Gene Dysregulation in the Adult Rat Paraventricular Nucleus and Amygdala by Prenatal Exposure to Dexamethasone
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Paraventricular Nucleus
3.2. Amygdala
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Gene Family | Gene | Accession # | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|---|---|
Glucocorticoid Receptor | NR3C1 | NM_012576.2 | TGCTGGAGGTGATTGAACCC | TCACTTGACGCCCACCTAAC |
Glutamate Signalling | GRIA2 | NM_001083811.1 | TACGGCATCGCCACACCTA | CTTGGAATCACCTCCCCCGC |
SLC1A2 | NM_001035233.1 | GTCAATGCCGCACACAACTC | GAATGGATGCAGGGGATGGT | |
Calcium Signalling | Ryr2 | NM_001191043.1 | CACTGAGAAGCCAAGACCGAA | CTCCATGACCCTCAGGGGA |
PLCH2 | XM_017593885.1 | AAATCCCAGAGTGCCCATCC | ATCGTTCCACCACAGGCAAA | |
CACNB2 | NM_053851.1 | CAGCTGCACTGTCGGAATCT | AGTCATTCCATTTTTGCCCTGA | |
CACNA1B | NM_001195199.1 | GGGCTAATCTGCCCCAGAAG | GAGAGCCGCATAGACCTTCC | |
CACNA1C | NM_012517.2 | TCAAACGTCGCCACAGACAT | CGAAGGCCCGAATCATTGTG | |
CAM2KA | NM_012920.1 | AGACACCAAAGTGCGCAAAC | TTCCAGGGTCGCACATCTTC | |
Neural Transmission | SNAP25 | NM_001270575.1 | ATGTTGGATGAGCAAGGCGA | TCGGCCTCCTTCATGTCTTG |
Synaptophysin | NM_009305.2 | CAGTTCCGGGTGGTCAAGG | ACTCTCCGTCTTGTTGGCAC | |
Growth and Differentiation | LSAMP | NM_017242.1 | CACTGAGGAACACTACGGCA | ACCCGGGTCTGAAAAGGACT |
of Neurons | NTM | NM_001357593.1 | TCATGCTATTTGGCCCAGGT | GGAAGGGGCACTCACATCAA |
Lysosomal Homeostasis | MBTPS1 | NM_053569.1 | GCGAGTAAACATCCCCCGAA | CCCAAATCTAGCAGGAGCCC |
Prion Protein | PRNP1 | NM_012631.3 | CCAAGCCGACTATCAGCCAT | GCTTTTTGCAGAGGCCAACA |
Reference Genes | CycA | NM_017101.1 | CAGACGCCGCTGTCTCTTTTC | CGTGATGTCGAAGAACACGGT |
Ywhaz | NM_013011.3 | GGCAGAGCGATACGATGACA | AAGATGACCTACGGGCTCCT |
References
- Hales, C.N.; Barker, D.J.P. Type 2 (Non-Insulin-Dependent) Diabetes Mellitus: The Thrifty Phenotype Hypothesis. Diabetologia 1992, 35, 595–601. [Google Scholar] [CrossRef] [PubMed]
- Hales, C.N.; Barker, D.J.P. The Thrifty Phenotype Hypothesis. Br. Med. Bull. 2001, 60, 5–20. [Google Scholar] [CrossRef] [Green Version]
- Calkins, K.; Devaskar, S.U. Fetal Origins of Adult Disease. Curr. Probl. Pediatr. Adolesc. Health Care 2011, 41, 158–176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Glover, V.; O’Donnell, K.J.; O’Connor, T.G.; Fisher, J. Prenatal Maternal Stress, Fetal Programming, and Mechanisms Underlying Later Psychopathology—A Global Perspective. Dev. Psychopathol. 2018, 30, 843–854. [Google Scholar] [CrossRef] [PubMed]
- Sandman, C.A.; Glynn, L.M.; Davis, E.P. Is There a Viability-Vulnerability Tradeoff? Sex Differences in Fetal Programming. J. Psychosom. Res. 2013, 75, 327–335. [Google Scholar] [CrossRef] [Green Version]
- Welberg, L.A.; Seckl, J.R.; Holmes, M.C. Inhibition of 11beta-Hydroxysteroid Dehydrogenase, the Foeto-Placental Barrier to Maternal Glucocorticoids, Permanently Programs Amygdala GR MRNA Expression and Anxiety-like Behaviour in the Offspring. Eur. J. Neurosci. 2000, 12, 1047–1054. [Google Scholar] [CrossRef]
