Systemic Resistance Induction of Potato and Tobacco Plants against Potato Virus Y by Klebsiella oxytoca
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation of the Rhizosphere Bacteria
2.2. Identification of the Rhizosphere Bacteria
2.3. Effect of Klebsiella Oxytoca and Biochar on PVYNTN Disease Severity
2.4. Assessment of PVYNTN Concentration by DAS–ELISA
2.5. Assessment of Antioxidant Enzymes
2.5.1. Polyphenol Oxidase (PPO)
2.5.2. Catalase (CAT) Activity
2.5.3. Superoxide Dismutase (SOD) Activity
2.6. Expression of PR-1b Gene by Real-Time RT-qPCR in Potato Plants
2.7. Expression of Defense Genes in Tobacco by Reverse Transcription PCR
2.8. Statistical Analysis
3. Results
3.1. Identification of Rhizosphere Bacteria
3.2. Effect of K. oxytoca and Biochar on PVYNTN Disease Severity
3.3. Effect of Klebsiella oxytoca and Biochar on PVYNTN Concentration
3.4. Evaluation of the Effect of Treatment with Klebsiella oxytoca and Biochar on Potato Growth Parameters
3.5. Effect of Treatment with Klebsiella oxytoca and Biochar on Antioxidant Enzymes Activity
3.6. Effect of Klebsiella oxytoca and Biochar on the Expression of PR-1b in Potato
3.7. Effect of Klebsiella oxytoca and Biochar on the Expression of Pathogenesis-Related Genes in Tobacco
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nasr-Eldin, M.; Messiha, N.; Othman, B.; Megahed, A.; Elhalag, K. Induction of potato systemic resistance against the Potato Virus Y (PVYNTN), using crude filtrates of Streptomyces spp. under greenhouse conditions. Egypt. J. Biol. Pest Control 2019, 29, 62. [Google Scholar] [CrossRef]
- Valkonen, J.P.T.; Gebhardt, C.H.; Zimnoch-Guzowska, E.; Watanabe, K.N. Resistance to Potato Virus Y in potato. In Potato Virus Y: Biodiversity, Pathogenicity, Epidemiology and Management; Lacomme, C., Glais, L., Bellstedt, D., Dupuis, B., Karasev, A., Jacquot, E., Eds.; Springer: Cham, Switzerland, 2017. [Google Scholar] [CrossRef]
- Aramburu, J.; Galipienso, L.; Matas, M. Characterization of Potato Virus Y isolates from tomato crops in northeast Spain. Eur. J. Plant Path. 2006, 115, 247–258. [Google Scholar] [CrossRef]
- Brunt, A.A. Potyviruses. In Virus and Virus-Like Diseases of Potato and Production of Seed-Potatoes; Loebenstein, G., Berger, P.H., Brunt, A.A., Lawson, R.H., Eds.; Kluwier Academic Publishers: Dordrecht, The Netherlands; Boston, MA, USA; London, UK, 2001; pp. 77–84. [Google Scholar]
- Kopp, A.; Bánfalvi, Z. Molecular mechanisms of resistance to potato virus X and Y in potato. Acta Phytopathol. Entomol. Hung. 2015, 50, 151–160. [Google Scholar] [CrossRef]
- Jetiyanon, K.; Kloepper, J.W. Mixtures of plant growth promoting rhizobacteria for induction of systemic resistance against multiple plant diseases. J. Biol. Control 2002, 24, 285–291. [Google Scholar] [CrossRef]
- Shaharoona, B.; Jamro, G.M.; Zahir, Z.A.; Arshad, M.; Memon, K.S. Effectiveness of various Pseudomonas spp. and Burkholderia caryophylli containing ACC-deaminase for improving growth and yield of wheat (Triticum aestivum L.). J. Microbiol. Biotechnol. 2007, 17, 1300–1307. [Google Scholar]
- Mazumdar, D.; Saha, S.P.; Ghosh, S. Klebsiella pneumoniae rs26 as a potent PGPR isolated from chickpea (Cicer arietinum) rhizosphere. J. Pharm. Innov. 2018, 7, 56–62. [Google Scholar]
- Dey, S.; Dutta, P.; Majumdar, S. Biological control of Macrophomina phaseolina in Vigna mungo L. by endophytic Klebsiella pneumoniae HR1. Jordan J. Biol. Sci. 2019, 12, 219–227. [Google Scholar]
- Liu, Y.; Wang, H.; Sun, X.; Yang, H.; Wang, Y.; Song, W. Study on mechanisms of colonization of nitrogen-fixing PGPB, Klebsiella pneumoniae NG14 on the root surface of rice and the formation of biofilm. Curr. Microbiol. 2011, 62, 1113–1122. [Google Scholar] [CrossRef]
