Molecular Genetic Diversity of Local and Exotic Durum Wheat Genotypes and Their Combining Ability for Agronomic Traits under Water Deficit and Well-Watered Conditions
Abstract
:1. Introduction
2. Materials and Methods
2.1. Molecular Characterization of Parental Genotypes
2.2. Hybridization and Field Evaluation
2.3. Data Collection
2.4. Drought Tolerance Indices
2.5. Statistical Analysis
3. Results
3.1. Molecular Diversity among Evaluated Parental Genotypes
3.2. Analysis of Variance
3.3. Performance of the Evaluated Parental Genotypes and F1 Combinations
3.4. Classification of Evaluated Genotypes
3.5. General Combining Ability (GCA) Effects
3.6. Specific Combining Ability (SCA) Estimates
3.7. Interrelationship among Evaluated Traits
3.8. Heterosis Relative to Better Parent
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Feuillet, C.; Langridge, P.; Waugh, R. Cereal breeding takes a walk on the wild side. Trends Genet. 2008, 24, 24–32. [Google Scholar] [CrossRef] [PubMed]
- FAOSTAT. Food and Agriculture Organization of the United Nations. Statistical Database. 2023. Available online: http://www.fao.org/faostat/en/#data (accessed on 1 October 2023).
- Boukid, F.; Dall-Asta, M.; Bresciani, L.; Mena, P.; Del Rio, D.; Calani, L.; Sayar, R.; Seo, Y.W.; Yacoubi, I.; Mejri, M. Phenolic profile and antioxidant capacity of landraces, old and modern Tunisian durum wheat. Eur. Food Res. Technol. 2018, 245, 73–82. [Google Scholar] [CrossRef]
- Ammar, K.; Kronstad, W.E.; Morris, C.F. Breadmaking quality of selected durum wheat genotypes and its relationship with high molecular weight glutenin subunits allelic variation and gluten protein polymeric composition. Cereal Chem. 2000, 77, 230–236. [Google Scholar] [CrossRef]
- Li, Y.-F.; Wu, Y.; Hernandez-Espinosa, N.; Peña, R.J. Heat and drought stress on durum wheat: Responses of genotypes, yield, and quality parameters. J. Cereal Sci. 2013, 57, 398–404. [Google Scholar] [CrossRef]
- Beres, B.L.; Rahmani, E.; Clarke, J.M.; Grassini, P.; Pozniak, C.J.; Geddes, C.M.; Porker, K.D.; May, W.E.; Ransom, J.K. A systematic review of durum wheat: Enhancing production systems by exploring genotype, environment, and management (G × E × M) synergies. Front. Plant Sci. 2020, 11, 568657. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wu, Y.; Hernandez-Espinosa, N.; Peña, R.J. The influence of drought and heat stress on the expression of end-use quality parameters of common wheat. J. Cereal Sci. 2013, 57, 73–78. [Google Scholar] [CrossRef]
- Buffagni, V.; Vurro, F.; Janni, M.; Gullì, M.; Keller, A.A.; Marmiroli, N. Shaping durum wheat for the future: Gene expression analyses and metabolites profiling support the contribution of bcat genes to drought stress response. Front. Plant Sci. 2020, 11, 891. [Google Scholar] [CrossRef]
- Mansour, E.; Moustafa, E.S.A.; El-Naggar, N.Z.A.; Abdelsalam, A.; Igartua, E. Grain yield stability of high-yielding barley genotypes under Egyptian conditions for enhancing resilience to climate change. Crop Pasture Sci. 2018, 69, 681–690. [Google Scholar] [CrossRef]
- Noto, L.V.; Cipolla, G.; Francipane, A.; Pumo, D. Climate change in the mediterranean basin (part I): Induced alterations on climate forcings and hydrological processes. Water Resour. Manag. 2023, 37, 2287–2305. [Google Scholar] [CrossRef]
- Saghouri el idrissi, I.; Kettani, R.; Ferrahi, M.; Nabloussi, A.; Ziri, R.; Brhadda, N. Water stress effect on durum wheat (Triticum durum Desf.) advanced lines at flowering stage under controlled conditions. J. Agric. Food Res. 2023, 14, 100696. [Google Scholar] [CrossRef]
- Pour-Aboughadareh, A.; Mohammadi, R.; Etminan, A.; Shooshtari, L.; Maleki-Tabrizi, N.; Poczai, P. Effects of drought stress on some agronomic and morpho-physiological traits in durum wheat genotypes. Sustainability 2020, 12, 5610. [Google Scholar] [CrossRef]
- Gracia, M.P.; Mansour, E.; Casas, A.M.; Lasa, J.M.; Medina, B.; Molina-Cano, J.L.; Moralejo, M.A.; López, A.; López-Fuster, P.; Escribano, J.; et al. Progress in the Spanish national barley breeding program. Span. J. Agric. Res. 2012, 10, 741. [Google Scholar] [CrossRef]
