Resistance to Some New Drugs and Prevalence of ESBL- and MBL-Producing Enterobacteriaceae Uropathogens Isolated from Diabetic Patients
Abstract
:1. Introduction
2. Materials and Methods
2.1. Retrieval of Data, Bacterial Isolates, and Identification
2.2. Antimicrobial Susceptibility Testing
2.3. Phenotypic Characterization of ESBLs
2.4. Phenotypic Characterization of Carbapenemases
2.5. Genotypic Characterization of ESBLs and Carbapenemases
2.6. Statistical Analysis
3. Results
3.1. Clinical and Other Variables
3.2. Prevalence of Major Uropathogens and Antimicrobial Susceptibility Pattern
3.3. Resistance to Colistin
3.4. Phenotypic Resistance Categories
3.5. Phenotypic and Genotypic Characterization of Resistance Markers
3.6. Co-Existence of Resistance-Encoding Genes
3.7. Resistance to Cefiderocol and Eravacycline
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mendenhall, E.; Kohrt, B.A.; Norris, S.A.; Ndetei, D.; Prabhakaran, D. Non-communicable disease syndemics: Poverty, depression, and diabetes among low-income populations. Lancet 2017, 389, 951–963. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Y.; Ley, S.H.; Hu, F.B. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat. Rev. Endocrinol. 2018, 14, 88–98. [Google Scholar] [CrossRef]
- Hicks, C.W.; Canner, J.K.; Mathioudakis, N.; Lippincott, C.; Sherman, R.L.; Abularrage, C.J. Incidence and Risk Factors Associated With Ulcer Recurrence Among Patients With Diabetic Foot Ulcers Treated in a Multidisciplinary Setting. J. Surg. Res. 2020, 246, 243–250. [Google Scholar] [CrossRef]
- Sherwani, S.I.; Khan, H.A.; Ekhzaimy, A.; Masood, A.; Sakharkar, M.K. Significance of HbA1c test in diagnosis and prognosis of diabetic patients. Biomark. Insights 2016, 11, 95–104. [Google Scholar] [CrossRef]
- Nitzan, O.; Elias, M.; Chazan, B.; Saliba, W. Urinary tract infections in patients with type 2 diabetes mellitus: Review of prevalence, diagnosis, and management. Diabetes. Metab. Syndr. Obes. Targets Ther. 2015, 8, 129–136. [Google Scholar] [CrossRef] [Green Version]
- Percival, S.L.; Suleman, L.; Vuotto, C.; Donelli, G. Healthcare-Associated infections, medical devices and biofilms: Risk, tolerance and control. J. Med. Microbiol. 2015, 64, 323–334. [Google Scholar] [CrossRef] [Green Version]
- Wyres, K.L.; Hawkey, J.; Hetland, M.A.K.; Fostervold, A.; Wick, R.R.; Judd, L.M.; Hamidian, M.; Howden, B.P.; Löhr, I.H.; Holt, K.E. Emergence and rapid global dissemination of CTX-M-15-associated Klebsiella pneumoniae strain ST307. J. Antimicrob. Chemother. 2019, 74, 577–581. [Google Scholar] [CrossRef] [Green Version]
- Yu, S.; Fu, A.Z.; Qiu, Y.; Engel, S.S.; Shankar, R.; Brodovicz, K.G.; Rajpathak, S.; Radican, L. Disease burden of urinary tract infections among type 2 diabetes mellitus patients in the U.S. J. Diabetes Complicat. 2014, 28, 621–626. [Google Scholar] [CrossRef] [Green Version]