- Angelousi, A.; Margioris, A.N.; Tsatsanis, C. ACTH Action on the Adrenals. In Endotext; Feingold, K.R., Anawalt, B., Boyce, A., Chrousos, G., de Herder, W.W., Dhatariya, K., Dungan, K., Hershman, J.M., Hofland, J., Kalra, S., et al., Eds.; MDText.com, Inc.: South Dartmouth, MA, USA, 2000. [Google Scholar]
- Hakamata, Y.; Komi, S.; Moriguchi, Y.; Izawa, S.; Motomura, Y.; Sato, E.; Mizukami, S.; Kim, Y.; Hanakawa, T.; Inoue, Y.; et al. Amygdala-Centred Functional Connectivity Affects Daily Cortisol Concentrations: A Putative Link with Anxiety. Sci. Rep. 2017, 7, 8313. [Google Scholar] [CrossRef] [Green Version]
- Herman, J.P.; Cullinan, W.E. Neurocircuitry of Stress: Central Control of the Hypothalamo-Pituitary-Adrenocortical Axis. Trends Neurosci. 1997, 20, 78–84. [Google Scholar] [CrossRef]
- Thau, L.; Gandhi, J.; Sharma, S. Physiology, Cortisol. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2021. [Google Scholar]
- Kwon, E.J.; Kim, Y.J. What Is Fetal Programming?: A Lifetime Health Is under the Control of in Utero Health. Obstet. Gynecol. Sci. 2017, 60, 506–519. [Google Scholar] [CrossRef]
- Benediktsson, R.; Calder, A.A.; Edwards, C.R.W.; Seckl, J.R. Placental 11β-Hydroxysteroid Dehydrogenase: A Key Regulator of Fetal Glucocorticoid Exposure. Clin. Endocrinol. 1997, 46, 161–166. [Google Scholar] [CrossRef]
- Galbally, M.; Watson, S.J.; Lappas, M.; de Kloet, E.R.; van Rossum, E.; Wyrwoll, C.; Mark, P.; Lewis, A.J. Fetal Programming Pathway from Maternal Mental Health to Infant Cortisol Functioning: The Role of Placental 11β-HSD2 MRNA Expression. Psychoneuroendocrinology 2021, 127, 105197. [Google Scholar] [CrossRef] [PubMed]
- Seckl, J.R. Glucocorticoid Programming of the Fetus; Adult Phenotypes and Molecular Mechanisms. Mol. Cell. Endocrinol. 2001, 185, 61–71. [Google Scholar] [CrossRef]
- Van den Bergh, B.R.H.; Van Calster, B.; Smits, T.; Van Huffel, S.; Lagae, L. Antenatal Maternal Anxiety Is Related to HPA-Axis Dysregulation and Self-Reported Depressive Symptoms in Adolescence: A Prospective Study on the Fetal Origins of Depressed Mood. Neuropsychopharmacology 2008, 33, 536–545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buss, C.; Davis, E.P.; Shahbaba, B.; Pruessner, J.C.; Head, K.; Sandman, C.A. Maternal Cortisol over the Course of Pregnancy and Subsequent Child Amygdala and Hippocampus Volumes and Affective Problems. Proc. Natl. Acad. Sci. USA 2012, 109, 1312–1319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lamothe, J.; Khurana, S.; Tharmalingam, S.; Williamson, C.; Byrne, C.J.; Khaper, N.; Mercier, S.; Tai, T.C. The Role of DNMT and HDACs in the Fetal Programming of Hypertension by Glucocorticoids. Oxid. Med. Cell. Longev. 2020, 2020, 5751768. [Google Scholar] [CrossRef] [PubMed]
- Lalonde, C.; Grandbois, J.; Khurana, S.; Murray, A.; Tharmalingam, S.; Tai, T. Late Gestational Exposure to Dexamethasone and Fetal Programming of Abnormal Behavior in Wistar Kyoto Rats. Brain Behav. 2021, 11, e02049. [Google Scholar] [CrossRef] [PubMed]
- Edwards, L.J.; Coulter, C.L.; Symonds, M.E.; McMillen, I.C. Prenatal Undernutrition, Glucocorticoids and the Programming of Adult Hypertension. Clin. Exp. Pharmacol. Physiol. 2001, 28, 938–941. [Google Scholar] [CrossRef]