- Cooper, M.; Messina, C.D. Breeding crops for drought-affected environments and improved climate resilience. Plant Cell 2023, 35, 162–186. [Google Scholar] [CrossRef] [PubMed]
- Dettori, M.; Cesaraccio, C.; Duce, P.; Mereu, V. Performance prediction of durum wheat genotypes in response to drought and heat in climate change conditions. Genes 2022, 13, 488. [Google Scholar] [CrossRef]
- Sayar, R.; Khemira, H.; Kharrat, M. Inheritance of deeper root length and grain yield in half-diallel durum wheat (Triticum durum) crosses. Ann. Appl. Biol. 2007, 151, 213–220. [Google Scholar] [CrossRef]
- Musembi, K.B.; Githiri, S.M.; Yencho, G.C.; Sibiya, J. Combining ability and heterosis for yield and drought tolerance traits under managed drought stress in sweetpotato. Euphytica 2015, 201, 423–440. [Google Scholar] [CrossRef]
- Thungo, Z.G.; Shimelis, H.; Mashilo, J. Combining ability of drought-tolerant bread wheat genotypes for agronomic and physiological traits. Agronomy 2022, 12, 862. [Google Scholar] [CrossRef]
- Salem, T.; Rabie, H.; Mowafy, S.; Eissa, A.; Mansour, E. Combining ability and genetic components of egyptian cotton for earliness, yield, and fiber quality traits. SABRAO J. Breed. Genet. 2020, 52, 369–389. [Google Scholar]
- Heİba, H.; Mahgoub, E.; Mahmoud, A.; Ibrahİm, M.; Mansour, E. Combining ability and gene action controlling chocolate spot resistance and yield traits in faba bean (Vicia faba L.). J. Agric. Sci. 2023, 29, 77–88. [Google Scholar] [CrossRef]
- Gowda, M.; Kling, C.; Würschum, T.; Liu, W.; Maurer, H.P.; Hahn, V.; Reif, J.C. Hybrid breeding in durum wheat: Heterosis and combining ability. Crop Sci. 2010, 50, 2224–2230. [Google Scholar] [CrossRef]
- Mohammadi, M.; Mirlohi, A.; Majidi, M.M.; Soleimani Kartalaei, E. Emmer wheat as a source for trait improvement in durum wheat: A study of general and specific combining ability. Euphytica 2021, 217, 64. [Google Scholar] [CrossRef]
- Meghawal, D.R.; Vyas, M.; Choudhary, J.; Dubey, R.B.; Malav, A.K. Combining ability analysis for morpho-physiological traits and grain yield under heat stress condition in durum wheat (Triticum durum desf.). Curr. Appl. Sci. Technol. 2021, 40, 11–20. [Google Scholar] [CrossRef]
- Mohammadi, M.; Mirlohi, A.; Majidi, M.M.; Rabbani, A. Exploring the breeding potential of Iranian emmer wheats to increase durum wheat tolerance to drought. Plant Genet. Resour. 2021, 19, 363–374. [Google Scholar] [CrossRef]
- Zannat, A.; Hussain, M.A.; Abdullah, A.H.M.; Hossain, M.I.; Saifullah, M.; Safhi, F.A.; Alshallash, K.S.; Mansour, E.; ElSayed, A.I.; Hossain, M.S. Exploring genotypic variability and interrelationships among growth, yield, and quality characteristics in diverse tomato genotypes. Heliyon 2023, 9, E18958. [Google Scholar] [CrossRef]
- Sakran, R.M.; Ghazy, M.I.; Rehan, M.; Alsohim, A.S.; Mansour, E. Molecular genetic diversity and combining ability for some physiological and agronomic traits in rice under well-watered and water-deficit conditions. Plants 2022, 11, 702. [Google Scholar] [CrossRef]
- Börner, A.; Chebotar, S.; Korzun, V. Molecular characterization of the genetic integrity of wheat (Triticum aestivum L.) germplasm after long-term maintenance. Theor. Appl. Genet. 2000, 100, 494–497. [Google Scholar] [CrossRef]
- Röder, M.; Wendehake, K.; Korzun, V.; Bredemeijer, G.; Laborie, D.; Bertrand, L.; Isaac, P.; Rendell, S.; Jackson, J.; Cooke, R.; et al. Construction and analysis of a microsatellite-based database of European wheat varieties. Theor. Appl. Genet. 2002, 106, 67–73. [Google Scholar] [CrossRef]
- Tajibayev, D.; Mukin, K.; Babkenov, A.; Chudinov, V.; Dababat, A.A.; Jiyenbayeva, K.; Kenenbayev, S.; Savin, T.; Shamanin, V.; Tagayev, K.; et al. Exploring the agronomic performance and molecular characterization of diverse spring durum wheat germplasm in Kazakhstan. Agronomy 2023, 13, 1955. [Google Scholar] [CrossRef]