- Zhang, M.; Zhang, C.; Zhang, S.; Yu, H.; Pan, H.; Zhang, H. Klebsiella jilinsis 2N3 promotes maize growth and induces resistance to northern corn leaf blight. Biol. Control 2021, 156, 104554. [Google Scholar] [CrossRef]
- Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Ozaki, K.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus in Arabidopsis thaliana by Trichoderma asperellum SKT-1. Plant Pathol. 2013, 29, 193–200. [Google Scholar] [CrossRef]
- Falcioni, T.; Ferrio, J.P.; del Cueto, A.I.; Giné, J.; Achón, M.Á.; Medina, V. Effect of salicylic acid treatment on tomato plant physiology and tolerance to Potato virus X infection. Eur. J. Plant Pathol. 2014, 138, 331–345. [Google Scholar] [CrossRef]
- Whitham, S.A.; Yang, C.; Goodin, M.M. Global impact: Elucidating plant responses to viral infection. Mol. Plant Microbe Interact. 2006, 19, 1207–1215. [Google Scholar] [CrossRef] [PubMed]
- Nasr-Eldin, M.A.; Othman, B.A.; Megahed, A.A.; El-Masry, S.S.; Faiesal, A.A. Physiological, cytological and molecular analysis of PVYNTN -infected potato cultivars. Egy. J. Exp. Biol. (Botany) 2018, 14, 171–185. [Google Scholar] [CrossRef]
- O’Donnell, P.J.; Schmelz, E.A.; Moussatche, P.; Lund, S.T.; Jones, J.B.; Klee, H.J. Susceptible to intolerance—A range of hormonal actions in a susceptible Arabidopsis pathogen response. Plant J. 2003, 33, 245–257. [Google Scholar] [CrossRef]
- Dzhavakhiya, V.G.; Ozertskoskaya, O.L.; Zinovyeva, S.V. Immune response. In Comprehensive and Molecular Phytopathology; Dyakov, Y.T., Dzhavakhiya, V.G., Korpela, T., Eds.; Elsevier: New York, NY, USA, 2007; pp. 265–314. [Google Scholar]
- Hull, R. Plant Virology, 5th ed.; Elsevier: London, UK, 2014; p. 1104. [Google Scholar]
- Musidlak, O.; Nawrot, R.; Gozdzicka-Jozefiak, A. Which plant proteins are involved in antiviral defense? Review on in vivo and in vitro activities of selected plant proteins against viruses. Int. J. Mol. Sci. 2017, 18, 2300. [Google Scholar] [CrossRef]
- Liu, D.; Chen, L.; Zhu, X.; Wang, Y.; Xuan, Y.; Liu, X.; Chen, L.; Duan, Y. Klebsiella pneumoniae SnebYK mediates resistance against Heterodera glycines and promotes soybean growth. Front. Microbiol. 2018, 9, 1134. [Google Scholar] [CrossRef]
- Le, K.D.; Kim, J.; Yu, N.H.; Kim, B.; Lee, C.W.; Kim, J.-C. Biological control of tomato bacterial wilt, kimchi cabbage soft rot, and red pepper bacterial leaf spot using Paenibacillus elgii JCK-5075. Front. Plant Sci. 2020, 11, 775. [Google Scholar] [CrossRef]
- Chen, M.; Li, Y.; Li, S.; Tang, L.; Zheng, J.; An, Q. Genomic identification of nitrogen-fixing Klebsiella variicola, K. pneumoniae and K. quasipneumoniae. J. Basic Microbiol. 2016, 56, 78–84. [Google Scholar] [CrossRef]
- Elsharkawy, M.M. Suppression of Potato Virus Y in tobacco by plant growth promoting fungi. Egypt. J. Biol. Pest Control 2016, 26, 695–700. [Google Scholar]
- Yang, X.; Liangyi, K.; Tien, P. Resistance of tomato infected with cucumber mosaic virus satellite RNA to potato spindle tuber viroid. Ann. Appl. Biol. 1996, 129, 543–555. [Google Scholar] [CrossRef]
- CHO, Y.K.; AHN, H.Y.E.K. Purification and characterization of polyphenol oxidase from potato: II. Inhibition and catalytic mechanism. J. Food Biochem. 1999, 23, 593–605. [Google Scholar] [CrossRef]
- Cakmak, I.; Marschner, H. Magnesium deficiency and high light intensity enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase in bean leaves. Plant Physiol. 1992, 98, 1222–1227. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wilmer, C.; Gaudin, A.; Solórzano, D.; Casas, A.; Luis, N.; Chudalayandi, P.; Medrano, G.; Kreuze, J.; Ghislain, M. Self-excision of the antibiotic resistance gene nptII using a heat inducible Cre-loxP system from transgenic potato. Plant Mol. Biol. 2006, 62, 71–82. [Google Scholar]
