. H. concinna and were found in western and southern Poland with limited incidence [41,42,43]. The first description of H. concinna was made in north-western Poland [44] near Zielonczyn, where the tick was found in the present study.
The DNA of Borreliaceae spirochetes was detected in 19.0% of I. ricinus and ranged at all collection sites between 8.3% and 32.6% (Table 3). The infection rate obtained in this study fits into the range between 3.7% and 38.1% established for the European tick populations examined in the last ten years including Poland [16,40,45,46,47,48,49,50,51,52,53].
So far, 16 Borreliaceae species have been detected in ixodid ticks in Europe including 12 species found in field-collected I. ricinus, i.e., Borreliella afzelii, Bl. garinii, Bl. burgdorferi, Bl. valaisiana, Bl. lusitaniae, Bl. spielmanii, Bl. bissettiae, Bl. bavariensis, Bl. finlandensis, Bl. carolinensis, Bl. americana and Borrelia miyamotoi [10,16,40,45,46,47,48,49,50,53]. Among the above mentioned only Bl. finlandensis, Bl. carolinensis and Bl. americana are not recognized as pathogenic [13,54,55]. Two other species, Bl. turdi and Bl. californiensis were detected in I. ricinus collected from birds and foxes, respectively [11,15]. The last two, Bl. lanei, and B. turcica were detected in ixodid tick species that specifically feed on bats and/or foxes [14,15]. A North American study of novel serological tests for the detection of Borreliaceae spirochetes points to the possible pathogenicity of the B. californiensis and B. turcica [25].
This precise identification of Borreliaceae spirochetes revealed 14 of 16 mentioned species with differential distribution and prevalence depending on distinct parts of Northern Poland. The most prevalent species in this study were Bl. afzelii and Bl. garinii (29.4% and 20% of infected ticks, respectively) and are the acclaimed predominant European Borreliella species including in Poland [16,40,47,49,50,51]. The next was Bl. Spielmanii (11.3%) an infrequent species in Europe and Bl. Valaisiana (9.4%), frequently detected in Germany, England, Slovakia, Moldova and Norway [16,40,45,47,50]. Unexpectedly, the next species were Bl. lanei and Bl. californiensis (7.7% and 7.5%, respectively). To the best of our knowledge, this is the first detection of these species in field-collected ticks from Poland and Europe. Two other species in the present study, i.e., B. miyamotoi (6.3%) and Bl. burgdorferi (6%) occur in many European countries including Poland [16,46,47,49,50,51,53]. On the contrary, the next two species, Bl. carolinensis (3.1%) and Bl. americana (2%) are detected in Europe only incidentally [7,10,56]. One of the rarest species in this study was B. turcica (1.7% of infected ticks). This species was originally isolated from the turtle-associated tick Hyalomma aegyptium [57] but recently it was found in I. kaiseri larva obtained from a red fox [15]. This is the third spirochete species in the present study detected for the first time in field-collected I. ricinus. The next species, Bl. lusitaniae (1.4%) is the main Borreliella species in southern Europe [16,48] and is relatively rare in the central and northern parts of the continent [16,40,46,47,49,50,51]. The last in this study, Bl. bissettiae and Bl. finlandensis (1% both) are detected incidentally in I. ricinus [16,46]. Specified incidence of Borreliaceae species include also co-infections (7.5% of infected ticks) that may become potential diagnostic difficulties, especially since three-quarters of detected mixed infections comprised Bl. garinii and/or Bl. afzelii acclaimed as the main pathogenic species in Europe [13,54]. Present results of mixed infections do not differ from other European studies that range from 1.2% to 13.6% [46,47,49,51].
Among the 14 identified spirochete species four of the most prevalent were found in every (Bl. afzelii, Bl. garinii and Bl. valaisiana) or almost every (Bl. spielmanii) study location. The remaining ten species were present on five (Bl. bugdorferi, Bl. californiensis, Bl. lanei and B. miyamotoi), four (Bl. americana and B. turcica), three (Bl. lusitaniae and Bl. carolinensis), two (Bl. finlandensis) or one study site (Bl. bissettiae) and statistically significant differences concerned the distribution of almost all species on particular study sites. The statistically significant differences were not observed only in the case of Bl. lusitaniae; the infection rate was similarly low on three study sites where it was detected. The presented study revealed a zonal distribution of different spirochete species from the Borreliaceae family in Northern Poland not only by the presence or absence of particular species but also by differences in infection rates that correlate with different risks of human and animal infection. Similar differences in the distribution and infection rates are observed in other European studies [45,46,47,51,58,59,60] but also in the case of different Borreliaceae species characteristics for Asia [61,62] and North America [63,64,65]. The cause of such zonality may be host specific, especially in the case of Borreliella species [66], and due to the differential availability in the studied area but not the climatic conditions which are similar for the entire area of research.
The analysis of variability of identified spirochete species revealed the differences in the case of both examined markers or only one of them (Bl. lusitaniae, Bl. americana, Bl. lanei). Each species demonstrated genetic distinctiveness from the others and genetic distance inside species was lower than the distance between the particular species. The distances inside and between species were also discernible on dendrograms established on the basis of the flaB gene and mag-trnI intergenic spacer. The diversity of Borreliaceae species noted in this study is also observed by other researchers [40]. It is, however, essential that in the present study the diversity was similar to that observed for the known European Borreliella species and was established for spirochete species detected for the first time in the natural populations of I. ricinus. This finding suggests the existence of newly detected spirochetes in Europe as the remaining European Borreliella species. Borreliella californiensis and Bl. lanei were detected for the first time in natural populations of I. ricinus and are closely related to Bl. burgdorferi, together with Bl. bissettiae, Bl. carolinensis and Bl. americana which are distributed in Europe and North America and also with Bl. finlandensis which is only from Europe and Bl. kurtenbachii which is detected only in North America [6]. According to the concept of Borreliaceae spirochetes evolution proposed by Estrada-Pena et al. [67], the common ancestor of the mentioned species might have existed in Laurasia before its split into North America and Eurasia.