- Okwume, C.C.; Onyemelukwe, N.F.; Abdullahi, I.N.; Okoyeocha, O.E.; Asamota, S.D. Prevalence of symptomatic urinary tract infection and bacterial spectrum of diabetic and non-diabetic patients at the two teaching hospitals in Enugu, Nigeria. Afr. J. Clin. Exp. Microbiol. 2021, 22, 480–488. [Google Scholar] [CrossRef]
- Seifu, W.D.; Gebissa, A.D. Prevalence and antibiotic susceptibility of Uropathogens from cases of urinary tract infections (UTI) in Shashemene referral hospital, Ethiopia. BMC Infect. Dis. 2018, 18, 1–9. [Google Scholar] [CrossRef]
- Albu, S.; Voidazan, S.; Bilca, D.; Badiu, M.; Truta, A.; Ciorea, M.; Ichim, A.; Luca, D.; Moldovan, G. Bacteriuria and asymptomatic infection in chronic patients with indwelling urinary catheter the incidence of ESBL bacteria. Medicine 2018, 97, e11796. [Google Scholar] [CrossRef]
- De Oliveira, D.M.P.; Forde, B.M.; Kidd, T.J.; Harris, P.N.A.; Schembri, M.A.; Beatson, S.A.; Paeterson, D.L.; Walker, M.J. Antimicrobial Resistance in ESKAPE Pathogens. Clin. Microbiol. Rev. 2020, 33, e00181-19. [Google Scholar] [CrossRef]
- Díaz Álvarez, M.; Acosta Batista, B.; Pérez Córdova, R.; Hernández Robledo, E. Urinary tract infection caused by Enterobacteriaceae and its relationship with vesicoureteral reflux. Bol. Méd. Hosp. Infant. México Engl. Ed. 2017, 74, 34–40. [Google Scholar] [CrossRef]
- Vatan, A.; Saltoglu, N.; Yemisen, M.; Balkan, I.I.; Surme, S.; Demiray, T.; Mete, B.; Tabak, F. Association between biofilm and multi/extensive drug resistance in diabetic foot infection. Int. J. Clin. Pract. 2018, 72, e13060. [Google Scholar] [CrossRef]
- De Lastours, V.; Foxman, B. Urinary tract infection in diabetes: Epidemiologic considerations topical collection on genitourinary infections. Curr. Infect. Dis. Rep. 2014, 16, 389. [Google Scholar] [CrossRef]
- Khalifa, S.M.; Abd El-Aziz, A.M.; Hassan, R.; Abdelmegeed, E.S. β-lactam resistance associated with β-lactamase production and porin alteration in clinical isolates of E. coli and K. pneumoniae. PLoS ONE 2021, 16, e0251594. [Google Scholar] [CrossRef]
- Bajpai, T.; Pandey, M.; Varma, M.; Bhatambare, G.S. Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J. Med. 2017, 7, 12–16. [Google Scholar] [CrossRef]
- Reid, R.; Al-bayati, M.; Samarasinghe, S. Genotypic Identification of Extended-Spectrum β-Lactamase (ESBL)- Producing Enterobacteriaceae from Urinary Tract Infections in the Leicestershire Area, United Kingdom: A One Health Prospective. J. Infect. Dis. Diagnosis 2018, 3, 1000122. [Google Scholar] [CrossRef]