- Doyle, J. A rapid total DNA preparation procedure for fresh plant tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Ateş Sönmezoğlu, Ö.; Terzi, B. Characterization of some bread wheat genotypes using molecular markers for drought tolerance. Physiol. Mol. Biol. Plants 2018, 24, 159–166. [Google Scholar] [CrossRef]
- Belete, Y.; Shimelis, H.; Laing, M.; Mathew, I. Genetic diversity and population structure of bread wheat genotypes determined via phenotypic and SSR marker analyses under drought-stress conditions. J. Crop Improv. 2021, 35, 303–325. [Google Scholar] [CrossRef]
- Özlem, A.-S.; Çevik, E.; Terzi-Aksoy, B. Assessment of some bread wheat (Triticum aestivum L.) genotypes for drought tolerance using SSR and ISSR markers. Biotech. Studies 2022, 31, 45–52. [Google Scholar]
- Ihsan, M.Z.; El-Nakhlawy, F.S.; Ismail, S.M.; Fahad, S.; Daur, I. Wheat phenological development and growth studies as affected by drought and late season high temperature stress under arid environment. Front. Plant Sci. 2016, 7, 795. [Google Scholar] [CrossRef] [PubMed]
- Calderini, D.F.; Abeledo, L.G.; Slafer, G.A. Physiological maturity in wheat based on kernel water and dry matter. J. Agron. 2000, 92, 895–901. [Google Scholar] [CrossRef]
- Fernandez, G.C. Effective selection criteria for assessing plant stress tolerance. In Proceedings of the International Symposium on Adaptation of Vegetables and other Food Crops in Temperature and Water Stress, Shanhua, Taiwan, 13–16 August 1992; pp. 257–270. [Google Scholar]
- Gavuzzi, P.; Rizza, F.; Palumbo, M.; Campanile, R.; Ricciardi, G.; Borghi, B. Evaluation of field and laboratory predictors of drought and heat tolerance in winter cereals. Can. J. Plant Sci. 1997, 77, 523–531. [Google Scholar] [CrossRef]
- Griffing, B. Concept of general and specific combining ability in relation to diallel crossing systems. Aust. J. Biol. Sci. 1956, 9, 463–493. [Google Scholar] [CrossRef]
- Nouri, A.; Etminan, A.; Teixeira da Silva, J.A.; Mohammadi, R. Assessment of yield, yield-related traits and drought tolerance of durum wheat genotypes (Triticum turjidum var. durum Desf.). Aust. J. Crop Sci. 2011, 5, 8–16. [Google Scholar]
- Mohammadi, R. Efficiency of yield-based drought tolerance indices to identify tolerant genotypes in durum wheat. Euphytica 2016, 211, 71–89. [Google Scholar] [CrossRef]
- Salsman, E.; Liu, Y.; Hosseinirad, S.A.; Kumar, A.; Manthey, F.; Elias, E.; Li, X. Assessment of genetic diversity and agronomic traits of durum wheat germplasm under drought environment of the northern Great Plains. Crop Sci. 2021, 61, 1194–1206. [Google Scholar] [CrossRef]
- Mohammadi, R.; Cheghamirza, K.; Geravandi, M.; Abbasi, S. Assessment of genetic and agro-physiological diversity in a global durum wheat germplasm. Cereal Res. Commun. 2022, 50, 117–126. [Google Scholar] [CrossRef]
- Ponce-Molina, L.J.; María Casas, A.; Pilar Gracia, M.; Silvar, C.; Mansour, E.; Thomas, W.B.T.; Schweizer, G.; Herz, M.; Igartua, E. Quantitative trait loci and candidate loci for heading date in a large population of a wide barley cross. Crop Sci. 2012, 52, 2469–2480. [Google Scholar] [CrossRef]
- Igartua, E.; Mansour, E.; Cantalapiedra, C.P.; Contreras-Moreira, B.; Gracia, M.P.; Fuster, P.; Escribano, J.; Molina-Cano, J.L.; Moralejo, M.; Ciudad, F.J.; et al. Selection footprints in barley breeding lines detected by combining genotyping-by-sequencing with reference genome information. Mol. Breed. 2015, 35, 11. [Google Scholar] [CrossRef]
- Haile, J.K.; Hammer, K.; Badebo, A.; Nachit, M.M.; Röder, M.S. Genetic diversity assessment of Ethiopian tetraploid wheat landraces and improved durum wheat varieties using microsatellites and markers linked with stem rust resistance. Genet. Resour. Crop Evol. 2012, 60, 513–527. [Google Scholar] [CrossRef]
- Dagnaw, T.; Mulugeta, B.; Haileselassie, T.; Geleta, M.; Ortiz, R.; Tesfaye, K. Genetic diversity of durum wheat (Triticum turgidum l. Ssp. Durum, desf) germplasm as revealed by morphological and SSR markers. Genes 2023, 14, 1155. [Google Scholar] [CrossRef]