It is worth to pay the attention to molecular markers used in this study for the detection of Borreliaceae DNA. In this study, markers were applied to allow for the detection of all the representatives of the Borreliaceae family in a nested PCR procedure with subsequent species identification by restriction analysis or by discrimination of the PCR product length. This procedure allows for avoiding results with undefined Borreliella species that occur in the case of using less variable molecular markers for standard PCR or species-specific probes for real-time PCR procedure [53,56,60,61,68]. The approach used in this study ensures identifying all PCR products so it allows for the assessment of the real representation of particular spirochete species in examined tick populations. Using such precise procedures is crucial for establishing the real distribution of Borreliaceae species, especially in light of the latest findings pointing to new potential spirochete species with possible medical importance [25].

5. Conclusions

The study of a natural population of I. ricinus in northern Poland proved the existence of the majority of the described European Borreliella species with the exclusion of two species that were described incidentally, i.e., B. bavariensis [31,51] and B. turdi [11]. The present study proved not only the predominant prevalence of B. afzelii and B. garinii in ticks from Poland [30,49,51,52] but also the existence of two North American Borreliella species in host-seeking ticks in Europe, namely B. californiensis and B. lanei. The detection of many Borreliella species in natural tick populations may affect the assessment of the risk of their transmission to humans especially as the present study concerned locations willingly visited by humans.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/life13040972/s1, Table S1: flaB gene mean genetic distance within individual Borreliaceae species detected in host seeking ticks from Northern Poland; Table S2: MEGA 11 results of mean distance between Borreliaceae species obtained on the basis of flaB gene sequence fragment comparison; Table S3: mag-trnI intergenic spaces mean genetic distance within individual Borreliaceae species detected in host seeking ticks from Northern Poland; Table S4: MEGA 11 results of mean distance between Borreliaceae species obtained on the basis of intergenic spacer (IGS) of 3-methyladenine glycosylase (mag) and tRNA-Ile (trnI) genes sequence fragment comparison.

Author Contributions

Conceptualization, B.W. and V.K.; methodology, B.W.; software, B.W. and V.K.; validation, B.W. and V.K.; formal analysis, B.W.; investigation, B.W. and V.K.; resources, B.W.; data curation, B.W.; writing—original draft preparation, B.W.; writing—review and editing, B.W. and V.K.; visualization, B.W. and V.K.; supervision, B.W.; project administration, B.W.; funding acquisition, B.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Grant No. N N303 806140 from the National Science Centre, Kraków, Poland.

Institutional Review Board Statement

The study was not conducted on live animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its supplementary information file. The accession numbers of DNA sequences obtained for ticks and bacteria are mentioned in Material and Methods and are available in the GenBank (https://ww.ncbi.nlm.nih.gov/nuccore, accessed on 28 November 2022).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Adeolu, M.; Gupta, R.S. A phylogenomic and molecular marker based proposal for the division of the genus Borrelia into two genera: The emended genus Borrelia containing only the members of the relapsing fever Borrelia, and the genus Borreliella gen. nov. containing the members of the Lyme disease Borrelia (Borrelia burgdorferi sensu lato complex). Antonie van Leeuwenhoek 2014, 105, 1049–1072. [Google Scholar] [CrossRef] [PubMed]
  2. Arahal, D.R.; Bull, C.T.; Busse, H.; Christensen, H.; Chuvochina, M.; Dedysh, S.N.; Fournier, P.; Konstantinidis, K.T.; Parker, C.T.; Rossello-Mora, R.; et al. Judicial Opinions 123-127. Int. J. Syst. Evol. Microbiol. 2022, 72, 005708. [Google Scholar] [CrossRef] [PubMed]
  3. Gupta, R.S.; Mahmood, S.; Adeolu, M. A phylogenomic and molecular signature based approach for characterization of the phylum Spirochaetes and its major clades: Proposal for a taxonomic revision of the phylum. Front. Microbiol. 2013, 4, 217. [Google Scholar] [CrossRef] [Green Version]
  4. Sykes, R.A.; Makiello, P. An estimate of Lyme borreliosis incidence in Western Europe. J. Public Health 2017, 39, 74–81. [Google Scholar] [CrossRef] [Green Version]
  5. Czarkowski, M.P.; Staszewska-Jakubik, E.; Wielgosz, U. Infectious Diseases and Poisonings in Poland in 2020; National Institute of Public Health: Warsaw, Poland, 2021. [Google Scholar]