- Zeynudin, A.; Pritsch, M.; Schubert, S.; Messerer, M.; Liegl, G.; Hoelscher, M.; Belachew, T.; Wieser, A. Prevalence and antibiotic susceptibility pattern of CTX-M type extended-spectrum β-lactamases among clinical isolates of gram-negative bacilli in Jimma, Ethiopia. BMC Infect. Dis. 2018, 18, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Uddin, F.; Imam, S.H.; Khan, S.; Khan, T.A.; Ahmed, Z.; Sohail, M.; Elnaggar, A.Y.; Fallatah, A.M.; El-Bahy, Z.M. NDM Production as a Dominant Feature in Carbapenem-Resistant Enterobacteriaceae Isolates from a Tertiary Care Hospital. Antibiotics 2022, 11, 48. [Google Scholar] [CrossRef]
- Lin, Q.; Wang, Y.; Yu, J.; Li, S.; Zhang, Y.; Wang, H.; Lai, X.; Liu, D.; Mao, L.; Luo, Y.; et al. Bacterial characteristics of carbapenem-resistant Enterobacteriaceae (CRE) colonized strains and their correlation with subsequent infection. BMC Infect. Dis. 2021, 21, 638. [Google Scholar] [CrossRef]
- Lowe, M.; Kock, M.M.; Coetzee, J.; Hoosien, E.; Peirano, G.; Strydom, K.; Ehlers, M.M.; Mbelle, N.M.; Shashkina, E.; Haslam, D.B.; et al. Klebsiella pneumoniae ST307 with blaOXA-181, South Africa, 2014–2016. Emerg. Infect. Dis. 2019, 25, 739–747. [Google Scholar] [CrossRef] [Green Version]
- Johnston, B.D.; Thuras, P.; Porter, S.B.; Anacker, M.; VonBank, B.; Snippes, V.P.; Witwer, M.; Castanheira, M.; Johnson, J.R. Activity of Cefiderocol, Ceftazidime-Avibactam, and Eravacycline against Carbapenem-Resistant Escherichia coli Isolates from the United States and International Sites in Relation to Clonal Background, Resistance Genes, Coresistance, and Region. Antimicrob. Agents Chemother. 2020, 64, e00797-20. [Google Scholar] [CrossRef]
- Grimm, V.; Ezaki, S.; Susa, M.; Knabbe, C.; Schmid, R.D.; Bachmann, T.T. Use of DNA microarrays for rapid genotyping of TEM beta-lactamases that confer resistance. J. Clin. Microbiol. 2004, 42, 3766–3774. [Google Scholar] [CrossRef] [Green Version]
- Gröbner, S.; Linke, D.; Schütz, W.; Fladerer, C.; Madlung, J.; Autenrieth, I.B.; Witte, W.; Pfeifer, Y. Emergence of carbapenem-non-susceptible extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolates at the university hospital of Tübingen, Germany. J. Med. Microbiol. 2009, 58, 912–922. [Google Scholar] [CrossRef] [Green Version]
- Ryoo, N.H.; Kim, E.C.; Hong, S.G.; Park, Y.J.; Lee, K.; Bae, I.K.; Song, E.H.; Jeong, S.H. Dissemination of SHV-12 and CTX-M-type extended-spectrum β-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. J. Antimicrob. Chemother. 2005, 56, 698–702. [Google Scholar] [CrossRef] [Green Version]
- Paterson, D.L.; Hujer, K.M.; Hujer, A.M.; Yeiser, B.; Bonomo, M.D.; Rice, L.B.; Bonomo, R.A.; International Klebsiella Study Group. Extended-spectrum b-lactamases in Klebsiella pneumoniae bloodstream isolates from seven countries: Dominance and widespread prevalence of SHV- and CTX-M-type b-lactamases. Antimicrob. Agents Chemother. 2003, 47, 3554–3560. [Google Scholar] [CrossRef] [Green Version]