- Khurana, S.; Grandbois, J.; Tharmalingam, S.; Murray, A.; Graff, K.; Nguyen, P.; Tai, T.C. Fetal Programming of Adrenal PNMT and Hypertension by Glucocorticoids in WKY Rats Is Dose and Sex-Dependent. PLoS ONE 2019, 14, e0221719. [Google Scholar] [CrossRef] [Green Version]
- Amaya, J.M.; Suidgeest, E.; Sahut-Barnola, I.; Dumontet, T.; Montanier, N.; Pagès, G.; Keller, C.; van der Weerd, L.; Pereira, A.M.; Martinez, A.; et al. Effects of Long-Term Endogenous Corticosteroid Exposure on Brain Volume and Glial Cells in the AdKO Mouse. Front. Neurosci. 2021, 15, 16. [Google Scholar] [CrossRef]
- Coe, C.L.; Kramer, M.; Czéh, B.; Gould, E.; Reeves, A.J.; Kirschbaum, C.; Fuchs, E. Prenatal Stress Diminishes Neurogenesis in the Dentate Gyrus of Juvenile Rhesus Monkeys. Biol. Psychiatry 2003, 54, 1025–1034. [Google Scholar] [CrossRef]
- Davis, E.P.; Sandman, C.A.; Buss, C.; Wing, D.A.; Head, K. Fetal Glucocorticoid Exposure Is Associated with Preadolescent Brain Development. Biol. Psychiatry 2013, 74, 647–655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monk, C.; Lugo-Candelas, C.; Trumpff, C. Prenatal Developmental Origins of Future Psychopathology: Mechanisms and Pathways. Annu. Rev. Clin. Psychol. 2019, 15, 317–344. [Google Scholar] [CrossRef]
- Krontira, A.C.; Cruceanu, C.; Binder, E.B. Glucocorticoids as Mediators of Adverse Outcomes of Prenatal Stress. Trends Neurosci. 2020, 43, 394–405. [Google Scholar] [CrossRef] [PubMed]
- Davis, E.P.; Hankin, B.L.; Swales, D.A.; Hoffman, M.C. An Experimental Test of the Fetal Programming Hypothesis: Can We Reduce Child Ontogenetic Vulnerability to Psychopathology by Decreasing Maternal Depression? Dev. Psychopathol. 2018, 30, 787–806. [Google Scholar] [CrossRef] [PubMed]
- Goasdoué, K.; Miller, S.M.; Colditz, P.B.; Björkman, S.T. Review: The Blood-Brain Barrier; Protecting the Developing Fetal Brain. Placenta 2017, 54, 111–116. [Google Scholar] [CrossRef] [Green Version]
- Karssen, A.M.; Meijer, O.C.; van der Sandt, I.C.; Lucassen, P.J.; de Lange, E.C.; de Boer, A.G.; de Kloet, E.R. Multidrug Resistance P-Glycoprotein Hampers the Access of Cortisol but Not of Corticosterone to Mouse and Human Brain. Endocrinology 2001, 142, 2686–2694. [Google Scholar] [CrossRef]
- Uhr, M.; Holsboer, F.; Müller, M.B. Penetration of Endogenous Steroid Hormones Corticosterone, Cortisol, Aldosterone and Progesterone into the Brain Is Enhanced in Mice Deficient for Both Mdr1a and Mdr1b P-Glycoproteins. J. Neuroendocrinol. 2002, 14, 753–759. [Google Scholar] [CrossRef]
- Mason, B.L.; Pariante, C.M.; Jamel, S.; Thomas, S.A. Central Nervous System (CNS) Delivery of Glucocorticoids Is Fine-Tuned by Saturable Transporters at the Blood-CNS Barriers and Nonbarrier Regions. Endocrinology 2010, 151, 5294–5305. [Google Scholar] [CrossRef]
- Kawano, H.; Masuko, S. Region-specific projections from the subfornical organ to the paraventricular hypothalamic nucleus in the rat. Neuroscience 2010, 169, 1227–1234. [Google Scholar] [CrossRef]
- Rodriguez, E.M.; Blazquez, J.L.; Guerra, M. The design of barriers in the hypothalamus allows the median eminence and the arcuate nucleus to enjoy private milieus: The former opens to the portal blood and the latter to the cerebrospinal fluid. Peptides 2010, 31, 757–776. [Google Scholar] [CrossRef]