  6. Trevisan, G.; Cinco, M.; Trevisini, S.; di Meo, N.; Chersi, K.; Ruscio, M.; Forgione, P.; Bonin, S. Borreliae Part 1: Borrelia Lyme Group and Echidna-Reptile Group. Biology 2021, 10, 1036. [Google Scholar] [CrossRef] [PubMed]
  7. Cotté, V.; Bonnet, S.; Cote, M.; Vayssier-Taussat, M. Prevalence of five pathogenic agents in questing Ixodes ricinus ticks from western France. Vector Borne Zoonotic Dis. 2010, 10, 723–730. [Google Scholar] [CrossRef]
  8. Lommano, E.; Bertaiola, L.; Dupasquier, C.; Gern, L. Infections and coinfections of questing Ixodes ricinus ticks by emerging zoonotic pathogens in Western Switzerland. Appl. Environ. Microbiol. 2012, 78, 4606–4612. [Google Scholar] [CrossRef] [Green Version]
  9. Heylen, D.; Fonville, M.; van Leeuwen, A.D.; Stroo, A.; Duisterwinke, M.; van Wieren, S.; Diuk-Wasser, M.; de Bruin, A.; Sprong, H. Pathogen communities of songbird-derived ticks in Europe’s low countries. Parasit. Vectors. 2017, 10, 497–508. [Google Scholar] [CrossRef]
  10. Dunaj, J.; Drewnowska, J.; Moniuszko-Malinowska, A.; Swięcicka, I.; Pancewicz, S. First metagenomic report of Borrelia americana and Borrelia carolinensis in Poland—A preliminary study. Ann. Agric. Environ. Med. 2021, 28, 49–55. [Google Scholar] [CrossRef]
  11. Gryczyńska, A.; Welc-Falęciak, R. Long-term study of the prevalence of Borrelia burgdorferi s.l. infection in ticks (Ixodes ricinus) feeding on blackbirds (Turdus merula) in NE Poland. Exp. Appl. Acarol. 2016, 70, 381–394. [Google Scholar] [CrossRef] [Green Version]
  12. Wilhelmsson, P.; Jaenson, T.G.T.; Olsen, B.; Waldenström, J.; Lindgren, P.E. Migratory birds as disseminators of ticks and the tick-borne pathogens Borrelia bacteria and tick-borne encephalitis (TBE) virus: A seasonal study at Ottenby Bird Observatory in South-eastern Sweden. Parasit. Vectors 2020, 13, 607. [Google Scholar] [CrossRef]
  13. Rudenko, N.; Golovchenko, M.; Grubhoffer, L.; Oliver, J.H., Jr. Borrelia carolinensis sp. nov., a novel species of the Borrelia burgdorferi sensu lato complex isolated from rodents and a tick from the south-eastern USA. Int. J. Syst. Evol. Microbiol. 2011, 61, 381–383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Michalik, J.; Wodecka, B.; Liberska, J.; Dabert, M.; Postawa, T.; Piksa, K.; Stańczak, J. Diversity of Lyme borreliosis spirochete species in Ixodes spp. ticks (Acari: Ixodidae) associated with cave-dwelling bats from Poland and Romania. Ticks Tick Borne Dis. 2020, 11, 101300. [Google Scholar] [CrossRef] [PubMed]
  15. Wodecka, B.; Michalik, J.; Grochowalska, R. Red foxes (Vulpes vulpes) are exposed to high diversity of Borrelia burgdorferi sensu lato species infecting fox-derived Ixodes ticks in west-central Poland. Pathogens 2022, 11, 696. [Google Scholar] [CrossRef]
  16. Strnad, M.; Hönig, V.; Ružek, D.; Grubhoffer, L.; Rego, R.O.M. Europe-wide meta-analysis of Borrelia burgdorferi sensu lato prevalence in questing Ixodes ricinus ticks. Appl. Environ. Microbiol. 2017, 83, e00609-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Strle, F.; Stanek, G. Clinical manifestations and diagnosis of Lyme borreliosis. Curr. Probl. Dermatol. 2009, 37, 51–110. [Google Scholar] [CrossRef]
  18. Fraenkel, C.J.; Garpmo, U.; Berglund, J. Determination of novel Borrelia genospecies in Swedish Ixodes ricinus ticks. J. Clin. Microbiol. 2002, 40, 3308–3312. [Google Scholar] [CrossRef] [Green Version]
  19. Platonov, A.E.; Karan, L.S.; Kolyasnikova, N.M.; Makhneva, N.A.; Toporkova, M.G.; Maleev, V.V.; Fish, D.; Krause, P.J. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg. Infect. Dis. 2011, 17, 1816–1823. [Google Scholar] [CrossRef] [PubMed]
  20. Wodecka, B.; Leońska, A.; Skotarczak, B. A comparative analysis of molecular markers for the detection and identification of Borrelia spirochetes in Ixodes ricinus. J. Med. Microbiol. 2010, 59, 309–314. [Google Scholar] [CrossRef]
  21. Kalmár, Z.; Sprong, H.; Mihalca, A.D.; Gherman, C.M.; Dumitrache, M.O.; Coipan, E.C.; Fonville, M.; Cozma, V. Borrelia miyamotoi and Candidatus Neoehrlichia mikurensis in Ixodes ricinus ticks, Romania. Emerg. Infect. Dis. 2016, 22, 550–551. [Google Scholar] [CrossRef] [Green Version]
  22. Hamšíková, Z.; Coipan, C.; Mahríková, L.; Minichová, L.; Sprong, H.; Kazimírová, M. Borrelia miyamotoi and Cco-Iinfection with Borrelia afzelii in Ixodes ricinus ticks and rodents from Slovakia. Microb. Ecol. 2017, 73, 1000–1008. [Google Scholar] [CrossRef] [PubMed]
  23. Page, S.; Daschkin, C.; Anniko, S.; Krey, V.; Nicolaus, C.; Maxeiner, H.G. First report of Borrelia miyamotoi in an Ixodes ricinus tick in Augsburg, Germany. Exp. Appl. Acarol. 2018, 74, 191–199. [Google Scholar] [CrossRef] [PubMed]
  24. Kubiak, K.; Szczotko, M.; Dmitryjuk, M. Borrelia miyamotoi—An emerging human tick-borne pathogen in Europe. Microorganisms 2021, 9, 154. [Google Scholar] [CrossRef] [PubMed]