- Kaase, M.; Nordmann, P.; Wichelhaus, T.A.; Gatermann, S.G.; Bonnin, R.A.; Poirel, L. NDM-2 carbapenemase in Acinetobacter baumannii from Egypt. J. Antimicrob. Chemother. 2011, 66, 1260–1262. [Google Scholar] [CrossRef] [Green Version]
- Wolter, D.J.; Khalaf, N.; Robledo, I.E.; Vázquez, G.J.; Santé, M.I.; Aquino, E.E.; Goering, R.V.; Hanson, N.D. Surveillance of carbapenem-resistant Pseudomonas aeruginosa isolates from Puerto Rican Medical Center Hospitals: Dissemination of KPC and IMP-18 β-lactamases. Antimicrob. Agents Chemother. 2009, 53, 1660–1664. [Google Scholar] [CrossRef] [Green Version]
- Kaiafa, G.; Veneti, S.; Polychronopoulos, G.; Pilalas, D.; Daios, S.; Kanellos, I.; Didangelos, T.; Pagoni, S.; Savopoulos, C. Is HbA1c an ideal biomarker of well-controlled diabetes? Postgrad. Med. J. 2021, 97, 380–383. [Google Scholar] [CrossRef]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbath, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Lijequist, B.; et al. Monnet, Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
- Ozawa, K.; Takai, M.; Taniguchi, T.; Kawase, M.; Takeuchi, S.; Kawase, K. Diabetes Mellitus as a Predictive Factor for Urinary Tract Infection for Patients Treated with Kidney Transplantation. Medicina 2022, 58, 1488. [Google Scholar] [CrossRef]
- Stapleton, A. Urinary tract infections in patients with diabetes. Am. J. Med. 2002, 113, 80–84. [Google Scholar] [CrossRef]
- Giesen, L.G.; Cousins, G.; Dimitrov, B.D.; Van De Laar, F.A.; Fahey, T. Predicting acute uncomplicated urinary tract infection in women: A systematic review of the diagnostic accuracy of symptoms and signs. BMC Fam. Pract. 2010, 11, 78. [Google Scholar] [CrossRef] [Green Version]
- Magill, S.S.; O’Leary, E.; Janelle, S.J.; Thompson, D.L.; Dumyati, G.; Nadle, J.; Wilson, L.E.; Kainer, M.A.; Lynfield, R.; Greissman, S.; et al. Changes in Prevalence of Health Care–Associated Infections in U.S. Hospitals. N. Engl. J. Med. 2018, 379, 1732–1744. [Google Scholar] [CrossRef]
- Salari, N.; Karami, M.M.; Bokaee, S.; Chaleshgar, M.; Shohaimi, S.; Akbari, H.; Mohammadi, M. The prevalence of urinary tract infections in type 2 diabetic patients: A systematic review and meta-analysis. Eur. J. Med. Res. 2022, 27, 1–13. [Google Scholar] [CrossRef]
- Jayakaran, J.; Soundararajan, N.; Shanmugam, P. Phenotypic and genotypic characterization of multidrug-resistant isolates from patients with catheter-associated urinary tract infection in a tertiary care hospital. J. Lab. Physicians 2019, 11, 206–211. [Google Scholar] [CrossRef]
- Bilal, H.; Khan, M.N.; Rehman, T.; Hameed, M.F.; Yang, X. Antibiotic resistance in Pakistan: A systematic review of past decade. BMC Infect. Dis. 2021, 21, 244. [Google Scholar] [CrossRef]
- Abbas, S.; Sabir, A.U.; Khalid, N.; Sabir, S.; Khalid, S.; Haseeb, S.; Khan, N.M.; Ajmal, W.M.; Azhar, F.; Saeed, M.T. Frequency of Extensively Drug-Resistant Gram-Negative Pathogens in a Tertiary Care Hospital in Pakistan. Cureus 2020, 12, e11914. [Google Scholar] [CrossRef]