- Eujayl, I.; Sorrells, M.; Baum, M.; Wolters, P.; Powell, W. Assessment of genotypic variation among cultivated durum wheat based on EST-SSRs and genomic SSRs. Euphytica 2001, 119, 39–43. [Google Scholar] [CrossRef]
- Maccaferri, M.; Sanguineti, M.; Donini, P.; Tuberosa, R. Microsatellite analysis reveals a progressive widening of the genetic basis in the elite durum wheat germplasm. Theor. Appl. Genet. 2003, 107, 783–797. [Google Scholar] [CrossRef]
- Marzario, S.; Logozzo, G.; David, J.; Zeuli, P.; Gioia, T. Molecular genotyping (SSR) and agronomic phenotyping for utilization of durum wheat (Triticum durum desf.) ex situ collection from Southern Italy: A combined approach including pedigreed varieties. Genes 2018, 9, 465. [Google Scholar] [CrossRef]
- Dukamo, B.H.; Gedebo, A.; Tesfaye, B.; Degu, H.D. Genetic diversity of Ethiopian durum wheat (T. turgidum subsp. durum) landraces under water stressed and non stressed conditions. Heliyon 2023, 9, e18359. [Google Scholar] [CrossRef]
- Almarri, N.B.; Alghamdi, S.S.; ElShal, M.H.; Afzal, M. Estimating genetic diversity among durum wheat (Triticum durum desf.) landraces using morphological and SRAP markers. J. Saudi Soc. Agric. Sci. 2023, 22, 273–282. [Google Scholar] [CrossRef]
- Asmamaw, M.; Keneni, G.; Tesfaye, K. Genetic diversity of ethiopian durum wheat (Triticum durum desf.) landrace collections as reveled by ssr markers. Adv. Crop Sci. Technol. 2019, 7, 413. [Google Scholar] [CrossRef]
- Zhao, W.; Liu, L.; Shen, Q.; Yang, J.; Han, X.; Tian, F.; Wu, J. Effects of water stress on photosynthesis, yield, and water use efficiency in winter wheat. Water 2020, 12, 2127. [Google Scholar] [CrossRef]
- Hafsi, M.; Mechmeche, W.; Bouamama, L.; Djekoune, A.; Zaharieva, M.; Monneveux, P. Flag leaf senescence, as evaluated by numerical image analysis, and its relationship with yield under drought in durum wheat. Agron. Crop Sci. 2000, 185, 275–280. [Google Scholar] [CrossRef]
- Sukumaran, S.; Reynolds, M.P.; Sansaloni, C. Genome-wide association analyses identify QTL hotspots for yield and component traits in durum wheat grown under yield potential, drought, and heat stress environments. Front. Plant Sci. 2018, 9, 81. [Google Scholar] [CrossRef] [PubMed]
- Giunta, F.; Motzo, R.; Deidda, M. Effect of drought on yield and yield components of durum wheat and triticale in a Mediterranean environment. Field Crops Res. 1993, 33, 399–409. [Google Scholar] [CrossRef]
- Shirvani, F.; Mohammadi, R.; Daneshvar, M.; Ismaili, A. Genetic variability, response to selection for agro-physiological traits, and traits-enhanced drought tolerance in durum wheat. Acta Ecol. Sin. 2023, 43, 810–819. [Google Scholar] [CrossRef]
- Mohi-Ud-Din, M.; Hossain, M.A.; Rohman, M.M.; Uddin, M.N.; Haque, M.S.; Ahmed, J.U.; Hossain, A.; Hassan, M.M.; Mostofa, M.G. Multivariate analysis of morpho-physiological traits reveals differential drought tolerance potential of bread wheat genotypes at the seedling stage. Plants 2021, 10, 879. [Google Scholar] [CrossRef]
- Mekaoussi, R.; Rabti, A.-b.; Fellahi, Z.E.A.; Hannachi, A.; Benmahammed, A.; Bouzerzour, H. Assessment of durum wheat (Triticum durum Desf.) genotypes based on their agro-physiological characteristics and stress tolerance indices. Acta Agric. Slov. 2021, 117, 1–16. [Google Scholar] [CrossRef]
- Ayed, S.; Othmani, A.; Bouhaouel, I.; Teixeira da Silva, J.A. Multi-environment screening of durum wheat genotypes for drought tolerance in changing climatic events. Agronomy 2021, 11, 875. [Google Scholar] [CrossRef]
- Sulaiman, F.S.; Aziz, J.M.; Ismail, N.B. Genetic study of some drought tolerance indicators in the first generation of durum wheat (Triticum durum Desf.). Passer J. Basic Appl. Sci. 2023, 5, 362–370. [Google Scholar] [CrossRef]
- Shamuyarira, K.W.; Shimelis, H.; Figlan, S.; Chaplot, V. Combining ability analysis of yield and biomass allocation related traits in newly developed wheat populations. Sci. Rep. 2023, 13, 11832. [Google Scholar] [CrossRef]
