Molecular Characterization and Virus-Induced Gene Silencing of a Collagen Gene, Me-col-1, in Root-Knot Nematode Meloidogyne enterolobii
Abstract
:1. Introduction
2. Materials and Methods
2.1. Nematodes and Plants
2.2. Cloning of Me-col-1 cDNA Sequence
2.3. Bioinformatic Analysis of Me-col-1 Sequence
2.4. Developmental Expression Analysis
2.5. Heterologous Expression of Protein Me-col-1
2.6. dsRNA Preparation and In Vitro RNAi of Me-col-1
2.7. In Planta RNAi
2.8. Statistical Analysis
3. Results
3.1. Sequence Characterization and Analysis of Me-col-1 Gene
3.2. Prokaryotic Expression of Me-col-1 Protein
3.3. Temporal Expression Assays
3.4. Me-col-1 In Vitro RNAi
3.5. Me-col-1 In Vivo RNAi
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rutter, W.B.; Skantar, A.M.; Handoo, Z.A.; Mueller, J.D.; Aultman, S.P.; Agudelo, P. Meloidogyne enterolobii Found Infecting Root-Knot Nematode Resistant Sweetpotato in South Carolina, United States. Plant Dis. 2019, 103, 775. [Google Scholar] [CrossRef]
- Collett, R.; Marais, M.; Daneel, M.; Rashidifard, M.; Fourie, H. Meloidogyne enterolobii, a threat to crop production with particular reference to sub-Saharan Africa: An extensive, critical and updated review. Nematology 2021, 1–39. [Google Scholar] [CrossRef]
- Santos, D.; Abrantes, I.; Maleita, C. The quarantine root-knot nematode Meloidogyne enterolobii—A potential threat to Portugal and Europe. Plant Pathol. 2019, 68, 1607–1615. [Google Scholar] [CrossRef]
- Kiewnick, S.; Dessimoz, M.; Franck, L. Effects of the Mi-1 and the N root-knot nematode-resistance gene on infection and reproduction of Meloidogyne enterolobii on tomato and pepper cultivars. J. Nematol. 2009, 41, 134–139. [Google Scholar] [PubMed]
- Yang, B.; Eisenback, J.D. Meloidogyne enterolobii n. sp. (Meloidogynidae), a Root-knot Nematode Parasitizing Pacara Earpod Tree in China. J. Nematol. 1983, 15, 381–391. [Google Scholar]
- Liu, C.; Grabau, Z.J.; Desaeger, J. Guava root-knot nematode Meloidogyne enterolobii: EENY-793/IN1372, 9/2022. EDIS 2022, 2022. [Google Scholar] [CrossRef]
- Shao, H.; Zhang, P.; You, C.; Li, C.; Feng, Y.; Xie, Z. Genetic Diversity of the root-knot nematode Meloidogyne enterolobiiin Mulberry Based on the Mitochondrial COI Gene. Ecol. Evol. 2020, 10, 5391–5401. [Google Scholar] [CrossRef]
- Ren, Z.; Chen, X.; Luan, M.; Guo, B.; Song, Z. First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China. Plant Dis. 2020, 105, 230. [Google Scholar] [CrossRef]
- Long, H.; Sun, Y.; Bai, C.; Guo, J.; Zeng, F. Identification of the Root Knot Nematode Meloidogyne enterolobii in Hainan Province. Chin. J. Trop. Crops 2015, 36, 371–376. (In Chinese) [Google Scholar]
- Long, H.; Chen, Y.; Pei, Y.; Li, H.; Sun, Y.; Feng, T. Occurrence and Identification of Root-Knot Nematodes on Red Dragon Fruit (Hylocereus polyrhizus) in Hainan, China. Agronomy 2022, 12, 1064. [Google Scholar] [CrossRef]
- Kingston, I.B. Nematode collagen genes. Parasitol. Today 1991, 7, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.N.; Sulston, J.E. Some Observations on Moulting in Caenorhabditis Elegans. Nematologica 1978, 24, 63–71. [Google Scholar] [CrossRef]
- Johnstone, I.L. Cuticle collagen genes. Expression in Caenorhabditis elegans. Trends Genet. 2000, 16, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Kramer, J.M. Structures and functions of collagens in Caenorhabditis elegans. FASEB J. 1994, 8, 329–336. [Google Scholar] [CrossRef] [PubMed]