- Masseron, A.; Poirel, L.; Ali, B.J.; Syed, M.A.; Nordmann, P. Molecular characterization of multidrug-resistance in Gram-negative bacteria from the Peshawar teaching hospital, Pakistan. New Microbes New Infect. 2019, 32, 100605. [Google Scholar] [CrossRef]
- Abrar, S.; Hussain, S.; Khan, R.A.; Ain, N.U.; Haider, H.; Riaz, S. Prevalence of extended-spectrum-β-lactamase-producing Enterobacteriaceae: First systematic meta-analysis report from Pakistan. Antimicrob. Resist. Infect. Control 2018, 7, 26. [Google Scholar] [CrossRef] [Green Version]
- Uddin, F.; McHugh, T.D.; Roulston, K.; Platt, G.; Khan, T.A.; Sohail, M. Detection of carbapenemases, AmpC and ESBL genes in Acinetobacter isolates from ICUs by DNA microarray. J. Microbiol. Methods 2018, 155, 19–23. [Google Scholar] [CrossRef] [PubMed]
- Ghenea, A.E.; Zlatian, O.M.; Cristea, O.M.; Ungureanu, A.; Mititelu, R.R.; Balasoiu, A.T.; Vasile, C.M.; Salan, A.I.; Iliuta, D.; Popescu, M. TEM,CTX-M,SHV Genes in ESBL-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Clinical Samples in a County Clinical Emergency Hospital Romania-Predominance of CTX-M-15. Antibiotics 2022, 11, 503. [Google Scholar] [CrossRef]
- Ahad, A.; Salman, M.; Ikram, A.; Ashraf, Z.; Amir, A.; Saeed, A.; Ahmad, A. Prevalence and molecular Characterization of ESBL-producing Escherichia coli in waste water samples from Pakistan. Int. J. Infect. Dis. 2020, 101, 33. [Google Scholar] [CrossRef]
- Nasir, F.; Khan, M.I.; Kashif, S.; Uddin, F.; Naseer, A.; Masood, S. Prevalence of ESBLs secreting and carbapenem-resistant E. coli from urinary tract infection. Rawal Med. J. 2021, 46, 518–521. [Google Scholar]
- Nordmann, P.; Poirel, L. Epidemiology and Diagnostics of Carbapenem Resistance in Gram-negative Bacteria. Clin. Infect. Dis. 2019, 69, 521–528. [Google Scholar] [CrossRef] [Green Version]
- Mohsin, M.; Brekhna, H.; Khan, A.U.; Ali, A.; Swedberg, G.; Hasan, B. Genomic characterization of high-risk Escherichia coli and Enterobacter hormaechei clones recovered from a single care hospital in Pakistan. J. Appl. Microbiol. 2022, 132, 3907–3914. [Google Scholar] [CrossRef]
- Habib, A.; Lo, S.; Villageois-Tran, K.; Petitjean, M.; Malik, S.A.; Armand-Lefèvre, L. Dissemination of carbapenemase-producing Enterobacterales in the community of Rawalpindi, Pakistan. PLoS ONE 2022, 17, e0270707. [Google Scholar] [CrossRef]
- Morrissey, I.; Olesky, M.; Hawser, S.; Lob, S.H.; Karlowsky, J.A.; Corey, G.R.; Bassetti, M. In Vitro Activity of Eravacycline against Gram-Negative Bacilli Isolated in Clinical Laboratories Worldwide from 2013 to 2017. Antimicrob. Agents Chemother. 2017, 64, 01715–01719. [Google Scholar] [CrossRef] [Green Version]