- Kamara, M.; Rehan, M.; Mohamed, A.; El Mantawy, R.; Kheir, A.; Abd El-Moneim, D.; Safhi, F.; Alshamrani, S.; Hafez, E.; Behiry, S.; et al. Genetic potential and inheritance patterns of physiological, agronomic and quality traits in bread wheat under normal and water deficit conditions. Plants 2022, 11, 952. [Google Scholar] [CrossRef] [PubMed]
- Askander, H.S.A. Combining ability and stability studies in F1 populations of Triticum durum across environments. Pak. J. Bot 2020, 52, 1685–1696. [Google Scholar] [CrossRef] [PubMed]
- Semahegn, Y.; Shimelis, H.; Laing, M.; Mathew, I. Combining ability of bread wheat genotypes for yield and yield-related traits under drought-stressed and non-stressed conditions. S. Afr. J. Plant Soil 2021, 38, 171–179. [Google Scholar] [CrossRef]
- Sharma, V.; Dodiya, N.S.; Dubey, R.B.; Khan, R. Combining ability analysis in bread wheat (Triticum aestivum L.) Em. Thell) under different environmental conditions. Bangladesh J. Bot. 2019, 48, 85–93. [Google Scholar] [CrossRef]
- Mwadzingeni, L.; Shimelis, H.; Tsilo, T.J. Combining ability and gene action controlling yield and yield components in bread wheat (Triticum aestivum L.) under drought stressed and nonstressed conditions. Plant Breed. 2018, 137, 502–513. [Google Scholar] [CrossRef]






| Marker | Forward Primer | Reverse Primer |
|---|---|---|
| Xgwm 11 | GGATAGTCAGACAATTCTTGTG | GTGAATTGTGTCTTGTATGCTTCC |
| Xgwm 99 | AAGATGGACGTATGCATCACA | GCCATATTTGATGACGCATA |
| Xgwm 108 | CGACAATGGGGTCTTAGCAT | TGCACACTTAAATTACATCCGC |
| Xgwm 186 | GCAGAGCCTGGTTCAAAAAG | CGCCTCTAGCGAGAGCTATG |
| Xgwm 337 | CCTCTTCCTCCCTCACTTAGC | TGCTAACTGGCCTTTGCC |
| Xgwm 357 | TATGGTCAAAGTTGGACCTCG | AGGCTGCAGCTCTTCTTCAG |
| Xgwm 389 | ATCATGTCGATCTCCTTGACG | TGCCATGCACATTAGCAGAT |
| Xgwm 484 | ACATCGCTCTTCACAAACCC | AGTTCCGGTCATGGCTAGG |
| Xgwm 603 | ACAAACGGTGACAATGCAAGGA | CGCCTCTCTCGTAAGCCTCAAC |
| Xgwm 626 | GATCTAAAATGTTATTTTCTCTC | TGACTATCAGCTAAACGTGT |
| Xpsp 3200 | GTTCTGAAGACATTACGGATG | GAGAATAGCTGGTTTTGTGG |
| Xwmc 78 | AGTAAATCCTCCCTTCGGCTTC | AGCTTCTTTGCTAGTCCGTTGC |
| Xwmc 89 | ATGTCCACGTGCTAGGGAGGTA | TTGCCTCCCAAGACGAAATAAC |
| Xwmc 118 | AGAATTAGCCCTTGAGTTGGTC | CTCCCATCGCTAAAGATGGTAT |
| Xwmc 304 | CGATACAAGGAAGACCAGCC | GGTTCGTCTGGTTCGCAAGT |
| Locus | Size Range of Alleles (bp) | Alleles Number | Major Allele Frequency | Gene Diversity (He) | PIC | |
|---|---|---|---|---|---|---|
| Min Allele | Max Allele | |||||
| Xgwm 11 | 50 | 170 | 3 | 0.48 | 0.60 | 0.51 |
| Xgwm 99 | 230 | 250 | 2 | 0.39 | 0.47 | 0.36 |
| Xgwm 108 | 50 | 400 | 5 | 0.81 | 0.33 | 0.32 |
| Xgwm 186 | 50 | 150 | 3 | 0.56 | 0.54 | 0.45 |
| Xgwm 337 | 50 | 350 | 4 | 0.30 | 0.75 | 0.70 |
| Xgwm 357 | 50 | 600 | 6 | 0.38 | 0.75 | 0.71 |
| Xgwm 389 | 130 | 400 | 2 | 0.63 | 0.47 | 0.36 |
| Xgwm 484 | 150 | 600 | 4 | 0.34 | 0.71 | 0.65 |
| Xgwm 603 | 50 | 900 | 5 | 0.33 | 0.73 | 0.68 |
| Xgwm 626 | 50 | 150 | 3 | 0.35 | 0.66 | 0.59 |
| Xpsp 3200 | 70 | 800 | 4 | 0.48 | 0.65 | 0.59 |
| Xwmc 78 | 100 | 600 | 6 | 0.25 | 0.82 | 0.80 |
| Xwmc 89 | 50 | 200 | 4 | 0.34 | 0.74 | 0.69 |
| Xwmc 118 | 40 | 200 | 4 | 0.42 | 0.68 | 0.63 |
| Xwmc 118 | 50 | 200 | 4 | 0.33 | 0.72 | 0.67 |
| Parent | P1 (W988) | P2 (W994) | P3 (W996) | P4 (W1011) | P5 (W1518) | P6 (W1520) | P7 (Bani-Suef-5) |
|---|---|---|---|---|---|---|---|
| P1 (W988) | - | ||||||
| P2 (W994) | 0.24 | - | |||||
| P3 (W996) | 0.24 | 0.15 | - | ||||
| P4 (W1011) | 0.31 | 0.20 | 0.16 | - | |||
| P5 (W1518) | 0.46 | 0.39 | 0.37 | 0.38 | - | ||
| P6 (W1520) | 0.24 | 0.17 | 0.13 | 0.09 | 0.40 | - | |
| P7 (Bani-Suef-5) | 0.23 | 0.19 | 0.10 | 0.13 | 0.37 | 0.12 | - |
| P8 (Bani-Suef-7) | 0.34 | 0.18 | 0.13 | 0.08 | 0.33 | 0.11 | 0.15 |
| SOV | df | Days to Heading | Plant Height (cm) | Spike Length (cm) | No. of Spikelets Per Spike | ||||
|---|---|---|---|---|---|---|---|---|---|
| Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | ||
| Replication | 2 | 16.03 ** | 7.95 | 150.25 ** | 88.95 ** | 3.88 ** | 5.27 ** | 11.76 ** | 6.89 ** |
| Genotype (G) | 35 | 26.89 ** | 20.29 ** | 29.28 ** | 30.59 ** | 1.18 ** | 0.80 ** | 2.10 ** | 2.65 ** |
| Parent (P) | 7 | 35.88 ** | 20.52 ** | 51.52 ** | 36.93 ** | 1.78 ** | 0.93 ** | 2.82 ** | 4.81 ** |