- Welberg, L.A.; Seckl, J.R.; Holmes, M.C. Prenatal Glucocorticoid Programming of Brain Corticosteroid Receptors and Corticotrophin-Releasing Hormone: Possible Implications for Behaviour. Neuroscience 2001, 104, 71–79. [Google Scholar] [CrossRef]
- Xu, Y.-J.; Sheng, H.; Wu, T.-W.; Bao, Q.-Y.; Zheng, Y.; Zhang, Y.-M.; Gong, Y.-X.; Lu, J.-Q.; You, Z.-D.; Xia, Y.; et al. CRH/CRHR1 Mediates Prenatal Synthetic Glucocorticoid Programming of Depression-like Behavior across 2 Generations. FASEB J. 2018, 32, 4258–4269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Graham, A.M.; Rasmussen, J.M.; Entringer, S.; Ben Ward, E.; Rudolph, M.D.; Gilmore, J.H.; Styner, M.; Wadhwa, P.D.; Fair, D.A.; Buss, C. Maternal Cortisol Concentrations During Pregnancy and Sex Specific Associations with Neonatal Amygdala Connectivity and Emerging Internalizing Behaviors. Biol. Psychiatry 2019, 85, 172–181. [Google Scholar] [CrossRef] [Green Version]
- Aronsson, M.; Fuxe, K.; Dong, Y.; Agnati, L.F.; Okret, S.; Gustafsson, J.A. Localization of Glucocorticoid Receptor MRNA in the Male Rat Brain by in Situ Hybridization. Proc. Natl. Acad. Sci. USA 1988, 85, 9331–9335. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di, S.; Malcher-Lopes, R.; Halmos, K.C.; Tasker, J.G. Nongenomic Glucocorticoid Inhibition via Endocannabinoid Release in the Hypothalamus: A Fast Feedback Mechanism. J. Neurosci. 2003, 23, 4850–4857. [Google Scholar] [CrossRef] [Green Version]
- Lightman, S.L.; Birnie, M.T.; Conway-Campbell, B.L. Dynamics of ACTH and Cortisol Secretion and Implications for Disease. Endocr. Rev. 2020, 41, bnaa002. [Google Scholar] [CrossRef] [Green Version]
- LeDoux, J. The Amygdala. Curr. Biol. 2007, 17, 868–874. [Google Scholar] [CrossRef] [Green Version]
- Tye, K.M.; Prakash, R.; Kim, S.-Y.; Fenno, L.E.; Grosenick, L.; Zarabi, H.; Thompson, K.R.; Gradinaru, V.; Ramakrishnan, C.; Deisseroth, K. Amygdala Circuitry Mediating Reversible and Bidirectional Control of Anxiety. Nature 2011, 471, 358–363. [Google Scholar] [CrossRef]
- Janak, P.H.; Tye, K.M. From Circuits to Behaviour in the Amygdala. Nature 2015, 517, 284–292. [Google Scholar] [CrossRef] [Green Version]
- Rubin, R.T.; Mandell, A.J.; Crandall, P.H. Corticosteroid Responses to Limbic Stimulation in Man: Localization of Stimulus Sites. Science 1966, 153, 767–768. [Google Scholar] [CrossRef]
- Dunn, J.D.; Orr, S.E. Differential Plasma Corticosterone Responses to Hippocampal Stimulation. Exp. Brain Res. 1984, 54, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Herman, J.P.; Ostrander, M.M.; Mueller, N.K.; Figueiredo, H. Limbic System Mechanisms of Stress Regulation: Hypothalamo-Pituitary-Adrenocortical Axis. Prog. Neuropsychopharmacol. Biol. Psychiatry 2005, 29, 1201–1213. [Google Scholar] [CrossRef] [PubMed]
- Walf, A.A.; Frye, C.A. The Use of the Elevated plus Maze as an Assay of Anxiety-Related Behavior in Rodents. Nat. Protoc. 2007, 2, 322–328. [Google Scholar] [CrossRef] [Green Version]