- Kramer, J.M.; Johnson, J.J.; Edgar, R.S.; Basch, C.; Roberts, S. The sqt-1 gene of C. elegans encodes a collagen critical for organismal morphogenesis. Cell 1988, 55, 555–565. [Google Scholar] [CrossRef]
- Levy, A.D.; Yang, J.; Kramer, J.M. Molecular and genetic analyses of the Caenorhabditis elegans dpy-2 and dpy-10 collagen genes: A variety of molecular alterations affect organismal morphology. Mol. Biol. Cell 1993, 4, 803–817. [Google Scholar] [CrossRef] [Green Version]
- Thacker, C.; Sheps, J.A.; Rose, A.M. Caenorhabditis elegans dpy-5 is a cuticle procollagen processed by a proprotein convertase. Cell Mol. Life Sci. 2006, 63, 1193–1204. [Google Scholar] [CrossRef]
- Van der Eycken, W.; de Almeida Engler, J.; Van Montagu, M.; Gheysen, G. Identification and Analysis of a Cuticular Collagen-Encoding Gene from the Plant-Parasitic Nematode Meloidogyne incognita. Gene 1994, 151, 237–242. [Google Scholar] [CrossRef]
- Gray, L.J.; Curtis, R.H.; Jones, J.T. Characterisation of a collagen gene subfamily from the potato cyst nematode Globodera pallida. Gene 2001, 263, 67–75. [Google Scholar] [CrossRef]
- Liu, J.; Hinanit, K.; Nor, C.; Yitzhak, S. Isolation of a Novel Collagen Gene (Mj-Col-5) in Meloidogyne javanica and Analysis of Its Expression Pattern. J. Parasitol. 2001, 87, 801–807. [Google Scholar] [CrossRef]
- Banerjee, S.; Gill, S.S.; Jain, P.K.; Sirohi, A. Isolation, cloning, and characterization of a cuticle collagen gene, Mi-col-5, in Meloidogyne incognita. 3 Biotech 2017, 7, 64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lacomme, C.; Hrubikova, K.; Hein, I. Enhancement of virus-induced gene silencing through viral-based production of inverted-repeats. Plant J. 2003, 34, 543–553. [Google Scholar] [CrossRef] [PubMed]
- Purkayastha, A.; Mathur, S.; Verma, V.; Sharma, S.; Dasgupta, I. Virus-induced gene silencing in rice using a vector derived from a DNA virus. Planta 2010, 232, 1531–1540. [Google Scholar] [CrossRef]
- Vaistij, F.E.; Jones, L. Compromised Virus-Induced Gene Silencing in RDR6-Deficient Plants. Plant Physiol. 2009, 149, 1399–1407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gould, B.; Kramer, E.M. Virus-induced gene silencing as a tool for functional analyses in the emerging model plant Aquilegia (columbine, Ranunculaceae). Plant Methods 2007, 3, 6. [Google Scholar] [CrossRef] [Green Version]
- Valentine, T.A.; Randall, E.; Wypijewski, K.; Chapman, S.; Jones, J.; Oparka, K.J. Delivery of macromolecules to plant parasitic nematodes using a tobacco rattle virus vector. Plant Biotechnol. J. 2007, 5, 827–834. [Google Scholar] [CrossRef]
- Kumagai, M.H.; Donson, J.; Della-Cioppa, G.; Harvey, D.; Hanley, K.; Grill, L.K. Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proc. Natl. Acad. Sci. USA 1995, 92, 1679–1683. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Mei, M.; Mao, Z.; Lv, S.; Zhou, J.; Chen, S.; Xie, B. Molecular cloning and virus-induced gene silencing of MiASB in the southern root-knot nematode, Meloidogyne incognita. Eur. J. Plant Pathol. 2014, 138, 181–193. [Google Scholar] [CrossRef]
- Chi, Y.; Wang, X.; Le, X.; Ju, Y.; Guan, T.; Li, H. Exposure to double-stranded RNA mediated by tobacco rattle virus leads to transcription up-regulation of effector gene Mi-Vap-2 from Meloidogyne incognita and promotion of pathogenicity in progeny. Int. J. Parasitol. 2016, 46, 105–113. [Google Scholar] [CrossRef]
- Huang, G.; Dong, R.; Allen, R.; Davis, E.L.; Baum, T.J.; Hussey, R.S. Two chorismate mutase genes from the root-knot nematode Meloidogyne incognita. Mol. Plant Pathol. 2005, 6, 23–30. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Urwin, P.E.; Lilley, C.J.; Atkinson, H.J. Ingestion of Double-Stranded RNA by Preparasitic Juvenile Cyst Nematodes Leads to RNA Interference. Mol. Plant Microbe Interact 2002, 15, 747–752. [Google Scholar] [CrossRef] [PubMed]