  25. Fesler, M.C.; Shah, J.S.; Middelveen, M.J.; Du Cruz, I.; Burrascano, J.J.; Stricker, R.B. Lyme Disease: Diversity of Borrelia species in California and Mexico detected using a novel immunoblot assay. Healthcare 2020, 8, 97. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Casjens, S.R.; Fraser-Liggett, C.M.; Mongodin, E.F.; Qiu, W.G.; Dunn, J.J.; Luft, B.J.; Schutzer, S.E. Whole genome sequence of an unusual Borrelia burgdorferi sensu lato isolate. J. Bacteriol. 2011, 193, 1489–1490. [Google Scholar] [CrossRef] [Green Version]
  27. Siuda, K. Ticks (Acari: Ixodida) of Poland. Part II: Taxonomy and Distribution; Polskie Towarzystwo Parazytologiczne: Warsaw, Poland, 1993. (In Polish) [Google Scholar]
  28. Estrada-Peña, A.; Nava, S.; Petney, T. Description of all the stages of Ixodes inopinatus n. sp. (Acari: Ixodidae). Ticks Tick Borne Dis. 2014, 5, 734–743. [Google Scholar] [CrossRef] [PubMed]
  29. Wodecka, B.; Rymaszewska, A.; Skotarczak, B. Host and pathogen DNA identification in blood meals of nymphal Ixodes ricinus ticks from forest parks and rural forests of Poland. Exp. Appl. Acarol. 2014, 62, 543–555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Wodecka, B.; Michalik, J.; Lane, R.S.; Nowak-Chmura, M.; Wierzbicka, A. Differential associations of Borrelia species with European badgers (Meles meles) and raccoon dogs (Nyctereutes procyonoides) in western Poland. Ticks Tick Borne Dis. 2016, 7, 1010–1016. [Google Scholar] [CrossRef]
  31. Wodecka, B. FlaB gene as a molecular marker for distinct identification of Borrelia species in environmental samples by the PCR-restriction fragment length polymorphism method. Appl. Environ. Microbiol. 2011, 77, 7088–7092. [Google Scholar] [CrossRef] [Green Version]
  32. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  33. Chitimia-Dobler, L.; Rieß, R.; Kahl, O.; Wölfel, S.; Dobler, G.; Nava, S.; Estrada-Peña, A. Ixodes inopinatus—Occurring also outside the Mediterranean region. Ticks Tick Borne Dis. 2018, 9, 196–200. [Google Scholar] [CrossRef] [PubMed]
  34. Chitimia-Dobler, L.; Lemhöfer, G.; Król, N.; Bestehorn, M.; Dobler, G.; Pfeffer, M. Repeated isolation of tick-borne encephalitis virus from adult Dermacentor reticulatus ticks in an endemic area in Germany. Parasit. Vectors 2019, 12, 90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Hauck, D.; Springer, A.; Pachnicke, S.; Schunack, B.; Fingerle, V.; Strube, C. Ixodes inopinatus in northern Germany: Occurrence and potential vector role for Borrelia spp., Rickettsia spp., and Anaplasma phagocytophilum in comparison with Ixodes ricinus. Parasitol. Res. 2019, 118, 3205–3216. [Google Scholar] [CrossRef] [PubMed]
  36. Hauck, D.; Springer, A.; Chitimia-Dobler, L.; Strube, C. Two-year monitoring of tick abundance and influencing factors in an urban area (city of Hanover, Germany). Ticks Tick Borne Dis. 2020, 11, 101464. [Google Scholar] [CrossRef] [PubMed]
  37. Vogelgesang, J.R.; Walter, M.; Kahl, O.; Rubel, F.; Brugger, K. Long-term monitoring of the seasonal density of questing ixodid ticks in Vienna (Austria): Setup and first results. Exp. Appl. Acarol. 2020, 81, 409–420. [Google Scholar] [CrossRef] [PubMed]
  38. Kahl, O.; Kämmer, D.; Bulling, I.; Komorek, M.; von Eiff, C.; Malerczyk, C. Ticks on the turf: Investigating the presence of ixodid ticks on and around football fields in Germany. Exp. Appl. Acarol. 2021, 84, 585–591. [Google Scholar] [CrossRef] [PubMed]
  39. Hornok, S.; Daccord, J.; Takács, N.; Kontschán, J.; Tuska-Szalay, B.; Sándor, A.D.; Szekeres, S.; Meli, M.L.; Hofmann-Lehmann, R. Investigation on haplotypes of ixodid ticks and retrospective finding of Borrelia miyamotoi in bank vole (Myodes glareolus) in Switzerland. Ticks Tick Borne Dis. 2022, 13, 101865. [Google Scholar] [CrossRef]
  40. Król, N.; Obiegala, A.; Imholt, C.; Arz, C.; Schmidt, E.; Jeske, K.; Ulrich, R.G.; Rentería-Solís, Z.; Jacob, J.; Pfeffer, M. Diversity of Borrelia burgdorferi sensu lato in ticks and small mammals from different habitats. Parasit. Vectors 2022, 15, 195. [Google Scholar] [CrossRef]
  41. Dwużnik, D.; Mierzejewska, E.J.; Alsarraf, M.; Bajer, A. A new focus of the tick Haemaphysalis concinna in Western Poland. Exp. Appl. Acarol. 2019, 78, 93–112. [Google Scholar] [CrossRef] [Green Version]
  42. Kiewra, D.; Czułowska, A.; Dyczko, D.; Zieliński, R.; Plewa-Tutaj, K. First record of Haemaphysalis concinna (Acari: Ixodidae) in Lower Silesia, SW Poland. Exp. Appl. Acarol. 2019, 77, 449–454. [Google Scholar] [CrossRef] [Green Version]
  43. Zięba, P.; Nowakiewicz, A.; Michalski, A.; Wlizło-Skowronek, B.; Gaweł, J.; Niemcewicz, M.; Gnat, S.; Łagowski, D. A new locality of the Haemaphysalis concinna tick (Koch, 1844) in Poland and its role as a potential vector of infectious diseases. Ann. Parasitol. 2019, 65, 281–286. [Google Scholar] [CrossRef] [PubMed]