- Zhanel, G.G.; Cheung, D.; Adam, H.; Zelenitsky, S.; Golden, A.; Schweizer, F.; Gorityala, B.; Lagacé-Wiens, P.R.S.; Walkty, A.; Gin, A.S.; et al. Review of Eravacycline, a Novel Fluorocycline Antibacterial Agent. Drugs 2016, 76, 567–588. [Google Scholar] [CrossRef]
- Wang, Q.; Jin, L.; Sun, S.; Yin, Y.; Wang, R.; Chen, F.; Wang, X.; Zhang, Y.; Hou, J. Occurrence of High Levels of Ce fi derocol Resistance in Carbapenem-Resistant Escherichia coli before Its Approval in China: A Report from China CRE-Network. Microbiol. Spectr. 2022, 10, e02670-21. [Google Scholar] [CrossRef] [PubMed]
- Ji, C.; Juárez-Hernández, R.E.; Miller, M.J. Exploiting bacterial iron acquisition: Siderophore conjugates. Future Med. Chem. 2012, 4, 297–313. [Google Scholar] [CrossRef] [PubMed]
- Kohira, N.; Hackel, M.A.; Ishioka, Y.; Kuroiwa, M.; Sahm, D.F.; Sato, T.; Maki, H.; Yamano, Y. Reduced susceptibility mechanism to cefiderocol, a siderophore cephalosporin, among clinical isolates from a global surveillance programme (SIDERO-WT-2014). J. Glob. Antimicrob. Resist. 2020, 22, 738–741. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence | Annealing Temperature °C | Product Size bp | Reference |
---|---|---|---|---|
TEM | F-ATGAGTATTCAACATTTCCG R-TTAATCAGTGAGGCACCTAT | 51 | 851 | Grimm et al., 2004 [24] |
SHV | F-GCAAAACGCCGGGTTATTC R-GGTTAGCGTTGCCAGTGCT | 57.4 | 940 | Gröbner at el., 2009 [25] |
PER | F-GCTCCGATAATGAAAGCGT R-TTCGGCTTGACTCGGCTGA | 53 | 520 | Uddin et al., 2022 [20] |
GES | F-GTT AGA CGG GCG TAC AAA GAT AAT R-TGT CCG TGC TCA GGA TGA GT | 55 | 903 | Ryoo et al., 2005 [26] |
CTX-M | F-CGCTTTGCGATGTGCAG R-ACCGCGATATCGTTGGT | 55.7 | 551 | Paterson et al., 2003 [27] |
NDM | F-CACCTCATGTTTGAATTCGCC R-CTCTGT CACATCGAAATCGC | 60 | 984 bp | Kaase et al., 2011 [28] |
KPC | F-CAGCTCATTCAAGGGCTTTC R-AGTCATTTGCCGTGCCATAC | 56 | 533 | Gröbner at el., 2009 [25] |
VIM | F-GGTGTTTGGTCGCATATCGC CCATTCAGCCAGATCGGCATC | 65 | 503 bp | Wolter et al., 2009 [29] |
IMP | F-GGAATAGAGTGGCTTAATTC R-CAACCAGTTTTG CCTTACC | 53 | 327 bp | Wolter et al., 2009 [29] |
Name of Variable | Occurrence |
---|---|
Type of DM | |
Type 1 | 264 (29.02%) |
Type 2 | 646 (70.98%) |
Gender | |
Male | 209 (22.96%) |
Age (years) | |
1–20 | 1 (0.47%) |
20–40 | 32 (15.31%) |
40–60 | 107 (51.19%) |
60–80 | 61 (29.18%) |
>80 | 8 (3.82%) |
Female | 701 (77.03%) |
Age (years) | |
1–20 | 3 (0.42%) |
20–40 | 49 (6.99%) |
40–60 | 237 (33.81%) |
60–80 | 355 (50.64%) |
>80 | 57 (8.13%) |
Blood glucose level | |
Fasting Blood Sugar * | |
≥120 | 115 (12.63%) |
<120 | 795 (87.36%) |
HbA1c | |
<6.5%) | 293 (32.2%) |
>6.5% | 617 (67.8%) |
Duration of DM | |
<1 year | 72 (7.91%) |
1–10 years | 420 (46.15%) |
>10 years | 418 (45.94%) |
Pathogen | Prevalence |
---|---|
Escherichia coli | 536 (58.90%) |
Klebsiella pneumoniae | 337 (37.03%) |
Enterobacter cloacae | 19 (2.08%) |
Proteus mirabilis | 18 (1.97%) |