- Davies, K.G.; Curtis, R.H.C. Cuticle Surface Coat of Plant-Parasitic Nematodes. Annu. Rev. Phytopathol. 2011, 49, 135–156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stepek, G.; McCormack, G.; Page, A.P. Collagen processing and cuticle formation is catalysed by the astacin metalloprotease DPY-31 in free-living and parasitic nematodes. Int. J. Parasitol. 2010, 40, 533–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cox, G.N. Molecular and Biochemical Aspects of Nematode Collagens. J Parasitol. 1992, 78, 1–15. [Google Scholar] [CrossRef]
- Gupta, M.C.; Graham, P.L.; Kramer, J.M. Characterization of Alpha1(IV) Collagen Mutations in Caenorhabditis Elegans and the Effects of Alpha1 and Alpha2(IV) Mutations on Type IV Collagen Distribution. J. Cell Biol. 1997, 137, 1185–1196. [Google Scholar] [CrossRef]
- van der Keyl, H.; Kim, H.; Espey, R.; Oke, C.V.; Edwards, M.K. Caenorhabditis elegans Sqt-3 mutants have mutations in the col-1 collagen gene. Dev. Dyn. 1994, 201, 86–94. [Google Scholar] [CrossRef] [PubMed]
- Novelli, J.; Ahmed, S.; Hodgkin, J. Gene Interactions in Caenorhabditis elegans Define DPY-31 as a Candidate Procollagen C-Proteinase and SQT-3/ROL-4 as Its Predicted Major Target. Genetics 2004, 168, 1259–1273. [Google Scholar] [CrossRef]
Primer Name | Primer Sequences (5′–3′) |
---|---|
GeneRacer5′ primer | CGACTGGAGCACGAGGACACTGA |
C-S1 | CCCTGTCCATAGGTTGCCCCAC |
GeneRacer5′ nested primer | GGACACTGACATGGACTGAAGGAGTA |
C-S2 | TCCAGGCACGGGAATGAGACGA |
GeneRacer3′ primer | TACCGTCGTTCCACTAGTGATTT |
M-A1 | GGGGCAACCTATGGACAGGGAGC |
GeneRacer3′ nested primer | CGCGGATCCTCCACTAGTGATTTCACTATAGG |
M-A2 | CTGGTCGTCTCATTCCCGTGCCT |
Col-F | ATGGAACCTAAAGAGCAG |
Col-R | TTAATGATATCCACCACTTTTTGCACTTGC |
Col-QF | GCTCTCCTGGTCGTCTCATT |
Col-QR | ACAACTGCCCTTATCTCCG |
MeActF | ACGGTCAAGTCATTACTGTTGGAAA |
MeActR | GTAAAGGTCTTTACGGATGTCAATG |
Col-BamHI | CGGATCCGAACCTAAAGAGCAGTTTTGC |
Col-NotI | TTGCGGCCGCAATGATATCCACCACTTTTTGCACT |
Col-IF 1 | TAATACGACTCACTATAGGGAGATGTAGCGGTTGTTGTTTCG |
Col-IR 1 | TAATACGACTCACTATAGGGAGATTTCCATTAGGTCCATCCTC |
TRVF | CTGGGTTACTAGCGGCACTGAATA |
TRVR | TCCACCAAACTTAATCCCGAATAC |
DcolF | TGTAGCGGTTGTTGTTTCG |
DcolR | TTTCCATTAGGTCCATCCTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pei, J.; Feng, T.; Long, H.; Chen, Y.; Pei, Y.; Sun, Y. Molecular Characterization and Virus-Induced Gene Silencing of a Collagen Gene, Me-col-1, in Root-Knot Nematode Meloidogyne enterolobii. Life 2022, 12, 2103. https://doi.org/10.3390/life12122103
Pei J, Feng T, Long H, Chen Y, Pei Y, Sun Y. Molecular Characterization and Virus-Induced Gene Silencing of a Collagen Gene, Me-col-1, in Root-Knot Nematode Meloidogyne enterolobii. Life. 2022; 12(12):2103. https://doi.org/10.3390/life12122103
Chicago/Turabian StylePei, Ji, Tuizi Feng, Haibo Long, Yuan Chen, Yueling Pei, and Yanfang Sun. 2022. "Molecular Characterization and Virus-Induced Gene Silencing of a Collagen Gene, Me-col-1, in Root-Knot Nematode Meloidogyne enterolobii" Life 12, no. 12: 2103. https://doi.org/10.3390/life12122103
APA StylePei, J., Feng, T., Long, H., Chen, Y., Pei, Y., & Sun, Y. (2022). Molecular Characterization and Virus-Induced Gene Silencing of a Collagen Gene, Me-col-1, in Root-Knot Nematode Meloidogyne enterolobii. Life, 12(12), 2103. https://doi.org/10.3390/life12122103