- Baebler, Š.; Krečič-Stres, H.; Rotter, A.; Kogovšek, P.; Cankar, K.; Kok, E.J.; Gruden, K.; Kovač, M.; Žel, J.; Pompe-Novak, M.; et al. PVYNTN elicits a diverse gene expression response in different potato genotypes in the first 12 h after inoculation. Mol. Plant Pathol. 2009, 10, 263–275. [Google Scholar] [CrossRef]
- Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus by Penicillium simplicissimum GP17-2 in Arabidopsis and tobacco. Plant Pathol. 2012, 61, 964–976. [Google Scholar] [CrossRef]
- Wang, S.; Wu, H.; Qiao, J.; Ma, L.; Liu, J.; Xia, F.; Gao, X. Molecular mechanism of plant growth promotion and induced systemic resistance to Tobacco mosaic virus by Bacillus spp. J. Microbiol. Biotechnol. 2009, 19, 1250–1258. [Google Scholar] [CrossRef]
- Takabatake, R.; Karita, E.; Seo, S.; Mitsuhara, I.; Kuchitsu, K.; Ohashi, Y. Pathogen-induced calmodulin isoforms in basal resistance against bacterial and fungal pathogens in tobacco. Plant Cell Physiol. 2007, 48, 414–423. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Bacillus licheniformis strain POT1 mediated polyphenol biosynthetic pathways genes activation and systemic resistance in potato plants against Alfalfa mosaic virus. Sci. Rep. 2020, 10, 16120. [Google Scholar] [CrossRef]
- Scholthof, K.-B.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P.; et al. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef]
- Singh, R.P.; Valkonen, J.P.; Gray, S.M.; Boonham, N.; Jones, R.A.; Kerlan, C.; Schubert, J. Discussion paper: The naming of Potato Virus Y strains infecting potato. Arch. Virol. 2008, 153, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Mahfouze, H.A.; El-Dougdoug, K.A.; Othman, B.A.; Gomaa, M.A.M. Molecular markers in potato cultivars treated with ribosome-inactivating proteins. Pest Technol. 2012, 6, 70–74. [Google Scholar]
- Abdalla, O.A.; Eraky, A.I.; Mohamed, S.A.; Fahmy, F.G. Management of Potato Virus Y (PVY-NTN) causing potato tuber necrotic ringspot disease (PTNRD) in potato by prior treatment with a mild PVY strain. J. Plant Prot. Res. 2018, 58, 130–136. [Google Scholar]
- Warren, M.; Krüger, K.; Schoeman, A.S. Potato Virus Y (PVY) and Potato Leaf Roll Virus (PLRV): Literature Review for Potatoes South Africa; Department of Zoology and Entomology, Faculty of Natural and Agricultural Sciences, University of Pretoria: Pretoria, South Africa, 2005. [Google Scholar]
- Hewedy, M.A.; Husseiny, S.M.; Salama, M.I.; NourEldein, H.A.; Abdelsalam, S.M. Reduction in Banana bunchy top virus infection rate by using Streptomyces chibaensi filtrates. Pak. J. Biotechnol. 2008, 5, 51–61. [Google Scholar]
- Petrov, N.; Stoyanova, M.; Andonova, R.; Teneva, A. Induction of resistance to Potato Virus Y strain NTN in potato plants through RNAi. Biotechnol. Biotechnol. Equip. 2015, 29, 21–26. [Google Scholar] [CrossRef]
- Latake, S.B.; Borkar, S.G. Characterization of marine actinomycete having antiviral activity against cucumber mosaic virus. Curr. Sci. 2017, 113, 1442–1447. [Google Scholar] [CrossRef]
- Mohammadi, M.; Kazemi, H. Changes in peroxidase and polyphenol oxidase activities in susceptible and resistant wheat heads inoculated with Fusarium graminearum and induced resistance. Plant Sci. 2002, 162, 491–498. [Google Scholar] [CrossRef]
- Garg, N.; Manchanda, G. ROS generation in plants: Boon or bane? Plant Biosyst. 2009, 143, 81–96. [Google Scholar] [CrossRef]