Antibiotics | E. coli (n = 536) | K. pneumoniae (n = 337) | Enterobacter cloacae (n = 19) | P. mirabilis (n = 18) | Total (n = 910) |
---|---|---|---|---|---|
AMC | 458 (85.44%) | 208 (61.72%) | 18 (94.73%) | 16 (88.89%) | 700 (76.91%) |
ATM | 382 (71.26%) | 203 (60.23%) | 16 (84.21%) | 15 (83.33%) | 616 (67.69%) |
SXT | 324 (60.44%) | 241 (71.51%) | 11 (57.89%) | 12 (66.67%) | 588 (64.61%) |
FEP | 402 (75.00%) | 210 (62.31%) | 13 (68.82%) | 11 (61.11%) | 636 (69.89%) |
FOX | 301 (56.16%) | 177 (52.52%) | 19 (100%) | 10 (55.55%) | 507 (55.71%) |
CAZ | 404 (75.37%) | 209 (62.01%) | 13 (68.82%) | 12 (66.67%) | 638 (70.10%) |
TE | 415 (77.42%) | 283 (83.97%) | 16 (84.21%) | 18 (100%) | 732 (80.43%) |
LEV | 406 (75.74%) | 239 (70.91%) | 16 (84.21%) | 14 (77.78%) | 675 (74.17%) |
GN | 301 (56.16%) | 216 (64.09%) | 17 (89.47%) | 14 (77.78%) | 548 (60.21%) |
F | 321 (59.88%) | 183 (54.30%) | 15 (78.94%) | 18 (100%) | 537 (59.01%) |
TZP | 441 (82.27%) | 204 (60.53%) | 15 (78.94%) | 14 (77.78%) | 674 (74,06%) |
NOR | 410 (76.49%) | 255 (75.66%) | 14 (73.68%) | 11 (61.11%) | 690 (75.82%) |
CIP | 410 (76.49%) | 255 (75.66%) | 11 (57.89%) | 12 (66.67%) | 688 (75.60%) |
MER | 138 (25.74%) | 91 (27.01%) | 04 (21.05%) | 05 (27.78%) | 238 (26.15%) |
IMP | 142 (26.49%) | 88 (26.11%) | 06 (31.57%) | 05 (27.78%) | 241 (26.45%) |
AMP | 465 (86.75%) | 263 (78.04%) | 19 (100%) | 16 (88.89%) | 763 (83.84%) |
CFZ | 462 (86.19%) | 260 (77.15%) | 19 (100%) | 15 (83.33%) | 756 (83.07%) |
FOS | 181 (33.76%) | 111 (32.93%) | 05 (26.31%) | 06 (33.33%) | 303 (33.29%) |
AK | 176 (32.83%) | 177 (52.52%) | 13 (68.82%) | 10 (55.55%) | 376 (41.31) |
CRO | 406 (75.74%) | 230 (68.24%) | 19 (100%) | 15 (83.33%) | 670 (73.62%) |
ERT | 142 (26.49%) | 88 (26.11%) | 06 (31.57%) | 08 (44.44%) | 244 (26.81%) |
DOR | 142 (26.49%) | 88 (26.11%) | 07 (36.84%) | 10 (55.55%) | 247 (27.14%) |
Bacterial Isolate | Intermediate (≤2 µg/ mL) | Resistant (≥4 µg/mL) | Total n (%) |
---|---|---|---|
E. coli (n = 536) | 489 (91.24%) | 47 (8.76%) | 536(100) |
K. pneumoniae (n = 337) | 302 (89.62%) | 35 (10.38%) | 337(100) |
Enterobacter cloacae (n = 19) | 18 (94.74%) | 1 (5.26%) | 19(100) |
P. mirabilis (n = 18) | 00 | 18 (100%) | 18(100) |
Total (n = 910) | 809 (88.90%) | 101 (11.10%) | 910(100) |
Isolates | Phenotypic Detection | Manual PCR (n = 495) (%) | Microarray Assay (n = 495) | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
TEM | PER | GES | CTX-M | Unrecognized | TEM | PER | GES | CTX-M | Unrecognized | ||
E. coli | 312 (58.2) | 83 (26.6) | 134 (42.9) | 34 (10.8) | 39 (12.5) | 22(7.0) | 85 (27.2) | 139 (44.5) | 36 (11.5) | 41 (13.14) | 11 (3.52) |
K. pneumoniae | 165 (48.9) | 55 (33.3) | 79 (47.8) | 5 (3.0) | 13 (7.8) | 13(7.8) | 59 (35.7) | 81 (49) | 6 (3.6) | 14 (8.48) | 05 (3.0) |
Enterobacter cloacae | 08 (42.1) | 02 (25) | 02 (25) | 00 | 3 (37.5) | 1 (12.5) | 02 (25) | 02 (25) | 0 | 04 (50) | Nil |