  44. Nowak-Chmura, M.; Siuda, K. Ticks of Poland. Review of contemporary issues and latest research. Ann. Parasitol. 2012, 58, 125–155. [Google Scholar]
  45. Mysterud, A.; Stigum, V.M.; Jaarsma, R.I.; Sprong, H. Genospecies of Borrelia burgdorferi sensu lato detected in 16 mammal species and questing ticks from northern Europe. Sci. Rep. 2019, 9, 5088. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Zubriková, D.; Wittmann, M.; Hönig, V.; Švec, P.; Víchová, B.; Essbauer, S.; Dobler, G.; Grubhoffer, L.; Pfister, K. Prevalence of tick-borne encephalitis virus and Borrelia burgdorferi sensu lato in Ixodes ricinus ticks in Lower Bavaria and Upper Palatinate, Germany. Ticks Tick Borne Dis. 2020, 11, 101375. [Google Scholar] [CrossRef]
  47. Knoll, S.; Springer, A.; Hauck, D.; Schunack, B.; Pachnicke, S.; Fingerle, V.; Strube, C. Distribution of Borrelia burgdorferi s.l. and Borrelia miyamotoi in Ixodes tick populations in Northern Germany, co-infections with Rickettsiales and assessment of potential influencing factors. Med. Vet. Entomol. 2021, 35, 595–606. [Google Scholar] [CrossRef]
  48. Del Cerro, A.; Oleaga, A.; Somoano, A.; Barandika, J.F.; García-Pérez, A.L.; Espí, A. Molecular identification of tick-borne pathogens (Rickettsia spp., Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Coxiella burnetii and piroplasms) in questing and feeding hard ticks from North-Western Spain. Ticks Tick Borne Dis. 2022, 13, 101961. [Google Scholar] [CrossRef] [PubMed]
  49. Dyczko, D.; Kiewra, D.; Kolanek, A.; Błażej, P. The influence of local environmental factors in southwestern Poland on the abundance of Ixodes ricinus and prevalence of infection with Borrelia burgdorferi s.l. and B. miyamotoi. Parasitol. Res. 2022, 121, 1575–1585. [Google Scholar] [CrossRef] [PubMed]
  50. Hansford, K.M.; Wheeler, B.W.; Tschirren, B.; Medlock, J.M. Questing Ixodes ricinus ticks and Borrelia spp. in urban green space across Europe: A review. Zoonoses Public Health 2022, 69, 153–166. [Google Scholar] [CrossRef]
  51. Kubiak, K.; Szymańska, H.; Dmitryjuk, M.; Dzika, E. Abundance of Ixodes ricinus ticks (Acari: Ixodidae) and the diversity of Borrelia species in northeastern Poland. Int. J. Environ. Res. Public Health 2022, 19, 7378. [Google Scholar] [CrossRef]
  52. Kubiak, K.; Dmitryjuk, M.; Dziekońska-Rynko, J.; Siejwa, P.; Dzika, E. The risk of exposure to ticks and tick-borne pathogens in a spa town in northern Poland. Pathogens 2022, 11, 542. [Google Scholar] [CrossRef]
  53. Richtrová, E.; Míchalová, P.; Lukavská, A.; Navrátil, J.; Kybicová, K. Borrelia burgdorferi sensu lato infection in Ixodes ricinus ticks in urban green areas in Prague. Ticks Tick Borne Dis. 2022, 13, 102053. [Google Scholar] [CrossRef] [PubMed]
  54. Stanek, G.; Reiter, M. The expanding Lyme Borrelia complex—Clinical significance of genomic species? Clin. Microbiol. Infect. 2011, 17, 487–493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Krause, P.J.; Fish, D.; Narasimhan, S.; Barbour, A.G. Borrelia miyamotoi infection in nature and in humans. Clin. Microbiol. Infect. 2015, 21, 631–639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Majerová, K.; Hönig, V.; Houda, M.; Papežík, P.; Fonville, M.; Sprong, H.; Rudenko, N.; Golovchenko, M.; Cerná Bolfíková, B.; Hulva, P.; et al. Hedgehogs, squirrels, and blackbirds as sentinel hosts for active surveillance of Borrelia miyamotoi and Borrelia burgdorferi complex in urban and rural environments. Microorganisms 2020, 8, 1908. [Google Scholar] [CrossRef]
  57. Guner, E.S.; Watanabe, M.; Hashimoto, N.; Kadosaka, T.; Kawamura, Y.; Ezaki, T.; Kawabata, H.; Imai, Y.; Kaneda, K.; Masuzawa, T. Borrelia turcica sp. nov., isolated from the hard tick Hyalomma aegyptium in Turkey. Int. J. Syst. Evol. Microbiol. 2004, 54, 1649–1652. [Google Scholar] [CrossRef]
  58. Musilová, L.; Kybicová, K.; Fialová, A.; Richtrová, E.; Kulma, M. First isolation of Borrelia lusitaniae DNA from green lizards (Lacerta viridis) and Ixodes ricinus ticks in the Czech Republic. Ticks Tick Borne Dis. 2022, 13, 101887. [Google Scholar] [CrossRef]
  59. Schötta, A.M.; Stelzer, T.; Stanek, G.; Stockinger, H.; Wijnveld, M. Bacteria and protozoa with pathogenic potential in Ixodes ricinus ticks in Viennese recreational areas. Wien. Klin. Wochenschr. 2022, 10, 1–8. [Google Scholar] [CrossRef]
  60. Hansford, K.M.; McGinley, L.; Wheeler, B.W.; Tschirren, B.; Medlock, J.M. Ixodes ricinus density, Borrelia prevalence and the density of infected nymphs along an urban-rural gradient in southern England. Zoonoses Public Health 2023. [Google Scholar] [CrossRef]
  61. Zhigailov, A.V.; Neupokoyeva, A.S.; Maltseva, E.R.; Perfilyeva, Y.V.; Bissenbay, A.O.; Turebekov, N.A.; Frey, S.; Essbauer, S.; Abdiyeva, K.S.; Ostapchuk, Y.O.; et al. The prevalence of Borrelia in Ixodes persulcatus in southeastern Kazakhstan. Ticks Tick-Borne Dis. 2021, 12, 101716. [Google Scholar] [CrossRef]