| F1 Cross (C) | 27 | 25.55 ** | 19.35 ** | 23.86 ** | 29.27 ** | 1.00 ** | 0.80 ** | 1.97 ** | 2.08 ** |
| P vs. C | 1 | 0.02 | 44.37 ** | 20.02 | 21.91 | 1.90 ** | 0.01 | 0.54 | 2.79 |
| Error | 70 | 2.98 | 3.13 | 8.79 | 6.00 | 0.06 | 0.07 | 0.77 | 0.70 |
| GCA | 7 | 32.77 ** | 40.07 ** | 22.92 ** | 26.48 ** | 1.19 ** | 0.69 ** | 2.59 ** | 2.61 ** |
| SCA | 28 | 3.01 ** | 5.94 ** | 6.47 ** | 6.13 ** | 0.19 ** | 0.16 ** | 0.48 * | 0.45 |
| Error | 70 | 0.99 | 1.04 | 2.93 | 2.00 | 0.02 | 0.02 | 0.26 | 0.23 |
| K2GCA/K2SCA | 1.58 | 1.18 | 0.56 | 0.59 | 0.67 | 0.48 | 1.06 | 1.10 | |
| SOV | df | No. of Spikes Per Plant | No. of Grains Per Spike | 1000-Grain Weight (g) | Grain Yield Per Plant (g) | ||||
| Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | ||
| Replication | 2 | 62.69 ** | 68.18 ** | 439.45 ** | 203.06 ** | 303.45 ** | 246.78 ** | 101.73 ** | 122.84 ** |
| Genotype (G) | 35 | 29.67 ** | 28.24 ** | 205.62 ** | 172.59 ** | 67.08 ** | 65.65 ** | 202.06 ** | 175.29 ** |
| Parent (P) | 7 | 30.48 ** | 35.79 ** | 78.52 ** | 71.05 ** | 98.90 ** | 83.42 ** | 174.61 ** | 130.19 ** |
| F1 Cross (C) | 27 | 23.73 ** | 22.45 ** | 228.11 ** | 192.26 ** | 43.49 ** | 48.68 ** | 132.56 ** | 138.51 ** |
| P vs. C | 1 | 184.38 ** | 131.56 ** | 488.02 ** | 352.45 ** | 481.22 ** | 399.29 ** | 2270.91 ** | 1484.13 ** |
| Error | 70 | 5.26 | 2.68 | 21.52 | 11.43 | 12.81 | 7.88 | 2.93 | 1.77 |
| GCA | 7 | 31.69 ** | 34.80 ** | 183.54 ** | 178.15 ** | 70.68 ** | 67.95 ** | 166.40 ** | 158.74 ** |
| SCA | 28 | 4.44 ** | 3.06 ** | 39.79 ** | 27.38 ** | 10.28 ** | 10.36 ** | 42.59 ** | 33.35 ** |
| Error | 70 | 1.75 | 0.89 | 7.17 | 3.81 | 4.27 | 2.63 | 0.98 | 0.59 |
| K2GCA/K2SCA | 1.11 | 1.56 | 0.54 | 0.74 | 1.10 | 0.84 | 0.40 | 0.48 | |
| Parent | Days to Heading | Plant Height (cm) | Spike Length (cm) | Number of Spikelets/Spike | ||||
|---|---|---|---|---|---|---|---|---|
| Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | |
| P1 (W988) | 0.22 | 0.48 | 1.52 ** | 1.47 ** | −0.34 ** | −0.24 ** | −0.51 ** | −0.66 ** |
| P2 (W994) | 3.48 ** | 1.54 ** | 0.26 | 0.30 | 0.11 ** | 0.12 * | 0.35 * | 0.59 ** |
| P3 (W996) | 1.55 ** | 0.81 ** | 0.36 | 0.93 * | 0.13 ** | 0.08 | −0.23 | 0.05 |
| P4 (W1011) | −1.45 ** | −0.56 | 0.29 | 0.09 | 0.25 ** | 0.01 | −0.06 | −0.05 |
| P5 (W1518) | −1.98 ** | 0.21 | −2.54 ** | −2.50 ** | −0.38 ** | −0.32 ** | −0.56 ** | −0.86 ** |
| P6 (W1520) | −1.35 ** | −1.69 ** | −0.01 | −0.27 | −0.39 ** | −0.29 ** | 0.46 ** | 0.21 |
| P7 (P7) | 1.02 ** | −0.86 ** | 1.93 ** | 2.17 ** | 0.57 ** | 0.43 ** | 0.30 * | 0.44 ** |
| P8 (P8) | −1.48 ** | −1.03 ** | −1.81 ** | −2.10 ** | 0.14 | 0.21 ** | 0.23 | 0.27 |
| LSD (0.05) gi | 0.59 | 0.60 | 1.01 | 0.83 | 0.08 | 0.09 | 0.30 | 0.28 |
| LSD (0.01) gi | 0.78 | 0.80 | 1.34 | 1.10 | 0.11 | 0.12 | 0.39 | 0.38 |
| Parent | No. of Spikes Per Plant | No. of Grains Per Spike | 1000-Grain Weight (g) | Grain Yield Per Plant (g) | ||||
| Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | |
| P1 (W988) | −2.02 ** | −2.43 ** | −4.95 ** | −5.69 ** | −1.19 | −1.83 ** | −3.32 ** | −4.09 ** |
| P2 (W994) | −0.58 | −0.63 * | −1.55 | −1.72 ** | −1.59 * | −1.39 ** | −1.15 ** | −0.23 |
| P3 (W996) | −0.15 | −0.10 | −2.25 ** | −1.76 ** | −1.33 * | −1.16 * | −1.42 ** | −1.53 ** |
| P4 (W1011) | −1.12 ** | −1.30 ** | −0.65 | −0.49 | −1.79 ** | −1.59 ** | −2.85 ** | −2.06 ** |
| P5 (W1518) | −1.22 ** | −1.13 ** | −4.08 ** | −3.52 ** | −2.46 ** | −2.43 ** | −5.02 ** | −5.09 ** |
| P6 (W1520) | −0.18 | 0.37 | 2.45 ** | 1.64 ** | 0.11 | 0.34 | 2.78 ** | 2.44 ** |
| P7 (Bani-Suef−5) | 1.88 ** | 1.83 ** | 7.58 ** | 6.81 ** | 3.64 ** | 3.91 ** | 6.18 ** | 4.94 ** |
| P8 (P8) | 3.38 ** | 3.40 ** | 4.45 ** | 5.04 ** | 4.61 ** | 4.14 ** | 4.78 ** | 5.61 ** |
| LSD (0.05) gi | 0.78 | 0.56 | 1.58 | 1.15 | 1.22 | 0.95 | 0.58 | 0.45 |
| LSD (0.01) gi | 1.03 | 0.74 | 2.09 | 1.52 | 1.61 | 1.27 | 0.77 | 0.60 |
| Cross | Days to Heading | Plant Height (cm) | Spike Length (cm) | No. of Spikelets/ Spike | ||||
|---|---|---|---|---|---|---|---|---|
| Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | |
| P1 × P2 (W988 × W994) | −1.76 ** | −5.19 ** | 6.58 ** | 6.64 ** | 0.07 | 0.37 * | 0.22 | 0.61 |
| P1 × P3 (W988 × W996) | −1.49 | −2.46 ** | 0.48 | 2.34 | 0.15 | −0.37 * | −0.53 | −0.03 |
| P1 × P4 (W988 × W1011) | 1.51 | −0.09 | 2.88 | 3.61 ** | −0.40 ** | 0.10 | −0.27 | −0.03 |
| P1 × P5 (W988 × W1518) | 1.04 | −0.19 | −2.62 | −1.23 | −0.13 | −0.47 ** | 0.53 | −0.02 |
| P1 × P6 (W988 × W1520) | −0.59 | −0.63 | −1.82 | 0.54 | −0.56 ** | −0.13 | −0.02 | 0.38 |
| P1 × P7 (W988 × Bani-Suef-5) | −0.29 | −0.89 | −3.42 * | −2.56 * | −0.02 | −0.18 | 0.30 | −0.34 |
| P1 × P8 (W988 × Bani-Suef-7) | −0.12 | 1.71 | −2.69 | −0.29 | −0.22 | 0.31 * | −0.33 | −0.41 |
| P2 × P3 (W994 × W996) | 3.58 ** | 1.81 | 1.08 | 0.51 | −0.30 * | 0.61 ** | −0.26 | 1.26 ** |
| P2 × P4 (W994 × W1011) | −0.42 | 3.17 ** | −0.19 | 0.77 | −0.28 * | 0.75 ** | 0.94 * | 0.09 |
| P2 × P5 (W994 × W1518) | −1.56 | 2.07 * | 1.64 | 0.94 | 0.65 ** | 0.24 | 0.51 | 0.87 |
| P2 × P6 (W994 × W1520) | 0.81 | 0.64 | 1.44 | 1.04 | 0.22 | −0.12 | 0.65 | −0.33 |
| P2 × P7 (W994 × Bani-Suef-5) | 3.11 ** | −0.29 | −1.49 | −2.39 | 0.33 * | −0.30 * | −0.32 | −0.22 |
| P2 × P8 (W994 × Bani-Suef-7) | −0.39 | −4.36 ** | −2.09 | −2.46 | 0.02 | −0.58 ** | 1.15 * | 0.48 |
| P3 × P4 (W996 × W1011) | 0.51 | 1.24 | −3.29 * | −3.53 ** | 0.66 ** | −0.32 * | 0.92 * | −0.21 |
| P3 × P5 (W996 × W1518) | −2.96 ** | −2.86 ** | 2.54 | 1.31 | −0.07 | −0.02 | −0.15 | −0.20 |
| P3 × P6 (W996 × W1520) | 0.08 | −2.29 * | 0.68 | −0.26 | 0.73 ** | −0.18 | 1.03 * | −0.33 |
| P3 × P7 (W996 × Bani-Suef-5) | −2.62 ** | −0.56 | −1.26 | −0.03 | 0.34 * | 0.00 | 0.12 | 0.28 |
| P3 × P8 (W996 × Bani-Suef-7) | −0.12 | 0.37 | 3.14 * | 1.91 | 0.27 * | 0.06 | 0.06 | −0.29 |
| P4 × P5 (W1011 × W1518) | 0.04 | −1.49 | −0.39 | −0.76 | −0.09 | −0.19 | −0.15 | −0.30 |
| P4 × P6 (W1011 × W1520) | −0.26 | 0.07 | 1.41 | 1.01 | 0.25 | 0.12 | −0.14 | 0.27 |
| P4 × P7 (W1011 × Bani-Suef-5) | −1.29 | −0.53 | 3.48 * | 2.91 * | −0.08 | −0.20 | 0.45 | −0.46 |
| P4 × P8 (W1011 × Bani-Suef-7) | −3.12 ** | −2.93 ** | 1.21 | 1.84 | −0.01 | −0.61 ** | −1.71 ** | −0.22 |
| P5 × P6 (W1518 × W1520) | 1.28 | −0.69 | −1.09 | −1.16 | −0.25 | −0.49 ** | −0.57 | −0.36 |
| P5 × P7 (W1518 × Bani-Suef-5) | −1.09 | 0.37 | 0.31 | 0.74 | 0.39 ** | 0.60 ** | −0.41 | −0.31 |
| P5 × P8 (W1518 × Bani-Suef-7) | 4.08 ** | 5.64 ** | 2.71 | −1.33 | 0.72 ** | 0.85 ** | 0.16 | −0.84 |
| P6 × P7 (W1520 × Bani-Suef-5) | 0.61 | −0.06 | −1.22 | −2.49 | −0.01 | 0.14 | −0.04 | −0.08 |
| P6 × P8 (W1520 × Bani-Suef-7) | −0.56 | −2.79 ** | −0.16 | 0.11 | 0.26 | 0.09 | −0.50 | −0.95 * |
| P7 × P8 (Bani-Suef-5 × Bani-Suef-8) | −0.26 | −1.39 | −1.42 | −0.99 | −0.60 ** | −0.19 | −0.54 | −0.70 |
| LSD 5% (sij) | 1.80 | 1.84 | 3.09 | 2.55 | 0.26 | 0.28 | 0.91 | 0.87 |
| LSD 1% (sij) | 2.39 | 2.45 | 4.10 | 3.39 | 0.34 | 0.38 | 1.21 | 1.16 |
| LSD 5% (sij-sik) | 2.66 | 2.73 | 4.57 | 3.78 | 0.38 | 0.42 | 1.35 | 1.29 |
| LSD 1% (sij-sik) | 3.53 | 3.62 | 6.06 | 5.01 | 0.51 | 0.56 | 1.79 | 1.71 |
| LSD 5% (sij-skl) | 2.51 | 2.57 | 4.31 | 3.56 | 0.36 | 0.40 | 1.27 | 1.22 |
| LSD 1% (sij-skl) | 3.33 | 3.41 | 5.72 | 4.72 | 0.48 | 0.53 | 1.69 | 1.62 |
| Cross | No. of Spikes /Plant | No. of Grains Per Spike | 1000-Grain Weight (g) | Grain Yield Per Plant (g) | ||||
| Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | Well-W. | Drought-S. | |
| P1 × P2 (W988 × W994) | −0.01 | 0.92 | 8.81 ** | 6.20 ** | 2.79 | 3.41 * | 8.60 ** | 7.55 ** |
| P1 × P3 (W988 × W996) | 1.89 | 1.72 * | −4.15 | −4.10 * | 0.86 | 1.84 | −0.14 | −1.15 |
| P1 × P4 (W988 × W1011) | −2.14 | −1.75 * | −8.09 ** | −6.03 ** | −0.34 | −1.06 | −7.37 ** | −6.95 ** |
| P1 × P5 (W988 × W1518) | −0.38 | 0.42 | −13.32 ** | −9.66 ** | −1.01 | 0.11 | 1.80 * | 5.08 ** |
| P1 × P6 (W988 × W1520) | −0.08 | −0.08 | −0.19 | −4.20 * | 2.09 | 0.68 | 8.66 ** | 2.55 ** |
| P1 × P7 (W988 × Bani-Suef-5) | 1.19 | −1.21 | 4.35 | 2.67 | 0.56 | −1.56 | 5.60 ** | 3.71 ** |
| P1 × P8 (W988 × Bani-Suef-7) | 3.36 ** | 1.89 * | 4.15 | 3.44 | 3.59 | 1.54 | 4.00 ** | 1.71 * |