- Zhang, P.; Zhou, M.P.; Zhang, X.; Huo, Y.; Ma, H.X. Change of defensive-related enzyme in wheat crown rot seedlings infected by Fusarium graminearum. Cereal Res. Commun. 2013, 41, 431–439. [Google Scholar] [CrossRef]
- Blackman, L.M.; Hardham, A.R. Regulation of catalase activity and gene expression during Phytophthora nicotianae development and infection of tobacco. Mol. Plant Pathol. 2008, 9, 495–510. [Google Scholar] [CrossRef]
- ElMorsi, A.; Abdelkhalek, A.; Alshehaby, O.; Hafez, E.E. Pathogenesis-related genes as tools for discovering the response of onion defence system against iris yellow spot virus infection. Botany 2015, 93, 735–744. [Google Scholar] [CrossRef]
- Elhalag, K.M.; Messiha, N.A.S.; Emara, H.M.; Abdallah, S.A. Evaluation of antibacterial activity of Stenotrophomonas maltophilia against Ralstonia solanacearum under different application conditions. J. Appl. Microbiol. 2016, 120, 1629–1645. [Google Scholar] [CrossRef]
- Hoegen, E.; Strömberg, A.; Pihlgren, U.; Kombrink, E. Primary structure and tissue-specific expression of the pathogenesis-related protein PR-1b in potato. Mol. Plant Pathol. 2002, 3, 329–345. [Google Scholar] [CrossRef] [PubMed]
- Otulak-Kozieł, K.; Kozieł, E.; Lockhart, B. Plant cell wall dynamics in compatible and incompatible potato response to infection caused by Potato Virus Y (PVYNTN). Int. J. Mol. Sci. 2018, 19, 862. [Google Scholar] [CrossRef] [PubMed]





| Primer | Forward | Reverse | Reference |
|---|---|---|---|
| Coxa | 5-CGTCGCATTCCAGATTAT CAA-3 | 5-AA CTACGGATA TAT AAG AGC CAA AAC TG-3 | [28] |
| PR1b | 5-GTATGAATAATTCCACGTACCATATGTTC-3 | 5-GTGGAAACAAGAAGATGCAATACTTAGT-3 | [29] |
| Primer | Forward | Reverse | Reference |
|---|---|---|---|
| PR1 | GTGTAGAACCTTTGACCTGGGA | TTCGCCTCTATAATTACCTGGA | [31] |
| Coi1 | GGATTGACTGATTTGGCGAAGG | TCCCTCACTGGCTACAACTCGT | [31] |
| Actin | GGGTTTGCTGGAGATGATGCT | GCTTCGTCACCAACATATGCAT | [32] |
| Treatment | Shoot Length (cm/Plant) | Shoot Fresh Weight (g/Plant) | Shoot Dry Weight (g/Plant) |
|---|---|---|---|
| Control | 8.4 c * | 3.1 c | 0.40 c |
| Klebsiella oxytoca | 15.7 a | 7.8 a | 0.81 a |
| Biochar | 11.5 b | 5.9 b | 0.52 b |
| Treatment | PPO (µmol/g FW) | CAT (µmol/g FW) | SOD (µmol/g FW) |
|---|---|---|---|
| Control | 0.04 c * | 0.45 b | 0.40 b |
| Klebsiella oxytoca | 0.21 a | 0.56 a | 0.49 a |
| Biochar | 0.09 b | 0.44 b | 0.50 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elsharkawy, M.M.; Alotibi, F.O.; Al-Askar, A.A.; Adnan, M.; Kamran, M.; Abdelkhalek, A.; Behiry, S.I.; Saleem, M.H.; Ahmad, A.A.; Khedr, A.A. Systemic Resistance Induction of Potato and Tobacco Plants against Potato Virus Y by Klebsiella oxytoca. Life 2022, 12, 1521. https://doi.org/10.3390/life12101521
Elsharkawy MM, Alotibi FO, Al-Askar AA, Adnan M, Kamran M, Abdelkhalek A, Behiry SI, Saleem MH, Ahmad AA, Khedr AA. Systemic Resistance Induction of Potato and Tobacco Plants against Potato Virus Y by Klebsiella oxytoca. Life. 2022; 12(10):1521. https://doi.org/10.3390/life12101521
Chicago/Turabian StyleElsharkawy, Mohsen Mohamed, Fatimah O. Alotibi, Abdulaziz A. Al-Askar, Muhammad Adnan, Muhammad Kamran, Ahmed Abdelkhalek, Said I. Behiry, Muhammad Hamzah Saleem, Abdelmonim Ali Ahmad, and Amr Ahmed Khedr. 2022. "Systemic Resistance Induction of Potato and Tobacco Plants against Potato Virus Y by Klebsiella oxytoca" Life 12, no. 10: 1521. https://doi.org/10.3390/life12101521
APA StyleElsharkawy, M. M., Alotibi, F. O., Al-Askar, A. A., Adnan, M., Kamran, M., Abdelkhalek, A., Behiry, S. I., Saleem, M. H., Ahmad, A. A., & Khedr, A. A. (2022). Systemic Resistance Induction of Potato and Tobacco Plants against Potato Virus Y by Klebsiella oxytoca. Life, 12(10), 1521. https://doi.org/10.3390/life12101521