  62. He, Z.; Jiang, B.; Huang, L.; Shao, Z.; Zhang, Y.; Li, Y.; Pu, E.; Duan, X.; Jiang, H.; Wang, J.; et al. High diversity and prevalence of Borrelia burgdorferi sensu lato in wildlife hosts, domestic animals, and ticks in Yunnan province, southwestern China. Front. Microbiol. 2022, 13, 876079. [Google Scholar] [CrossRef]
  63. Fedorova, N.; Kleinjan, J.E.; James, D.; Hui, L.T.; Peeters, H.; Lane, R.S. Remarkable diversity of tick or mammalian-associated Borreliae in the metropolitan San Francisco Bay Area, California. Ticks Tick Borne Dis. 2014, 5, 951–961. [Google Scholar] [CrossRef] [PubMed]
  64. Rose, I.; Yoshimizu, M.H.; Bonilla, D.L.; Fedorova, N.; Lane, R.S.; Padgett, K.A. Phylogeography of Borrelia spirochetes in Ixodes pacificus and Ixodes spinipalpis ticks highlights differential acarological risk of tick-borne disease transmission in northern versus southern California. PLoS ONE 2019, 14, e0214726. [Google Scholar] [CrossRef] [PubMed]
  65. MacDonald, A.J.; Weinstein, S.B.; O’Connor, K.E.; Swei, A. Circulation of tick-borne spirochetes in tick and small mammal communities in Santa Barbara county, California, USA. J. Med. Entomol. 2020, 57, 1293–1300. [Google Scholar] [CrossRef] [PubMed]
  66. Kurtenbach, K.; De Michelis, S.; Etti, S.; Schäfer, S.M.; Sewell, H.S.; Brade, V.; Kraiczy, P. Host association of Borrelia burgdorferi sensu lato—The key role of host complement. Trends Microbiol. 2002, 10, 74–79. [Google Scholar] [CrossRef] [PubMed]
  67. Estrada-Pena, A.; Alvarez-Jarreta, J.; Cabezas-Cruz, A. Reservoir and vector evolutionary pressures shaped the adaptation of Borrelia. Infect. Genet. Evol. 2018, 66, 308–318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Răileanu, C.; Silaghi, C.; Fingerle, V.; Margos, G.; Thiel, C.; Pfister, K.; Overzier, E. Borrelia burgdorferi sensu lato in questing and engorged ticks from different habitat types in southern Germany. Microorganisms 2021, 9, 1266. [Google Scholar] [CrossRef]
Life 13 00972 g001 550
Figure 1. Ixodes ricinus tick collection sites in northern Poland. 1—Lubieszyn, 2—Bartoszewo, 3—Zielonczyn, 4—Ciemnik, 5—Świerznica, 6—Gdańsk, 7—Bełdany Lake.
Figure 1. Ixodes ricinus tick collection sites in northern Poland. 1—Lubieszyn, 2—Bartoszewo, 3—Zielonczyn, 4—Ciemnik, 5—Świerznica, 6—Gdańsk, 7—Bełdany Lake.
Life 13 00972 g001
Life 13 00972 g002 550
Figure 2. Phylogenetic analysis of Borreliaceae species obtained on the basis of flaB gene fragment (length 783–789 bp) amplified with primers FL120F and FL908R. The analysis involved 70 sequences. Bootstrap values >50 are shown. (*)—sequences obtained in this study. BG—Borreliella garinii, BA—Bl. afzelii, BB—Bl. burgdorferi, BV—Bl. valaisiana, BL—Bl. lusitaniae, BS—Bl. spielmanii, BBI—Bl. bissettiae, BF—Bl. finlandensis, BCL—Bl. californiensis, BCR—Bl. carolinensis, BLN—Bl. lanei, BAM—Bl. americana, BTC—Borrelia turcica, BM—B. miyamotoi.
Figure 2. Phylogenetic analysis of Borreliaceae species obtained on the basis of flaB gene fragment (length 783–789 bp) amplified with primers FL120F and FL908R. The analysis involved 70 sequences. Bootstrap values >50 are shown. (*)—sequences obtained in this study. BG—Borreliella garinii, BA—Bl. afzelii, BB—Bl. burgdorferi, BV—Bl. valaisiana, BL—Bl. lusitaniae, BS—Bl. spielmanii, BBI—Bl. bissettiae, BF—Bl. finlandensis, BCL—Bl. californiensis, BCR—Bl. carolinensis, BLN—Bl. lanei, BAM—Bl. americana, BTC—Borrelia turcica, BM—B. miyamotoi.
Life 13 00972 g002
Life 13 00972 g003 550
Figure 3. Phylogenetic analysis of Borreliaceae species obtained on the basis of mag-trnI intergenic spacer fragment (length 302–1176 bp) amplified with primers glz435f and ile20r. The analysis involved 78 sequences. Bootstrap values >50 are shown. (*)—sequences obtained in this study. BG—Borreliella garinii, BA—Bl. afzelii, BB—Bl. burgdorferi, BV—Bl. valaisiana, BL—Bl. lusitaniae, BS—Bl. spielmanii, BBI—Bl. bissettiae, BF—Bl. finlandensis, BCL—Bl. californiensis, BCR—Bl. carolinensis, BLN—Bl. lanei, BAM—Bl. americana, BTC—Borrelia turcica, BM—B. miyamotoi.
Figure 3. Phylogenetic analysis of Borreliaceae species obtained on the basis of mag-trnI intergenic spacer fragment (length 302–1176 bp) amplified with primers glz435f and ile20r. The analysis involved 78 sequences. Bootstrap values >50 are shown. (*)—sequences obtained in this study. BG—Borreliella garinii, BA—Bl. afzelii, BB—Bl. burgdorferi, BV—Bl. valaisiana, BL—Bl. lusitaniae, BS—Bl. spielmanii, BBI—Bl. bissettiae, BF—Bl. finlandensis, BCL—Bl. californiensis, BCR—Bl. carolinensis, BLN—Bl. lanei, BAM—Bl. americana, BTC—Borrelia turcica, BM—B. miyamotoi.
Life 13 00972 g003
Table
Table 1. Primers used for the amplification DNA of Ixodidae ticks and Borreliaceae spirochetes.