| P2 × P3 (W994 × W996) | −1.88 | −2.08 * | −0.89 | −0.06 | 1.59 | 2.74 | 2.03 * | −1.02 |
| P2 × P4 (W994 × W1011) | 1.76 | 1.79 * | −1.15 | 1.34 | −2.61 | −2.82 | −0.87 | −3.15 ** |
| P2 × P5 (W994 × W1518) | −0.14 | −0.71 | −3.72 | −2.63 | 0.39 | −0.99 | 0.96 | −0.79 |
| P2 × P6 (W994 × W1520) | 1.16 | 1.45 | −1.25 | −1.50 | 3.16 | 3.24 * | −0.17 | 1.01 |
| P2 × P7 (W994 × Bani-Suef-5) | 0.42 | −0.35 | 3.61 | 2.04 | 3.96 * | 3.68 * | 2.10 * | 3.85 ** |
| P2 × P8 (W994 × Bani-Suef-7) | 0.26 | 0.09 | 1.75 | 1.47 | −0.34 | 0.11 | 1.83 * | 2.51 ** |
| P3 × P4 (W996 × W1011) | −0.01 | 0.59 | −5.12 * | −5.30 ** | 1.13 | 0.94 | 1.06 | 0.15 |
| P3 × P5 (W996 × W1518) | 2.42 | 2.09* | 4.98 * | 8.07 ** | 1.46 | 0.44 | 4.90 ** | 6.18 ** |
| P3 × P6 (W996 × W1520) | 0.39 | 0.25 | 5.78 * | 5.87 ** | 2.23 | 1.01 | 5.10 ** | 1.65 * |
| P3 × P7 (W996 × Bani-Suef-5) | 1.32 | 0.45 | 2.65 | 2.40 | 2.03 | 2.11 | 2.03 * | 1.48 * |
| P3 × P8 (W996 × Bani-Suef-7) | −0.51 | 0.22 | 3.78 | 2.50 | 0.06 | 0.54 | 1.10 | −0.52 |
| P4 × P5 (W1011 × W1518) | 4.06 ** | 2.29 ** | 3.71 | 4.47 * | 3.26 | 2.88 | 4.66 ** | 3.38 ** |
| P4 × P6 (W1011 × W1520) | 0.69 | 0.79 | 0.85 | 3.94 * | 3.36 | 3.78 * | 8.20 ** | 10.18 ** |
| P4 × P7 (W1011 × Bani-Suef-5) | 0.96 | 0.99 | 10.05 ** | 7.47 ** | 3.49 | 4.54 ** | 4.80 ** | 3.01 ** |
| P4 × P8 (W1011 × Bani-Suef-7) | 0.79 | 1.09 | 5.85 * | 2.90 | 1.19 | 0.98 | 4.53 ** | 2.68 ** |
| P5 × P6 (W1518 × W1520) | −0.21 | −0.05 | −1.39 | −5.03 ** | −1.97 | −3.39 * | −8.30 ** | −6.45 ** |
| P5 × P7 (W1518 × Bani-Suef-5) | 0.06 | 0.49 | 2.48 | 3.84 * | 4.49 * | 4.71 ** | 5.63 ** | 3.38 ** |
| P5 × P8 (W1518 × Bani-Suef-7) | 2.89 * | 1.92 * | 10.95 ** | 5.27 ** | 0.86 | 2.14 | 5.36 ** | 5.05 ** |
| P6 × P7 (W1520 × Bani-Suef-5) | −0.31 | 1.32 | −0.05 | 2.97 | −3.74 * | −4.39 ** | 1.83 * | −0.15 |
| P6 × P8 (W1520 × Bani-Suef-7) | 1.52 | 0.75 | 2.75 | 5.07 ** | −1.37 | 0.71 | 4.90 ** | 5.18 ** |
| P7 × P8 (Bani-Suef-5 × Bani-Suef-8) | 1.12 | 1.29 | −5.39 * | −1.40 | 0.43 | 0.81 | 4.17 ** | 5.35 ** |
| LSD 5% (sij) | 2.39 | 1.71 | 4.83 | 3.52 | 3.73 | 2.92 | 1.78 | 1.38 |
| LSD 1% (sij) | 3.17 | 2.26 | 6.41 | 4.67 | 4.95 | 3.88 | 2.37 | 1.84 |
| LSD 5% (sij-sik) | 3.53 | 2.52 | 7.15 | 5.21 | 5.52 | 4.33 | 2.64 | 2.05 |
| LSD 1% (sij-sik) | 4.69 | 3.35 | 9.49 | 6.91 | 7.32 | 5.74 | 3.50 | 2.72 |
| LSD 5% (sij-skl) | 3.33 | 2.38 | 6.74 | 4.91 | 5.20 | 4.08 | 2.49 | 1.93 |
| LSD 1% (sij-skl) | 4.42 | 3.16 | 8.94 | 6.52 | 6.90 | 5.41 | 3.30 | 2.56 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galal, A.A.; Safhi, F.A.; El-Hity, M.A.; Kamara, M.M.; Gamal El-Din, E.M.; Rehan, M.; Farid, M.; Behiry, S.I.; El-Soda, M.; Mansour, E. Molecular Genetic Diversity of Local and Exotic Durum Wheat Genotypes and Their Combining Ability for Agronomic Traits under Water Deficit and Well-Watered Conditions. Life 2023, 13, 2293. https://doi.org/10.3390/life13122293
Galal AA, Safhi FA, El-Hity MA, Kamara MM, Gamal El-Din EM, Rehan M, Farid M, Behiry SI, El-Soda M, Mansour E. Molecular Genetic Diversity of Local and Exotic Durum Wheat Genotypes and Their Combining Ability for Agronomic Traits under Water Deficit and Well-Watered Conditions. Life. 2023; 13(12):2293. https://doi.org/10.3390/life13122293
Chicago/Turabian StyleGalal, Ahmed A., Fatmah A. Safhi, Mahmoud A. El-Hity, Mohamed M. Kamara, Eman M. Gamal El-Din, Medhat Rehan, Mona Farid, Said I. Behiry, Mohamed El-Soda, and Elsayed Mansour. 2023. "Molecular Genetic Diversity of Local and Exotic Durum Wheat Genotypes and Their Combining Ability for Agronomic Traits under Water Deficit and Well-Watered Conditions" Life 13, no. 12: 2293. https://doi.org/10.3390/life13122293
APA StyleGalal, A. A., Safhi, F. A., El-Hity, M. A., Kamara, M. M., Gamal El-Din, E. M., Rehan, M., Farid, M., Behiry, S. I., El-Soda, M., & Mansour, E. (2023). Molecular Genetic Diversity of Local and Exotic Durum Wheat Genotypes and Their Combining Ability for Agronomic Traits under Water Deficit and Well-Watered Conditions. Life, 13(12), 2293. https://doi.org/10.3390/life13122293