- Treit, D.; Fundytus, M. Thigmotaxis as a Test for Anxiolytic Activity in Rats. Pharmacol. Biochem. Behav. 1988, 31, 959–962. [Google Scholar] [CrossRef]
- Haynes, L.E.; Griffiths, M.R.; Hyde, R.E.; Barber, D.J.; Mitchell, I.J. Dexamethasone Induces Limited Apoptosis and Extensive Sublethal Damage to Specific Subregions of the Striatum and Hippocampus: Implications for Mood Disorders. Neuroscience 2001, 104, 57–69. [Google Scholar] [CrossRef]
- Campbell, S.; MacQueen, G. The Role of the Hippocampus in the Pathophysiology of Major Depression. J. Psychiatry Neurosci. 2004, 29, 417–426. [Google Scholar]
- Hall, B.S.; Moda, R.N.; Liston, C. Glucocorticoid Mechanisms of Functional Connectivity Changes in Stress-Related Neuropsychiatric Disorders. Neurobiol. Stress 2014, 1, 174–183. [Google Scholar] [CrossRef] [Green Version]
- Paxinos, G.; Franklin, K.B.J. Paxinos and Franklin’s The Mouse Brain in Stereotaxic Coordinates; Academic Press: Cambridge, MA, USA, 1997. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Mychasiuk, R.; Gibb, R.; Kolb, B. Prenatal Stress Produces Sexually Dimorphic and Regionally Specific Changes in Gene Expression in Hippocampus and Frontal Cortex of Developing Rat Offspring. DNE 2011, 33, 531–538. [Google Scholar] [CrossRef]
- Bonefeld, B.E.; Elfving, B.; Wegener, G. Reference genes for normalization: A study of rat brain tissue. Synapse 2008, 62, 302–309. [Google Scholar] [CrossRef]
- The Jamovi Project. Jamovi, (Version 1.6); Jamovi: Sydney, NSW, Australia, 2021; Available online: https://www.jamovi.org (accessed on 28 December 2021).
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022; Available online: https://www.R-project.org/ (accessed on 5 April 2022).
- Barson, J.R.; Mack, N.R.; Gao, W.J. The paraventricular nucleus of the thalamus is an important node in the emotional processing network. Front. Behav. Neurosci. 2020, 14, 191. [Google Scholar] [CrossRef] [PubMed]
- Kapoor, A.; Dunn, E.; Kostaki, A.; Andrews, M.H.; Matthews, S.G. Fetal Programming of Hypothalamo-Pituitary-Adrenal Function: Prenatal Stress and Glucocorticoids. J. Physiol. 2006, 572 Pt 1, 31–44. [Google Scholar] [CrossRef] [PubMed]
- Anacker, C.; Zunszain, P.A.; Carvalho, L.A.; Pariante, C.M. The Glucocorticoid Receptor: Pivot of Depression and of Antidepressant Treatment? Psychoneuroendocrinology 2011, 36, 415–425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Kloet, E.R.; Molendijk, M.L. Coping with the Forced Swim Stressor: Towards Understanding an Adaptive Mechanism. Neural Plast. 2016, 2016, 6503162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, H.; Cui, S.-Y.; Cui, X.-Y.; Liu, Y.-T.; Hu, X.; Zhao, H.-L.; Qin, Y.; Kurban, N.; Zhang, Y.-H. Anti-Stress Effects of Combined Block of Glucocorticoid and Mineralocorticoid Receptors in the Paraventricular Nucleus of the Hypothalamus. Br. J. Pharmacol. 2021, 178, 3696–3707. [Google Scholar] [CrossRef]
- Levitt, N.S.; Lindsay, R.S.; Holmes, M.C.; Seckl, J.R. Dexamethasone in the Last Week of Pregnancy Attenuates Hippocampal Glucocorticoid Receptor Gene Expression and Elevates Blood Pressure in the Adult Offspring in the Rat. Neuroendocrinology 1996, 64, 412–418. [Google Scholar] [CrossRef]
- Laryea, G.; Schütz, G.; Muglia, L.J. Disrupting Hypothalamic Glucocorticoid Receptors Causes HPA Axis Hyperactivity and Excess Adiposity. Mol. Endocrinol. 2013, 27, 1655–1665. [Google Scholar] [CrossRef] [Green Version]
- De Vries, A.; Holmes, M.C.; Heijnis, A.; Seier, J.V.; Heerden, J.; Louw, J.; Wolfe-Coote, S.; Meaney, M.J.; Levitt, N.S.; Seckl, J.R. Prenatal Dexamethasone Exposure Induces Changes in Nonhuman Primate Offspring Cardiometabolic and Hypothalamic-Pituitary-Adrenal Axis Function. J. Clin. Investig. 2007, 117, 1058–1067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schneider, M.L.; Moore, C.F.; Kraemer, G.W.; Roberts, A.D.; DeJesus, O.T. The Impact of Prenatal Stress, Fetal Alcohol Exposure, or Both on Development: Perspectives from a Primate Model. Psychoneuroendocrinology 2002, 27, 285–298. [Google Scholar] [CrossRef]
- Handa, R.J.; Burgess, L.H.; Kerr, J.E.; O’Keefe, J.A. Gonadal Steroid Hormone Receptors and Sex Differences in the Hypothalamo-Pituitary-Adrenal Axis. Horm. Behav. 1994, 28, 464–476. [Google Scholar] [CrossRef]
- Handa, R.J.; Weiser, M.J. Gonadal Steroid Hormones and the Hypothalamo-Pituitary-Adrenal Axis. Front. Neuroendocrinol. 2014, 35, 197–220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hiroi, R.; Carbone, D.L.; Zuloaga, D.G.; Bimonte-Nelson, H.A.; Handa, R.J. Sex-Dependent Programming Effects of Prenatal Glucocorticoid Treatment on the Developing Serotonin System and Stress-Related Behaviors in Adulthood. Neuroscience 2016, 320, 43–56. [Google Scholar] [CrossRef] [Green Version]
- Traynelis, S.F.; Wollmuth, L.P.; McBain, C.J.; Menniti, F.S.; Vance, K.M.; Ogden, K.K.; Hansen, K.B.; Yuan, H.; Myers, S.J.; Dingledine, R. Glutamate Receptor Ion Channels: Structure, Regulation, and Function. Pharmacol. Rev. 2010, 62, 405–496. [Google Scholar] [CrossRef] [Green Version]
- Diering, G.H.; Huganir, R.L. The AMPA Receptor Code of Synaptic Plasticity. Neuron 2018, 100, 314–329. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Royo, M.; Escolano, B.A.; Madrigal, M.P.; Jurado, S. AMPA Receptor Function in Hypothalamic Synapses. Front. Synaptic Neurosci. 2022, 14, 833449. [Google Scholar] [CrossRef]
- Li, M.-X.; Zheng, H.-L.; Luo, Y.; He, J.-G.; Wang, W.; Han, J.; Zhang, L.; Wang, X.; Ni, L.; Zhou, H.-Y.; et al. Gene Deficiency and Pharmacological Inhibition of Caspase-1 Confers Resilience to Chronic Social Defeat Stress via Regulating the Stability of Surface AMPARs. Mol. Psychiatry 2018, 23, 556–568. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Busnardo, C.; Alves, F.H.F.; Crestani, C.C.; Scopinho, A.A.; Resstel, L.B.M.; Correa, F.M.A. Paraventricular Nucleus of the Hypothalamus Glutamate Neurotransmission Modulates Autonomic, Neuroendocrine and Behavioral Responses to Acute Restraint Stress in Rats. Eur. Neuropsychopharmacol. 2013, 23, 1611–1622. [Google Scholar] [CrossRef] [PubMed]
- Alt, A.; Nisenbaum, E.S.; Bleakman, D.; Witkin, J.M. A Role for AMPA Receptors in Mood Disorders. Biochem. Pharmacol. 2006, 71, 1273–1288. [Google Scholar] [CrossRef]
- Andreasen, J.T.; Fitzpatrick, C.M.; Larsen, M.; Skovgaard, L.; Nielsen, S.D.; Clausen, R.P.; Troelsen, K.; Pickering, D.S. Differential Role of AMPA Receptors in Mouse Tests of Antidepressant and Anxiolytic Action. Brain Res. 2015, 1601, 117–126. [Google Scholar] [CrossRef]
- Ellis, A.S.; Fosnocht, A.Q.; Lucerne, K.E.; Briand, L.A. Disruption of GluA2 Phosphorylation Potentiates Stress Responsivity. Behav. Brain Res. 2017, 333, 83–89. [Google Scholar] [CrossRef]
- Andreasen, J.T.; Gynther, M.; Rygaard, A.; Bøgelund, T.; Nielsen, S.D.; Clausen, R.P.; Mogensen, J.; Pickering, D.S. Does Increasing the Ratio of AMPA-to-NMDA Receptor Mediated Neurotransmission Engender Antidepressant Action? Studies in the Mouse Forced Swim and Tail Suspension Tests. Neurosci. Lett. 2013, 546, 6–10. [Google Scholar] [CrossRef] [PubMed]
- Morley-Fletcher, S.; Zuena, A.R.; Mairesse, J.; Gatta, E.; Van Camp, G.; Bouwalerh, H.; Riozzi, B.; Battaglia, G.; Pittaluga, A.; Olivero, G.; et al. The Reduction in Glutamate Release Is Predictive of Cognitive and Emotional Alterations That Are Corrected by the Positive Modulator of AMPA Receptors S 47445 in Perinatal Stressed Rats. Neuropharmacology 2018, 135, 284–296. [Google Scholar] [CrossRef] [PubMed]
- Karst, H.; Nair, S.; Velzing, E.; Rumpff-van Essen, L.; Slagter, E.; Shinnick-Gallagher, P.; Joëls, M. Glucocorticoids Alter Calcium Conductances and Calcium Channel Subunit Expression in Basolateral Amygdala Neurons. Eur. J. Neurosci. 2002, 16, 1083–1089. [Google Scholar] [CrossRef] [PubMed]
- Weisskopf, M.G.; Bauer, E.P.; LeDoux, J.E. L-Type Voltage-Gated Calcium Channels Mediate NMDA-Independent Associative Long-Term Potentiation at Thalamic Input Synapses to the Amygdala. J. Neurosci. 1999, 19, 10512–10519. [Google Scholar] [CrossRef] [PubMed]
- Bauer, E.P.; Schafe, G.E.; LeDoux, J.E. NMDA Receptors and L-Type Voltage-Gated Calcium Channels Contribute to Long-Term Potentiation and Different Components of Fear Memory Formation in the Lateral Amygdala. J. Neurosci. 2002, 22, 5239–5249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blair, H.T.; Schafe, G.E.; Bauer, E.P.; Rodrigues, S.M.; LeDoux, J.E. Synaptic Plasticity in the Lateral Amygdala: A Cellular Hypothesis of Fear Conditioning. Learn. Mem. 2001, 8, 229–242. [Google Scholar] [CrossRef] [Green Version]
- Shinnick-Gallagher, P.; McKernan, M.G.; Xie, J.; Zinebi, F. L-Type Voltage-Gated Calcium Channels Are Involved in the in Vivo and in Vitro Expression of Fear Conditioning. Ann. N. Y. Acad. Sci. 2003, 985, 135–149. [Google Scholar] [CrossRef]
- Davis, S.E.; Bauer, E.P. L-Type Voltage-Gated Calcium Channels in the Basolateral Amygdala Are Necessary for Fear Extinction. J. Neurosci. 2012, 32, 13582–13586. [Google Scholar] [CrossRef] [Green Version]
- Moon, A.L.; Haan, N.; Wilkinson, L.S.; Thomas, K.L.; Hall, J. CACNA1C: Association With Psychiatric Disorders, Behavior, and Neurogenesis. Schizophr. Bull. 2018, 44, 958–965. [Google Scholar] [CrossRef]
- Kanai, Y.; Clémençon, B.; Simonin, A.; Leuenberger, M.; Lochner, M.; Weisstanner, M.; Hediger, M.A. The SLC1 High-Affinity Glutamate and Neutral Amino Acid Transporter Family. Mol. Aspects Med. 2013, 34, 108–120. [Google Scholar] [CrossRef]
- Hodel, A. SNAP-25. Int. J. Biochem. Cell Biol. 1998, 30, 1069–1073. [Google Scholar] [CrossRef]
- Prescott, G.R.; Chamberlain, L.H. Regional and Developmental Brain Expression Patterns of SNAP25 Splice Variants. BMC Neurosci. 2011, 12, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghezzo, A.; Guerini, F.R.; Bolognesi, E.; Matteoli, M.; Manca, S.; Sotgiu, S.; Bejor, M.; Clerici, M.; Chiappedi, M. Neuropsycological Gender Differences in Healthy Individuals and in Pediatric Neurodevelopmental Disorders. A Role for SNAP-25. Med. Hypotheses 2009, 73, 978–980. [Google Scholar] [CrossRef] [PubMed]
Gene | Sex | Fold Change Amygdala | Fold Change PVN |
---|---|---|---|
(2ΔΔCT ± SE) | (2ΔΔCT ± SE) | ||
Glucocorticoid Receptor | |||
NR3C1 | Male | 1.38 (1.02, 1.86) | 0.60 (0.37, 0.95) |
Female | 1.21 (0.81. 1.79) | 0.24 (0.14, 0.40) | |
Glutamate Signalling | |||
GRIA2 | Male | 1.20 (0.91, 1.58) | 2.43 (1.49, 3.94) |
Female | 0.88 (0.76, 1.02) | 2.00 (1.28, 3.12) | |
SLC1A2 | Male | 0.57 (0.41, 0.80) | 1.46 (0.87, 2.36) |
Female | 1.05 (0.87, 1.28) | 0.47 (0.33, 0.68) | |
Calcium Signalling | |||
Ryr2 | Male | 0.65 (0.35, 1.22) | NA |
Female | 0.92 (0.72, 1.16) | ||
PLCH2 | Male | 0.97 (0.81, 1.17) | 1.72 (1.07, 2.77) |
Female | 1.45 (1.23, 1.71) | 0.98 (0.57, 1.66) | |
CACNB2 | Male | 0.27 (0.15, 0.48) | 1.85 (1.06, 3.21) |
Female | 0.92 (0.59, 1.44) | 0.76 (0.50, 1.14) | |
CACNA1B | Male | 1.24 (1.06, 1.46) | 0.91 (0.56, 1.51) |
Female | 1.22 (0.94, 1.58) | 1.19 (0.90, 1.58) | |
CACNA1C | Male | 0.11 (0.07, 0.20) | 1.41 (0.87, 2.29) |
Female | 0.34 (0.21, 0.55) | 1.82 (1.37, 2.24) | |
CAM2KA | Male | 1.14 (0.74, 1.74) | 0.89 (0.64, 1.25) |
Female | 0.83 (0.68, 1.03) | 1.36 (1.16, 1.59) | |
Neural Transmission | |||
SNAP25 | Male | 0.63 (0.47, 0.83) | 1.28 (0.95, 1.74) |
Female | 0.96 (0.74, 1.24) | 0.94 (0.85, 1.04) | |
Synaptophysin | Male | 1.04 (0.85, 1.27) | 0.91 (0.65, 1.28) |
Female | 1.10 (0.97, 1.24) | 1.06 (0.52, 2.17) | |
Growth and Differentiation of Neurons | |||
LSAMP | Male | 0.68 (0.56, 0.84) | NA |
Female | 1.19 (0.98, 1.45) | ||
NTM | Male | 0.81 (0.71, 0.93) | NA |
Female | 0.97 (0.91, 1.05) | ||
Lysosomal Homeostasis | |||
MBTPS1 | Male | 0.59 (0.38, 0.91) | NA |
Female | 1.25 (1.03, 1.51) | ||
Prion Protein | |||
PRNP1 | Male | 1.23 (1.00, 1.51) | 1.07 (0.85, 1.22) |
Female | 1.04 (0.95, 1.14) | 1.21 (0.89, 1.64) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rivet, T.R.; Lalonde, C.; Tai, T.C. Gene Dysregulation in the Adult Rat Paraventricular Nucleus and Amygdala by Prenatal Exposure to Dexamethasone. Life 2022, 12, 1077. https://doi.org/10.3390/life12071077
Rivet TR, Lalonde C, Tai TC. Gene Dysregulation in the Adult Rat Paraventricular Nucleus and Amygdala by Prenatal Exposure to Dexamethasone. Life. 2022; 12(7):1077. https://doi.org/10.3390/life12071077
Chicago/Turabian StyleRivet, Tyler R., Christine Lalonde, and T. C. Tai. 2022. "Gene Dysregulation in the Adult Rat Paraventricular Nucleus and Amygdala by Prenatal Exposure to Dexamethasone" Life 12, no. 7: 1077. https://doi.org/10.3390/life12071077