Table 1. Primers used for the amplification DNA of Ixodidae ticks and Borreliaceae spirochetes.
SpecificityGenetic MarkerSequence of Primers (5′->3′)Annealing Temp. (°C)Length of Amplicons (bp)UsageReference
Ixodidae *coICO1-45F: ACTAACCATAAAGACACATTGG44706PCR-RFLP, sequencingThis study
CO1-1100R: GAATTGGCTAAAATAATTCC
Nested PCR
CO1-375F: GGCAGGAACTGGATGAAC47
CO1-1086R: AATTCCTGTTAATCCYCC
Borreliaceae **flaB132f: TGGTATGGGAGTTTCTGG56604PCR-RFLP[24]
905r: TCTGTCATTGTAGCATCTTT
Nested PCR
220f: CAGACAACAGAGGGAAAT54
823r: TCAAGTCTATTTTGGAAAGCACC
FL84F: AGAAGCTTTCTAGTGGGTACAGA57
FL976R: GATTGGCCTGTGCAATCAT
Nested PCR 789sequencingThis study
FL120F: TGATGATGCTGCTGGGATGG56
FL908R: TCATCTGTCATTGTAGCATCTT
mag—trnIglz199f—GTAAGTTTGCCAGGACCATT56
ile20r—TGAACATCCGACCTCAGG
Nested PCR 309-1183sequencingThis study
glz435f—TAAGCTTCCGTTTCAAC58
ile65r—CAGACCTGCGCTCTAACC
* primers specific to the whole Ixodes genus. ** primers specific to the whole Borreliaceae family including Lyme disease borreliae (Borreliella genus), relapsing fever (RF) borreliae and reptile-related (REP) borreliae (Borrelia genus).
Table
Table 2. Restriction patterns received after digestion of PCR product with primer set 220F and 823R specific for Borreliaceae spirochetes.
Table 2. Restriction patterns received after digestion of PCR product with primer set 220F and 823R specific for Borreliaceae spirochetes.
Borreliaceae SpeciesRestriction Fragment Size
HpyF3ISatIPsuIVspI
Bl. burgdorferi359, 207, 38241, 200, 112, 51
Bl. finlandensis359, 207, 38251, 226, 127
Bl. americana359, 207, 38353, 200, 51
Bl. afzelii305, 165, 92, 42 *
Bl. garinii388, 135, 72, 9 327, 277
Bl. bavariensis388, 135, 72, 9 277, 219, 108
Bl. valaisiana188, 135, 117, 92, 72 *
Bl. lusitaniae305, 207, 92 *
Bl. bissettiae280, 135, 117, 72 *
Bl. spielmanii397, 207241, 209, 112, 42
Bl. lanei397, 207353, 200, 51
Bl. carolinensis280, 135, 117, 45, 27 *
Bl. californiensis280, 207, 117 461, 143
Bl. turdi280, 207, 117 352, 143, 109
B. miyamotoi512, 86 *
B. turcica412, 135, 45, 12 *
* unique restriction pattern, further differentiation is not required.
Table
Table 3. Reference strains of Borreliaceae spirochetes used in this study.
Table 3. Reference strains of Borreliaceae spirochetes used in this study.
Borreliaceae SpeciesStrainSourceCountryAccession Number
flaBmag-trnI
B. garinii20047I. ricinusFranceCP018744
BgVirI. persulcatusRussiaCP003151
B. afzeliiPKoSkin biopsyGermanyCP002933
Tom3107I. persulcatusRussiaCP009212
B. burgdorferiPAliHomo sapiensGermanyCP019844
B31I. scapularisUSAAE000783
B. valaisianaVS116I. ricinusSwitzerlandABCY02000001
Tom4006I. persulcatusRussiaCP009117
B. lusitaniaePotiB2I. ricinusPortugalD82856NA
J3-6M-IRI. ricinusPolandKF422805NA
Bl. bissettiaeDN127I. pacificusUSACP002746
B. spielmaniiA14SHomo sapiensNetherlandsABKB02000003ABKB02000009
B. finlandensisSV1I. ricinusFinlandABJZ02000005
B. carolinensisSCW-22I. minor fed on Neotoma floridanaUSAKF422810MT119049
B. californiensisCA446Dipodomys californicusUSAKF422809MT119055
B. laneiCA28I. pacificusUSAKF422812MT119061
B. americanaCA8I. pacificusUSAKF422811MT119066
B. miyamotoiCT14D4Human bloodUSACP010308
Izh-5Human bloodRussiaCP024205
CZ-F1EI. ricinusCzech RepublicCP046389
B. turcicaIST7Hyalomma aegyptium from tortoiseTurkeyCP028884
NA—not accessible.
Table
Table 4. Detection of Borreliaceae DNA in I. ricinus ticks collected from northern Poland.
Table 4. Detection of Borreliaceae DNA in I. ricinus ticks collected from northern Poland.
Study SiteNo. of Ticks Tested/Infected (%)
TotalFemalesMalesNymphsLarvae
Świerznica475/116 (24.4)14/3 (21.4)15/6 (40.0)252/101 (40.1)194/6 (3.1)
Ciemnik509/42 (8.3)20/4 (20.0)29/1 (3.4)276/24 (8.7)184/13 (7.1)
Lubieszyn306/40 (13.1)16/1 (6.3)26/3 (11.5)249/28 (11.2)15/8 (53.3)
Gdańsk266/63 (23.7)11/3 (27.3)13/7 (53.8)237/53 (22.4)5/0 (0)
Bartoszewo185/35 (18.9)17/2 (11.8)19/9 (47.4)148/24 (16.2)1/0 (0)
Zielonczyn302/72 (23.8)2/0 (0)3/0 (0)260/69 (26.5)37/3 (8.1)
Bełdany Lake144/47 (32.6)16/8 (50)27/8 (29.6)101/31 (30.7)
Total2187/415 (19.0)96/21 (21.9)132/34 (25.8)1523/330 (21.7)436/30 (6.9)
Table
Table 5. Borreliaceae species identified in I. ricinus from Northern Poland.