P. mirabilis | 10 (55.5) | 02 (20) | 02 (20) | 02 (20) | 02 (20) | Nil | 04 (40) | 02 (20) | 02 (20) | 02 (20) | Nil |
Total n (%) | 495 (54.3) | 134 (27) | 207 (41.8) | 36 (7.2) | 53 (10.7) | 36(7.2) | 150 (30.3) | 224 (45.2) | 44 (8.8) | 61 (12.32) | 16 (3.23) |
Isolates | Phenotypic Methods | Total (%) | Manual PCR | Microarray Assay | ||||
---|---|---|---|---|---|---|---|---|
blaNDM | blaKPC | Unrecognized | blaNDM | blaKPC | Unrecognized | |||
E. coli (n = 142) | MBL | 107 (75.35%) | 109 (76.7%) | 24 (16.90%) | 9 (6.33%) | 111 (78.16%) | 24 (16.90%) | 7 (4.92%) |
KPC | 21 (14.78%) | |||||||
Unrecognized | 14 (8.85%) | |||||||
K. pneumoniae (n = 91) | MBL | 61 (67.03%) | 64 (70.3%) | 27 (29.67%) | 00 | 64 (70.3%) | 27 (29.67%) | 0 |
KPC | 27 (29.67%) | |||||||
Unrecognized | 3 (3.29%) | |||||||
E. cloacae (n = 7) | MBL | 5 (71.42%) | 5 (71.42%) | 2 (28.58%) | 00 | 5 (71.42%) | 2 (28.58%) | 0 |
KPC | 2 (28.58%) | |||||||
Unrecognized | - | |||||||
P. mirabilis (n = 10) | MBL | 5 (50.0%) | 5 (50.0%) | 5 (50%) | 2 (20%) | 5 (50%) | 5 (50%) | 0 |
KPC | 3 (30.0%) | |||||||
Unrecognized | 2 (20%) | |||||||
Total (n = 250) | MBL | 178 (71.2%) | 183 (73.2%) | 55 (22%) | 11 (4.4%) | 188 (75.2%) | 55 (22%) | 7 (2.8%) |
KPC | 53 (21.2%) | |||||||
Unrecognized | 19 (7.6%) |
Isolate | Resistant to | |
---|---|---|
FDC | ERV | |
E. coli (n = 142) | 10 (7.04) | 19 (13.38) |
K. pneumoniae (n = 91) | 7 (7.69) | 9 (9.89) |
Enterobacter cloacae (n = 7) | 2 (28.57) | 1 (14.28) |
P. mirabilis (n = 10) | 1 (10.0) | 10 (100) |
Total (n = 250) | 20 (8.0) | 39 (15.6) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alzahrani, O.M.; Uddin, F.; Mahmoud, S.F.; Alswat, A.S.; Sohail, M.; Youssef, M. Resistance to Some New Drugs and Prevalence of ESBL- and MBL-Producing Enterobacteriaceae Uropathogens Isolated from Diabetic Patients. Life 2022, 12, 2125. https://doi.org/10.3390/life12122125
Alzahrani OM, Uddin F, Mahmoud SF, Alswat AS, Sohail M, Youssef M. Resistance to Some New Drugs and Prevalence of ESBL- and MBL-Producing Enterobacteriaceae Uropathogens Isolated from Diabetic Patients. Life. 2022; 12(12):2125. https://doi.org/10.3390/life12122125
Chicago/Turabian StyleAlzahrani, Othman M., Fakhur Uddin, Samy F. Mahmoud, Amal S. Alswat, Muhammad Sohail, and Mona Youssef. 2022. "Resistance to Some New Drugs and Prevalence of ESBL- and MBL-Producing Enterobacteriaceae Uropathogens Isolated from Diabetic Patients" Life 12, no. 12: 2125. https://doi.org/10.3390/life12122125
APA StyleAlzahrani, O. M., Uddin, F., Mahmoud, S. F., Alswat, A. S., Sohail, M., & Youssef, M. (2022). Resistance to Some New Drugs and Prevalence of ESBL- and MBL-Producing Enterobacteriaceae Uropathogens Isolated from Diabetic Patients. Life, 12(12), 2125. https://doi.org/10.3390/life12122125