Table 5. Borreliaceae species identified in I. ricinus from Northern Poland.
Borreliaceae SpeciesStudy Site (PCR+ [F/M/N/L])
LubieszynBartoszewoZielonczynCiemnikŚwierznicaGdańskBełdany LakeTotal (%)
Bl. garinii9 [1/3/5/0]8 [2/3/3/0]4 [0/0/4/0]7 [0/1/5/1]35 [1/1/27/6]5 [0/2/3/0]3 [1/0/2/0]71 [5/10/49/7] (17.1)
Bl. afzelii5 [0/0/3/2]7 [0/0/7/0]30 [0/0/28/2]10 [1/0/8/1]38 [1/2/35/0]3 [1/0/2/0]10 [2/2/6/0]103 [5/4/89/5] (24.8)
Bl. burgdorferi1 [0/0/1/0] 3 [0/0/3/0]1 [0/0/1/0]7 [0/0/7/0] 5 [1/0/4/0]17 [1/0/16/0] (4.1)
Bl. valaisiana5 [0/0/4/1]7 [0/2/5/0]4 [0/0/4/0]1 [1/0/0/0]9 [1/1/7/0]9 [0/0/9/0] 35 [2/3/29/1] (8.4)
Bl. lusitaniae 1 [0/0/1/0]2 [2/0/0/0]2 [0/0/2/0] 5 [2/0/3/0] (1.2)
Bl. spielmanii12 [0/0/8/4]4 [0/1/3/0]1 [0/0/1/0]3 [0/0/1/2]3 [0/0/3/0]22 [2/3/17/0] 45 [2/4/33/6] (10.8)
Bl. bissettiae 4 [0/0/4/0] 4 [0/0/4/0] (1.0)
Bl. finlandensis 1 [0/0/1/0] 2 [0/1/1/0]3 [0/1/2/0] (0.7)
Bl. californiensis1 [0/0/1/0]1 [0/1/0/0]8 [0/0/7/1]4 [0/0/2/2] 13 [1/3/9/0]27 [1/4/19/3] (6.5)
Bl. carolinensis2 [0/0/2/0]4 [0/0/4/0] 6 [0/0/6/0] 12 [0/0/12/0] (2.9)
Bl. lanei3 [0/0/3/0]1 [0/1/0/0] 5 [0/0/2/3]2 [0/0/2/0]14 [0/1/13/0] 25 [0/2/20/3] (6.0)
Bl. americana 2 [0/0/2/0]1 [0/0/0/1] 1 [0/0/1/0]4 [1/2/1/0]8 [1/2/4/1] (1.9)
B. miyamotoi 2 [0/1/1/0]8 [0/0/8/0]3 [0/0/3/0]9 [0/2/7/0] 3 [0/0/3/0]25 [0/3/22/0] (6.0)
B. turcica1 [0/0/0/1] 2 [0/0/2/0] 1 [0/0/1/0]4 [0/0/3/1] (1.0)
Bl. garinii/Bl. afzelii 5 [0/0/5/0] 3 [0/0/3/0] 8 [0/0/8/0] (1.9)
Bl. garinii/Bl. burgdorferi 1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Bl. garinii/Bl. lanei 1 [0/1/0/0] 1 [0/1/0/0] (0.2)
Bl. garinii/Bl. lusitaniae 1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Bl. garinii/Bl. valaisiana 1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Bl. afzelii/Bl. burgdorferi 2 [0/0/2/0] 1 [0/0/1/0]3 [0/0/3/0] (0.7)
Bl. afzelii/Bl. californiensis 1 [0/0/1/0] 1 [1/0/0/0]2 [1/0/1/0] (0.5)
Bl. afzelii/Bl. carolinensis 1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Bl. afzelii/Bl. lanei 2 [0/0/0/2] 1 [0/0/1/0] 3 [0/0/1/2] (0.7)
Bl. afzelii/B. turcica1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Bl. burgdorferi/Bl. valaisiana 1 [0/0/1/0] 1 [1/0/0/0]2 [1/0/1/0] (0.5)
Bl. burgdorferi/Bl. californiensis 1 [0/0/1/0]1 [0/0/1/0] (0.2)
Bl. burgdorferi/Bl. finlandensis 1 [0/0/1/0]1 [0/0/1/0] (0.2)
Bl. valaisiana/Bl. spielmanii 1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Bl. spielmanii/Bl. lanei 1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Bl. californiensis/B. turcica 1 [0/0/1/0]1 [0/0/1/0] (0.2)
Bl. lanei/B. miyamotoi 1 [0/0/0/1] 1 [0/0/0/1] (0.2)
Bl. afzelii/Bl. lanei/B. turcica 1 [0/0/1/0] 1 [0/0/1/0] (0.2)
Total40 [1/3/28/8]35 [2/9/24/0]72 [0/0/69/3]42 [4/1/24/13]116 [3/6/101/6]63 [3/7/53/0]47 [8/8/31/0]415 [21/34/330/30] (100.0)
F—female, M—male, N—nymph, L—larva.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wodecka, B.; Kolomiiets, V. Genetic Diversity of Borreliaceae Species Detected in Natural Populations of Ixodes ricinus Ticks in Northern Poland. Life 2023, 13, 972. https://doi.org/10.3390/life13040972

AMA Style

Wodecka B, Kolomiiets V. Genetic Diversity of Borreliaceae Species Detected in Natural Populations of Ixodes ricinus Ticks in Northern Poland. Life. 2023; 13(4):972. https://doi.org/10.3390/life13040972

Chicago/Turabian Style

Wodecka, Beata, and Valentyna Kolomiiets. 2023. "Genetic Diversity of Borreliaceae Species Detected in Natural Populations of Ixodes ricinus Ticks in Northern Poland" Life 13, no. 4: 972. https://doi.org/10.3390/life13040972

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop